ID: 1106325342

View in Genome Browser
Species Human (GRCh38)
Location 13:28684127-28684149
Sequence GTCTCCCGCCCCTGCAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106325336_1106325342 4 Left 1106325336 13:28684100-28684122 CCTGCAGATAGTAGCTACCCACT No data
Right 1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG No data
1106325335_1106325342 15 Left 1106325335 13:28684089-28684111 CCATAAATCTGCCTGCAGATAGT No data
Right 1106325342 13:28684127-28684149 GTCTCCCGCCCCTGCAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106325342 Original CRISPR GTCTCCCGCCCCTGCAGGCT TGG Intergenic
No off target data available for this crispr