ID: 1106327932

View in Genome Browser
Species Human (GRCh38)
Location 13:28711991-28712013
Sequence CAGTGTGACCAAATAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106327932_1106327935 -1 Left 1106327932 13:28711991-28712013 CCCAATTCTATTTGGTCACACTG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1106327935 13:28712013-28712035 GCTTCCCTGCAAGATAGTAAGGG 0: 1
1: 0
2: 0
3: 4
4: 131
1106327932_1106327934 -2 Left 1106327932 13:28711991-28712013 CCCAATTCTATTTGGTCACACTG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1106327934 13:28712012-28712034 TGCTTCCCTGCAAGATAGTAAGG 0: 1
1: 0
2: 0
3: 10
4: 110
1106327932_1106327936 0 Left 1106327932 13:28711991-28712013 CCCAATTCTATTTGGTCACACTG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1106327936 13:28712014-28712036 CTTCCCTGCAAGATAGTAAGGGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106327932 Original CRISPR CAGTGTGACCAAATAGAATT GGG (reversed) Intronic
901263216 1:7889121-7889143 AAGTGTAACAAAGTAGAATTTGG + Intergenic
904872124 1:33625423-33625445 CTGTGTGTCCAACTATAATTCGG - Intronic
905713012 1:40123361-40123383 CAGTGTGCCCAAAGAGGATTAGG + Intergenic
906431380 1:45758485-45758507 AAATTTGACCAAATAGATTTGGG + Intergenic
909229283 1:73064534-73064556 AAGTATGACCAAAGAGAAATAGG + Intergenic
909537017 1:76748348-76748370 CAGTGTAACCATATAGAAATGGG + Intergenic
909744434 1:79075915-79075937 CATTGATCCCAAATAGAATTGGG + Intergenic
910305844 1:85762985-85763007 CAATGTAACCACATAGAATAGGG + Intronic
911335784 1:96578497-96578519 CAGTGCCACCAGATGGAATTTGG - Intergenic
915999432 1:160600606-160600628 CAGTCTGACCAAAATGTATTAGG - Intergenic
916284855 1:163094951-163094973 CAGTGTGCCTAAAAAGTATTTGG - Intergenic
916304816 1:163318439-163318461 CAGTGAGATGAGATAGAATTGGG + Intronic
919217878 1:194583483-194583505 ATTTGTGACCAAATAGCATTTGG - Intergenic
919300783 1:195763181-195763203 CAGTGTGAGCAATGAGATTTTGG + Intergenic
920511443 1:206555339-206555361 CAGTGTGGCCACAGAGAATCTGG + Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065766123 10:29031299-29031321 CAGTGTGTACATATAGAAATAGG + Intergenic
1069616515 10:69809982-69810004 CAGAGTGATCAAATAGGATCTGG - Intronic
1072313359 10:94178419-94178441 CAGGTTGACCACACAGAATTGGG - Intronic
1076652170 10:131997304-131997326 CAGTGAGACCAAATCGAAAATGG + Intergenic
1078949126 11:16108855-16108877 CAGTGTAAGCAAATACATTTAGG - Intronic
1080262784 11:30367809-30367831 CTGTGTGATCAAATAAATTTAGG + Intergenic
1081214934 11:40384391-40384413 AAATGAGATCAAATAGAATTTGG - Intronic
1083765787 11:64840829-64840851 CAGTGTGACCATATGGAAAATGG + Intronic
1087501817 11:98965985-98966007 AAGTGTGACAAAATAAACTTTGG - Intergenic
1091353605 11:134916739-134916761 GAGTGTCTCCAAATAGACTTGGG + Intergenic
1091585760 12:1815686-1815708 CAGTGAGACCTGGTAGAATTCGG - Intronic
1092553989 12:9536072-9536094 CAGTCTAAACAAATTGAATTAGG - Intergenic
1092755577 12:11760172-11760194 CAGTGTGACTAATTATACTTGGG - Intronic
1093256105 12:16870283-16870305 CTGGGTTACCAAATAGAAATAGG + Intergenic
1093546769 12:20357865-20357887 AAGTGTGTCTAAATATAATTTGG + Intergenic
1094518108 12:31154556-31154578 CAGTCTAACCAAATTGAATTAGG + Intergenic
1100641428 12:96485276-96485298 AAGTGTGATCAAATACAATGGGG - Intergenic
1102083231 12:110115266-110115288 CAGTGTGCCGAAATGAAATTAGG + Intergenic
1102900901 12:116635972-116635994 CAGTGTGAACAAAGTGAAGTTGG + Intergenic
1103372934 12:120433191-120433213 CTCTGTGACCCCATAGAATTTGG - Intergenic
1106096280 13:26647130-26647152 CAGTGAGACTATATTGAATTTGG + Intronic
1106327932 13:28711991-28712013 CAGTGTGACCAAATAGAATTGGG - Intronic
1107607679 13:42077782-42077804 CATTCCAACCAAATAGAATTAGG + Intronic
1108114586 13:47112891-47112913 AAGTGTGACCACATAAAAATGGG - Intergenic
1109080103 13:57888168-57888190 CACTGGGACCCAAGAGAATTTGG + Intergenic
1109111587 13:58327449-58327471 CAGATAAACCAAATAGAATTAGG - Intergenic
1113802442 13:113093625-113093647 CAGTGGTACCAAATAGGATTTGG + Intronic
1117429844 14:55646011-55646033 CAGCCTGACCAAAAAGATTTAGG - Intronic
1118975128 14:70670248-70670270 CACTGTGACAAAATGGAATAGGG - Intronic
1120035134 14:79688017-79688039 TTGTGGGACCAAATAGAATATGG + Intronic
1120035140 14:79688064-79688086 AAGTGGGACCAAATAGAATATGG + Intronic
1120568784 14:86092237-86092259 CTGTGTGACCATTTAGAATTTGG - Intergenic
1120734370 14:88036788-88036810 CATTGTGACAAAAGAGAATTTGG + Intergenic
1126968675 15:54084803-54084825 AAGAGTGACCAAATGGCATTAGG - Intronic
1131958840 15:97766874-97766896 TAGTTTGACCAAATAAAAATGGG + Intergenic
1133433068 16:5755417-5755439 CAGTGTGAACCAATAAAATGGGG - Intergenic
1142924244 17:3219436-3219458 CAGTAAGATCAAATGGAATTAGG + Intergenic
1148939447 17:51195699-51195721 AAGTGTTACCAAGTAGGATTTGG - Intronic
1150052612 17:61979808-61979830 GGATGTGACCAAATAGAAGTTGG - Intronic
1153256393 18:3175930-3175952 CAGTGTGATCACACAGCATTGGG + Intronic
1154453026 18:14494454-14494476 CAATGTGCCCAAATAGCATAGGG - Intergenic
1156133745 18:34009902-34009924 CACTGTGATCCAATGGAATTAGG - Intronic
1159506266 18:69340709-69340731 GAATGTGACCTAAAAGAATTTGG + Intergenic
1161877065 19:6919919-6919941 CACTGTCACCAAACAGAACTAGG + Intronic
1162272779 19:9629909-9629931 GAATTTGACCAAATAGATTTGGG - Intronic
926207383 2:10843537-10843559 TAGTGTGTCCAAATACAAATGGG + Intergenic
927658995 2:24976043-24976065 CACTGTGAACAAAGAAAATTTGG + Intergenic
929202556 2:39252559-39252581 CAGTGTGACCAACTACCAGTTGG + Intronic
930833185 2:55767475-55767497 CTGTGTGCCCATATAGAATATGG + Intergenic
931222410 2:60299758-60299780 AAGTATGACCAAAGAGGATTTGG - Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
933582501 2:84143502-84143524 GAGTGTGAGGAAATTGAATTTGG + Intergenic
939445535 2:142305218-142305240 CAGAGAGACAAAAGAGAATTTGG + Intergenic
939453873 2:142408161-142408183 CAGTGTTGCCAGAAAGAATTGGG - Intergenic
939514951 2:143154761-143154783 CAATGAGAAAAAATAGAATTTGG - Intronic
940340506 2:152576127-152576149 CAGTGGGTCCAAGTAGAAGTGGG + Intronic
940562874 2:155323946-155323968 CAATGTTTCCAAAAAGAATTAGG - Intergenic
942739769 2:179161889-179161911 CAGTGTGATGAAATCAAATTTGG - Intronic
942767264 2:179471155-179471177 AATTGTGACCATAAAGAATTGGG + Intronic
943375576 2:187072368-187072390 CAGAGTCACAAAATAGAATGAGG - Intergenic
943711946 2:191106817-191106839 AAGTGCGACCTATTAGAATTAGG + Intronic
943960557 2:194257283-194257305 CAGTGTGAACAAAAAGGACTTGG + Intergenic
945338696 2:208623728-208623750 CAATGTTATCAATTAGAATTTGG - Intronic
946113917 2:217445265-217445287 CAGAGTGACCCTATAGAGTTTGG - Intronic
946370088 2:219275953-219275975 TATTGTGACCAAATAGAATGAGG - Intronic
948299826 2:236896096-236896118 CATTTTGACCAAAAAGAATGAGG + Intergenic
1174270137 20:49362327-49362349 CACTGCTAACAAATAGAATTTGG + Intergenic
1175377802 20:58541421-58541443 CTGTGTGATCAGATATAATTTGG - Intergenic
1176443005 21:6793795-6793817 CAATGTGCCCAAATAGCATAGGG + Intergenic
1176756379 21:10728720-10728742 GAATGGGACCAAATAGAATGTGG - Intergenic
1176821162 21:13658809-13658831 CAATGTGCCCAAATAGCATAGGG + Intergenic
1182140192 22:27948169-27948191 CAGTGTTTACAAATACAATTTGG + Intergenic
1183304903 22:37077388-37077410 CACTGTGGCCAGATAGACTTAGG - Intronic
949680595 3:6509421-6509443 CAGTTTGACCACATTGAACTGGG + Intergenic
956366677 3:68510749-68510771 CAGTGGGAAGAAATTGAATTGGG - Intronic
959519475 3:107309006-107309028 CAGTCTGATCTAATTGAATTTGG + Intergenic
959582769 3:107999203-107999225 TAGTGTTACCAAACAGAATCTGG + Intergenic
960547099 3:118927963-118927985 TACTGAGACCAAATAGATTTAGG - Intronic
964991771 3:162821460-162821482 CAGTCTTTCCAAATTGAATTTGG - Intergenic
968443792 4:637978-638000 CAGTGTTATCAAGTAGAATACGG + Intronic
973114540 4:46438976-46438998 CACTGTTACCGAATAAAATTTGG + Intronic
973680199 4:53309474-53309496 AAGTGTGACCACAGAGGATTAGG + Intronic
973705107 4:53573456-53573478 CAGTGTGAGGAAATAGCATTTGG - Intronic
975424051 4:74205887-74205909 CAGTGGCACAAAATAAAATTTGG + Intronic
975734239 4:77366268-77366290 CAGTGTGTCCAAACACAACTGGG + Intronic
976561540 4:86507310-86507332 TAGATTGACCAAATACAATTTGG + Intronic
976651093 4:87435663-87435685 CAGTGTGAAAAAATAGAAAAGGG + Intronic
977140574 4:93366427-93366449 CAGTGTGACCAAAATTTATTAGG - Intronic
977692164 4:99925402-99925424 CTTTGTGACCAAATGCAATTTGG - Intronic
979776573 4:124596053-124596075 TAGTTTGACCAAAAAGAAATAGG + Intergenic
980677665 4:136110065-136110087 TAGTGTGACTTAACAGAATTGGG - Intergenic
981641552 4:146949531-146949553 CAGAGTAACCAAATACAATATGG - Intergenic
983053123 4:163071462-163071484 CATTGTTACCAAATTGAACTTGG - Intergenic
984155093 4:176186727-176186749 ATGTGTGATCAAATAGAGTTTGG + Intronic
984796721 4:183667908-183667930 AAGTCTGAAAAAATAGAATTAGG - Intronic
984830897 4:183971964-183971986 CAGTGTGACCTACTGGATTTCGG - Intronic
987662650 5:20896814-20896836 CAGGGTGACAAAATAAAATTTGG + Intergenic
988600059 5:32631439-32631461 AAGTGTGACCAAATTAAGTTAGG + Intergenic
988634779 5:32970881-32970903 AAGTGTCACTAAATACAATTTGG + Intergenic
988760932 5:34308500-34308522 CAGGGTGACAAAATAAAATTTGG - Intergenic
988943877 5:36174686-36174708 CAGAGTAACCAGATAGAATGTGG + Intronic
990958311 5:61365754-61365776 GAGTGTGTGCAAATAGCATTAGG + Intronic
993099486 5:83519771-83519793 CAGATTGAACAAATAGAAGTGGG + Exonic
993862332 5:93151084-93151106 CAGTGTGAACAAAAAAAATAAGG + Intergenic
994411570 5:99412903-99412925 CAGGTTGACCAAATAAAATATGG - Intergenic
994482257 5:100352347-100352369 CAGGTTGACCAAATAAAATATGG + Intergenic
994912294 5:105927099-105927121 CAGTGTTAGCAACTGGAATTTGG + Intergenic
995407895 5:111822380-111822402 CAGTTTGATATAATAGAATTAGG + Intronic
996990786 5:129628209-129628231 CAGTGAGAACAAATGGTATTTGG - Intronic
1000078899 5:157824814-157824836 CAGTGTGACATAATAGAAAATGG - Intronic
1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG + Intergenic
1000303462 5:159975314-159975336 TAGTGTAAGCAAATGGAATTTGG + Intergenic
1004164534 6:13244410-13244432 CAGTGTGACCAAAATTTATTAGG + Intronic
1005574935 6:27181829-27181851 AAATATGACCAAATAGATTTGGG - Intergenic
1005804039 6:29457157-29457179 CAGTTTTAACAAATAGAATCTGG - Intergenic
1007371684 6:41430337-41430359 CATTGTAATCAAATTGAATTCGG + Intergenic
1008276076 6:49545728-49545750 CAGTCTGATCAAATAGTATCAGG + Intergenic
1008577193 6:52872534-52872556 CAGTGTGCCCATCTATAATTAGG - Intronic
1008628220 6:53338304-53338326 CAGTGTGACCCAAGGGAAGTTGG - Intronic
1009296543 6:61957602-61957624 CAGTCTGACCAAAAATTATTAGG - Intronic
1012787378 6:103648203-103648225 CAGTTTATCCAAATAGAGTTTGG - Intergenic
1015828325 6:137340087-137340109 CAGAGTGACCTCATACAATTGGG - Intergenic
1017083677 6:150693543-150693565 CAGTGTGACCAAAGAGAGGGTGG - Intronic
1017251489 6:152284910-152284932 TAGTGTGACGACATAGAAATAGG - Intronic
1018036876 6:159889314-159889336 CAGAGTGACCAACTAGAAGGAGG - Intergenic
1018414375 6:163588717-163588739 CAGTGTGACCGTAGAGAATAAGG - Intergenic
1021039561 7:15845192-15845214 CAATATGACCAAGTAGAAGTGGG + Intergenic
1023185271 7:37526571-37526593 CAGTGTGACCAAAAGGAATCTGG - Intergenic
1024037816 7:45523713-45523735 AAGTGTAACCCAATAGGATTTGG + Intergenic
1024120914 7:46238781-46238803 AACTGTTAGCAAATAGAATTTGG + Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024693098 7:51824295-51824317 CAGTGGGAGCAAAGAGAATATGG - Intergenic
1024871771 7:53971739-53971761 CACTGTGACAAAGTAGTATTTGG + Intergenic
1028503984 7:91551364-91551386 TACTGTGAACAAATAGAATGAGG - Intergenic
1030396726 7:108995388-108995410 CAGAGAGACCAAAAAGAATCTGG - Intergenic
1030410747 7:109176581-109176603 CATTGTCACCAAATAGAATTGGG + Intergenic
1031228233 7:119069709-119069731 CAGTGTGCCCAGAGAGAATTTGG - Intergenic
1031490216 7:122378264-122378286 CAGTATGACAAAATAGAAAAAGG + Intronic
1032697372 7:134348932-134348954 CAGTGTGAACCAATATAACTGGG - Intergenic
1038702592 8:29862981-29863003 TAGTGTTACCAAACTGAATTTGG + Intergenic
1039739223 8:40365549-40365571 TAGAGTAACAAAATAGAATTGGG - Intergenic
1039743604 8:40404229-40404251 CGGGGAGACCAAATAGAATAAGG + Intergenic
1042107583 8:65345214-65345236 AAATGTTAGCAAATAGAATTCGG + Intergenic
1042878809 8:73465203-73465225 CAGTGTGGCCAAATAGCACTGGG + Intronic
1043528879 8:81128080-81128102 CAGTGTTTCCAAAGAGCATTAGG + Intergenic
1044045715 8:87429414-87429436 CAGTGTACCCAAATAGGATCTGG + Intronic
1047447619 8:124933598-124933620 CAGTGTGACCAAAATTTATTAGG - Intergenic
1047995844 8:130335005-130335027 CAGTGTGGCCAGAGAGAATTTGG - Intronic
1048053204 8:130838874-130838896 CAATGTGACCAAATGCAATGTGG + Intronic
1048386877 8:133920297-133920319 CAGTGTGAACACATAGAAATGGG - Intergenic
1051768845 9:20554076-20554098 CAGTTTGAACAAACAGTATTTGG - Intronic
1052168625 9:25365244-25365266 CAGGCTGACCAAATAGACTCTGG - Intergenic
1053659043 9:40251516-40251538 AATTTTGAACAAATAGAATTAGG - Intronic
1053909416 9:42880889-42880911 AATTTTGAACAAATAGAATTAGG - Intergenic
1054360078 9:64104296-64104318 AATTTTGAACAAATAGAATTAGG - Intergenic
1054371167 9:64397816-64397838 AATTTTGAACAAATAGAATTAGG - Intronic
1054525555 9:66124706-66124728 AATTTTGAACAAATAGAATTAGG + Intronic
1054678794 9:67887535-67887557 AATTTTGAACAAATAGAATTAGG - Intronic
1054768897 9:69066744-69066766 CAGTGTGTCCAAATACGATATGG - Intronic
1056412609 9:86346133-86346155 CAGTGTGATTTAATAGGATTAGG - Intronic
1057526359 9:95805997-95806019 AAGTGTGATAAACTAGAATTAGG + Intergenic
1057999300 9:99848864-99848886 CAGTCTGACCAGAAAGAATGAGG - Intronic
1060617436 9:125031060-125031082 CAGTGGGACAAAACAGATTTGGG + Intronic
1203526198 Un_GL000213v1:90736-90758 CAATGTGCCCAAATAGCATAGGG - Intergenic
1187148285 X:16657431-16657453 CAGGGTGACCAAAGTGAACTGGG + Intronic
1188406195 X:29813221-29813243 TAGTGTGAAAAATTAGAATTAGG + Intronic
1195485062 X:105395164-105395186 TAATGTGACTAAATGGAATTAGG + Intronic
1197167817 X:123397694-123397716 CAGTATGTCCAAATACAATTGGG - Intronic
1198420259 X:136464872-136464894 CAGTGTCAACAAGTAGAATAAGG - Intergenic
1198630116 X:138627826-138627848 CAGTATGCCCACATAGAAATTGG + Intergenic
1200683145 Y:6236326-6236348 AAGTGTGGCCAAATGGAAGTGGG - Intergenic
1200832318 Y:7699210-7699232 TAGTGTGGCCGAATGGAATTGGG + Intergenic
1201049487 Y:9918060-9918082 AAGTGTGGCCAAATGGAAGTGGG + Intergenic