ID: 1106328395

View in Genome Browser
Species Human (GRCh38)
Location 13:28716684-28716706
Sequence TACTCATTTCCTCATTCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106328395_1106328399 21 Left 1106328395 13:28716684-28716706 CCATGGGAATGAGGAAATGAGTA 0: 1
1: 0
2: 3
3: 29
4: 300
Right 1106328399 13:28716728-28716750 TGCCTAACCTCACCCCAGCAAGG 0: 1
1: 1
2: 3
3: 24
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106328395 Original CRISPR TACTCATTTCCTCATTCCCA TGG (reversed) Intronic
900200070 1:1400583-1400605 TACTCATGTCCTCTTTCCCCAGG + Exonic
905149886 1:35919321-35919343 CACTCATTTCCTTCTACCCAAGG - Intronic
905389217 1:37625541-37625563 TACTCACTTCCTCAGTCTCCTGG - Intronic
905461020 1:38123094-38123116 TAACCATTCTCTCATTCCCAGGG - Intergenic
906454793 1:45984864-45984886 TACTCATTTACTCATTTTTATGG - Intronic
906570502 1:46834095-46834117 TCCTCATTTCCTTCTTCCCCAGG + Intergenic
907637482 1:56150735-56150757 TACTCACTCCTTCATTTCCAAGG + Intergenic
907710260 1:56874307-56874329 GACTCACTTCCTCAGTCACAGGG - Intronic
907844666 1:58193166-58193188 TACTCACTTCCCTCTTCCCAGGG - Intronic
909931714 1:81504856-81504878 TATTCATCTCCTCATACCCTGGG - Intronic
910980301 1:92953728-92953750 TCCTCATTTCCTCCTGCCCCTGG - Intronic
910984914 1:92996074-92996096 TAGTCATTTCTTCTGTCCCAGGG + Intergenic
911044566 1:93617758-93617780 TAATCATTGCCTACTTCCCAGGG - Intronic
911474166 1:98355925-98355947 TTCTCATTTACTCATCTCCATGG - Intergenic
911642441 1:100303525-100303547 TAGTCTTCTCCTCTTTCCCAGGG - Intergenic
912061156 1:105672516-105672538 TAAGCATTTCCTCATTCTTAAGG + Intergenic
912578823 1:110701881-110701903 GACTCATTCCCTTATCCCCAAGG + Intergenic
913477696 1:119254518-119254540 TACTCATCTCCTCATTCCATTGG + Intergenic
913669753 1:121085601-121085623 TACTGATTTCCTCTTTCACTAGG + Intergenic
914021516 1:143872999-143873021 TACTGATTTCCTCTTTCACTAGG + Intergenic
914660006 1:149780916-149780938 TACTGATTTCCTCTTTCACTAGG + Intergenic
914865983 1:151429263-151429285 TACACATCTCCTCATTTGCACGG - Intronic
915119577 1:153620648-153620670 TACTCATCACTTCATTCACATGG - Intronic
915323242 1:155067483-155067505 CACTCCTTCCCTCCTTCCCAAGG - Intronic
915705347 1:157838536-157838558 TATTTATTTCTTCTTTCCCATGG - Intronic
917666238 1:177228548-177228570 CACTCCTTGCCTCATCCCCAGGG + Intronic
918386653 1:184014882-184014904 TACTTACTTCATCATTTCCATGG - Intronic
918434793 1:184500336-184500358 GAATCATTTCATCATTCCCGAGG - Intronic
918994926 1:191745298-191745320 TCATCATGTCCTCTTTCCCAGGG - Intergenic
919051748 1:192519993-192520015 TACCCATTTTCTCACACCCATGG + Intergenic
920082350 1:203384195-203384217 TGTTAATTTCCTGATTCCCATGG - Intergenic
921324715 1:213979389-213979411 GACTCCTTGCCGCATTCCCACGG + Intergenic
921709907 1:218363701-218363723 TACACCTTTCCTGATCCCCATGG + Intronic
1063771349 10:9205794-9205816 TAGCCATTTCCTCATTCTCTGGG - Intergenic
1064149723 10:12852577-12852599 TACACATCTCTTCATTCACATGG - Intergenic
1066410425 10:35163350-35163372 TTCTCATTTTCTCATCTCCAAGG + Intronic
1066535836 10:36390385-36390407 TATTTATTTTCTTATTCCCAGGG + Intergenic
1067968654 10:50943556-50943578 TATTGTTTTTCTCATTCCCAGGG + Intergenic
1069731010 10:70613438-70613460 TACTACTTCCCTCCTTCCCAAGG + Intergenic
1069862693 10:71481373-71481395 TCCCCATTTCCTGACTCCCAAGG - Intronic
1070988385 10:80708779-80708801 TACTCAAATCCTCATTCCTTTGG + Intergenic
1072807352 10:98432395-98432417 TATTCATCTCTTTATTCCCATGG + Intronic
1073341553 10:102748659-102748681 TACTCATTTGATGGTTCCCAGGG - Intronic
1074279793 10:112040028-112040050 TACTCATTTCCTGTTTGCCCTGG - Intergenic
1074633312 10:115283822-115283844 TACTCATCTACTCATTCCCTAGG + Intronic
1076236242 10:128865375-128865397 GACTCATTTCCTCCTTCCATGGG - Intergenic
1077013150 11:388437-388459 AACTCATCTCCTCATCCCCTAGG - Intergenic
1079767497 11:24413641-24413663 TACTCAATTCCAGATTCCAAAGG + Intergenic
1086011692 11:82111879-82111901 TAATCATTTCTTCATTCCCAGGG + Intergenic
1086136987 11:83451543-83451565 TGCTCATTTGCTCATACCCTTGG - Intergenic
1087592229 11:100204898-100204920 TACGCATTTCATCATTCTCCAGG - Intronic
1088162739 11:106893179-106893201 TAAACATCTCCTCAGTCCCAGGG + Intronic
1088335955 11:108704115-108704137 ATCTCATCTACTCATTCCCAGGG - Intronic
1088464932 11:110124959-110124981 TCCCAATTTTCTCATTCCCATGG - Intronic
1089617043 11:119700611-119700633 TGTTCACTTCCACATTCCCAGGG + Intronic
1090441446 11:126728473-126728495 TACTCACTGCTTTATTCCCAGGG + Intronic
1092507197 12:9115436-9115458 TTCTTATTTCCTCTTTCTCAAGG - Intronic
1092786251 12:12029650-12029672 CACTCATATCCTGATTCCCCTGG + Intergenic
1094317777 12:29150765-29150787 TACTCTTTTCCTAATTCTGAGGG + Intronic
1095321242 12:40830222-40830244 TGCTCAGTTCCTGCTTCCCACGG + Intronic
1096013146 12:48240221-48240243 TATTCATTTCCTTATTCTGAGGG - Intergenic
1096594788 12:52688000-52688022 GACTCTCTTCCTGATTCCCAAGG + Intergenic
1096764060 12:53868677-53868699 CAATCATTTCCTCATTCCTTGGG + Intergenic
1100585548 12:95976305-95976327 TACCTTTTTGCTCATTCCCAAGG + Intronic
1101396510 12:104353383-104353405 AACTCATTTGCCCATTCTCATGG - Intergenic
1102861371 12:116339228-116339250 TACCCACTTCCTCATTACCAAGG - Intergenic
1106328395 13:28716684-28716706 TACTCATTTCCTCATTCCCATGG - Intronic
1106360279 13:29025196-29025218 TCCTCAGTTCCTCATTGTCAAGG - Exonic
1106691920 13:32126786-32126808 TACTGTTTCCTTCATTCCCAGGG + Intronic
1107627471 13:42304563-42304585 TACACCTTTCTTCATTCACAAGG + Intronic
1107648914 13:42524660-42524682 TTTTCATTTCCTCATAGCCATGG - Intergenic
1109077263 13:57852391-57852413 TGCTCTTATCCTCATTGCCAAGG - Intergenic
1110369139 13:74720182-74720204 TACTCATTTTCCCATTCCAAAGG - Intergenic
1112110667 13:96294571-96294593 CACTCATTTTCTCATTCCAGAGG + Intronic
1112988046 13:105476714-105476736 TCCTAATTTCCTTATACCCAAGG + Intronic
1113928407 13:113953502-113953524 AGCTCATTTCCTCAAACCCAGGG - Intergenic
1114334084 14:21670038-21670060 TCTTCATTTCTTCATTCCTAAGG + Intergenic
1114761968 14:25325962-25325984 TGGTCATTTCCACATCCCCAGGG + Intergenic
1115582149 14:34771760-34771782 AAATCATTTCCTCAATCTCAAGG + Intronic
1116828393 14:49693662-49693684 TATATATTTCCTTATTCCCACGG + Intronic
1117517261 14:56514347-56514369 GCCTCATTTCGTCCTTCCCAAGG - Intronic
1118300558 14:64611855-64611877 TACTCAGCTCATCACTCCCATGG + Intergenic
1118777102 14:68979745-68979767 CATTCATTTTCTCTTTCCCAGGG + Intergenic
1120037344 14:79712894-79712916 TATTTATTTCCTCATTTTCAAGG + Intronic
1120417014 14:84232057-84232079 TACACATTTACTCATCACCAAGG + Intergenic
1120568377 14:86087403-86087425 TACTCTTATCCTGAGTCCCAGGG + Intergenic
1122895427 14:104754292-104754314 GAGTCTTTCCCTCATTCCCAAGG - Intronic
1122898475 14:104772127-104772149 TCCTCATTTCCTCCTCCCCTCGG - Intronic
1123872206 15:24588338-24588360 TACTTTTTTTCTCTTTCCCATGG - Intergenic
1124690916 15:31822210-31822232 TACTGAGTTCCTCATACACATGG - Intronic
1126069560 15:44853978-44854000 TCCTTTTTTTCTCATTCCCAAGG + Intergenic
1126334366 15:47570239-47570261 TCCGCATTTCCTCAATCACAGGG - Intronic
1127759098 15:62120559-62120581 CCCTCATTCCCTCCTTCCCAAGG + Intergenic
1127959623 15:63881091-63881113 TAATAATATCCTCTTTCCCAGGG - Intergenic
1129208199 15:74049818-74049840 AACTCAATTCCTAATTCCTAAGG - Intergenic
1129295375 15:74597161-74597183 TATTCATCTCCTCATACCCTGGG - Exonic
1130238925 15:82166968-82166990 TAATCATTTCAGAATTCCCAGGG + Intronic
1130753335 15:86736717-86736739 TACTTATGTCCTTATCCCCATGG - Intronic
1131053850 15:89364215-89364237 TGCTCCTTTCCTGAGTCCCACGG - Intergenic
1133620643 16:7522993-7523015 TCCTCCTTGCCTCATCCCCAGGG + Intronic
1133870492 16:9681274-9681296 TTTTCATTTCCTCATTCACTGGG + Intergenic
1134039217 16:11055123-11055145 CACTCATTTCTTCACCCCCAAGG - Intronic
1134259956 16:12643189-12643211 CTCTGACTTCCTCATTCCCATGG + Intergenic
1134424551 16:14127747-14127769 TACTCCTTTCCTCTTTCTCCAGG + Intronic
1134447709 16:14343435-14343457 TCCTCATTTCTTTATTTCCATGG + Intergenic
1136175762 16:28515157-28515179 GACTCACTCCCTAATTCCCATGG + Intergenic
1136294405 16:29293420-29293442 TGCTCATCTCCTCATGCCCAGGG + Intergenic
1136598893 16:31270933-31270955 TACTCTTTTCCCCTTCCCCAGGG + Exonic
1137037417 16:35578378-35578400 TCCTCATATCCTAATTACCAGGG - Intergenic
1137497286 16:48980302-48980324 TTCTCTTCTCCTTATTCCCACGG + Intergenic
1138084960 16:54125026-54125048 CACTCATTTCCCCATTCACTGGG + Intergenic
1138878750 16:60984812-60984834 TACTCAGTTCCTTTATCCCAGGG - Intergenic
1139511130 16:67429216-67429238 TACTCCCTTCCTCACTCCAAGGG + Intergenic
1143425494 17:6832848-6832870 TACTCATCGCTTCATTCGCATGG + Intergenic
1145758892 17:27414254-27414276 TTCTCATTTCCTTATTCCTCTGG + Intergenic
1145862336 17:28221505-28221527 CAGGCATTTCCTCATGCCCAGGG - Intergenic
1146553845 17:33806036-33806058 TTCTCACTCACTCATTCCCATGG + Intronic
1146619146 17:34383126-34383148 TACTCATCTCCCCAGTCCTAAGG - Intergenic
1147927975 17:43956856-43956878 CAGGCATTTCCTCATGCCCAGGG + Intronic
1148476987 17:47935203-47935225 TTCTCATTTCCTTTTGCCCAAGG - Intergenic
1150602980 17:66666593-66666615 TCCTCATTTCCTACTACCCAAGG + Intronic
1153258969 18:3202858-3202880 TACTCTTTTCAACATTCTCAAGG + Intronic
1153678672 18:7479146-7479168 TATCCTTTTCCTCATTCTCATGG + Intergenic
1155232133 18:23784136-23784158 TACTCATTCCCTATTTGCCAAGG + Exonic
1155267352 18:24106625-24106647 TACTCATCCCCTCATCCCCATGG - Intronic
1155686466 18:28558155-28558177 TCTTCATTTCCTCATTCCCTAGG - Intergenic
1156311134 18:35923115-35923137 TACTTATATCCTCATTCCTCAGG + Intergenic
1158090871 18:53711582-53711604 CATTCGTTTTCTCATTCCCATGG + Intergenic
1160031016 18:75260084-75260106 TATTCATTTACTAATTCACAAGG - Intronic
1160549273 18:79682770-79682792 TAATCAGTCCCTCATTCTCACGG - Intronic
1161912267 19:7203445-7203467 TTCCCACTTCCTCGTTCCCATGG - Intronic
1163073629 19:14867579-14867601 TACTCTATTCCTCATTCCCGAGG + Intergenic
1166433090 19:42742581-42742603 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166449050 19:42881783-42881805 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166453447 19:42919986-42920008 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166455935 19:42939296-42939318 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166471866 19:43084774-43084796 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166483002 19:43188591-43188613 TTTTCATTTTCTCACTCCCAGGG + Intronic
1166492634 19:43271629-43271651 TTTTCATTTTCTCACTCCCAGGG + Intergenic
1167050447 19:47074851-47074873 CCCTCATGTACTCATTCCCAGGG + Intronic
1167562757 19:50235810-50235832 TACTCAGCTCATCATTCCCATGG + Intronic
927313316 2:21654335-21654357 TATTTATTTCCTAATTCCCTAGG + Intergenic
927583299 2:24274812-24274834 TACTCATCTACTCTTTACCAAGG + Intronic
928488991 2:31761624-31761646 TAGTCATATCCTTATTCCCAGGG + Intergenic
928600922 2:32902860-32902882 AACTCAGTTCCTCAGTCACACGG + Intergenic
928651254 2:33405864-33405886 TATTCATTTCCATATTCCCAGGG - Intergenic
929563617 2:42970849-42970871 TCCTCTTTGCCTCACTCCCAGGG + Intergenic
929618920 2:43334992-43335014 TCCCCATTGCCTCATTCTCAAGG - Intronic
929690667 2:44070040-44070062 TCCACATTCTCTCATTCCCATGG - Intergenic
929887284 2:45890284-45890306 TACCCATTTCCTCTTTCCCTCGG + Intronic
930218024 2:48717030-48717052 TACTGTTCTCATCATTCCCATGG + Intronic
931579670 2:63759411-63759433 TACTCAAGTCCCCTTTCCCAGGG - Intronic
932988572 2:76758759-76758781 TATTCATTTCATTATTCACATGG + Intronic
933836410 2:86249379-86249401 CACTGCTTTCCTCATTCTCAAGG + Intronic
934817451 2:97340989-97341011 TACTTATTTGCTCATTGGCAGGG - Intergenic
934820245 2:97367495-97367517 TACTTATTTGCTCATTGGCAGGG + Intergenic
934909917 2:98242286-98242308 TGCTCAATACCTCATTTCCAAGG - Intronic
935785542 2:106545269-106545291 TACTCCTTTCCACATCGCCAGGG - Intergenic
935811100 2:106797872-106797894 CAATCATTTCCTCATTTGCAGGG + Intergenic
935885846 2:107618148-107618170 AACTGTTTTCCTCATTCCCCAGG + Intergenic
939920929 2:148112292-148112314 TACTAATATCCTATTTCCCAAGG + Intronic
940365464 2:152843811-152843833 TACTGACTTCCATATTCCCAGGG + Intergenic
941740570 2:169030742-169030764 TACTCATTTCTTCATTGTCCCGG - Intronic
943040236 2:182796008-182796030 AACTCATTTGCTCAGTTCCATGG - Intergenic
943214679 2:185015334-185015356 TACTTACTACCTCATTCACATGG - Intergenic
945834508 2:214822764-214822786 TCCTCTCTTCCTCCTTCCCATGG - Intergenic
946300722 2:218822540-218822562 TTCTCAATTGCTCATTCTCAGGG + Exonic
947098615 2:226594307-226594329 TTCTCATTTTCCCTTTCCCAAGG - Intergenic
947446371 2:230166687-230166709 TACTCACTTGCTCAATCCCCAGG - Intergenic
947848443 2:233264405-233264427 AACTCATTTCCCTTTTCCCAAGG - Intronic
948832494 2:240605007-240605029 TACTGAAGTCCTCATCCCCAAGG - Intronic
1168803289 20:657761-657783 TCCTCATTTCCTCATCCAAATGG - Intronic
1169419408 20:5447760-5447782 TACTCCTTGCCTCCCTCCCAAGG + Intergenic
1170859461 20:20089260-20089282 AAAGCATTTCCTCATCCCCATGG + Intronic
1171723253 20:28587792-28587814 GACTAATTTCCTCATCCCCTAGG - Intergenic
1171754800 20:29095315-29095337 GACTAATTTCCTCATCCCCTAGG + Intergenic
1171787853 20:29487227-29487249 GACTAATTTCCTCATCCCCTAGG - Intergenic
1171860092 20:30392163-30392185 GACTAATTTCCTCATCCCCTAGG + Intronic
1172854386 20:37990685-37990707 TAGTCATTTCCTCATTCTGCAGG - Intronic
1172940960 20:38654389-38654411 ACCTCATTCACTCATTCCCAGGG + Intergenic
1173059357 20:39646903-39646925 TACTCTTTTCCTCATTCATTAGG - Intergenic
1174903712 20:54527627-54527649 TACTCACTTCCACCTTCCCAGGG - Intronic
1175321941 20:58094443-58094465 CACTCATCTCCACATCCCCAGGG - Intergenic
1175718291 20:61269868-61269890 TACTCATTTCCACATGGCCCCGG + Intronic
1176658061 21:9605858-9605880 TTCTCATTGCATCATTTCCAGGG - Intergenic
1177911968 21:27044027-27044049 TGCTAATTTTCTCATTCCCATGG - Intergenic
1178187011 21:30234129-30234151 TCTTCATTTCCTCCTTCTCAAGG - Intergenic
1178884425 21:36474097-36474119 GCCTCATTTCCTGATTCCCCTGG - Intronic
1179299399 21:40092733-40092755 TCATCATTTTCTCATTCTCAGGG + Intronic
1180296807 22:10946441-10946463 GACTAATTTCCTCATCCCCTAGG - Intergenic
1180334362 22:11561973-11561995 CACTATTTTCCTCATGCCCAAGG - Intergenic
1180411798 22:12619136-12619158 GACTAATTTCCTCATCCCCTAGG + Intergenic
1182145914 22:27996616-27996638 TGCTCATCTCCTCCTTGCCATGG + Intronic
1182750552 22:32638870-32638892 TACTCATAAACTCTTTCCCAAGG + Intronic
1183223785 22:36535070-36535092 TATTCATCTCTTTATTCCCAAGG + Intergenic
1183936863 22:41267607-41267629 TTCCCATTTCTTCATTCCCAGGG - Intronic
950938772 3:16872415-16872437 TTCACATTTCCTCATCCCCAGGG + Intronic
951998650 3:28759395-28759417 TAGTCATTCCCTGATTGCCATGG + Intergenic
952487280 3:33825965-33825987 TTCTTATTCCCTCATTCCCAGGG - Intronic
953447812 3:42982665-42982687 CACTCAGGTCCTCATTTCCATGG - Intronic
954158659 3:48703757-48703779 TATTTATTTCCTCATCTCCATGG - Intronic
954460926 3:50626493-50626515 CACTCATTTCCCCATTCTTAAGG + Intronic
955645427 3:61132402-61132424 TGCTCATCTCTTCCTTCCCAGGG - Intronic
955701467 3:61686057-61686079 TGCTCGTTACCTCATTCCCGTGG + Intronic
957879912 3:86199069-86199091 GACTGATTTCATCATTCCAAGGG - Intergenic
960102041 3:113754030-113754052 TGCTTATTTCCTCTTTCCAACGG - Intronic
960190666 3:114701304-114701326 TCCTCATAAGCTCATTCCCAGGG + Intronic
961231582 3:125317125-125317147 TACTAAGTTCCTTATTCCTATGG + Intronic
963604464 3:147402759-147402781 TAATCGTTTCCTCATCACCAAGG + Exonic
963716401 3:148808994-148809016 TACTCAGCTACTCATTCCCTGGG - Intronic
963834876 3:150048150-150048172 TGCTCCTTACCTCCTTCCCAGGG - Intronic
964422801 3:156521808-156521830 TACTGCTTTCCTCATACCAAAGG - Intronic
965143675 3:164870147-164870169 CTCTCATCTCCTCATTCCCCCGG - Intergenic
965523061 3:169688170-169688192 TCCTCATATCCAGATTCCCATGG + Intergenic
965760600 3:172071829-172071851 AAGTCATTTTCTCATTACCATGG + Intronic
966430447 3:179826583-179826605 TCCCCATCTCCTCATGCCCATGG - Intronic
966447531 3:180019665-180019687 CTCTGATTTCCTCAGTCCCAAGG - Intronic
966514764 3:180806488-180806510 TTCTCGTTTCCTAATTCACATGG - Intronic
969570684 4:8006481-8006503 CACTGATTTCCTGGTTCCCAGGG + Intronic
974441331 4:61921880-61921902 TACACATTTACTCTTTTCCATGG - Intronic
976264236 4:83175028-83175050 TTTTCACTTCCTCCTTCCCACGG + Intergenic
976775399 4:88700569-88700591 TACCTATTTCCTCATTTCAAAGG + Intronic
978225828 4:106334038-106334060 TACCTATTTCCTCTGTCCCATGG + Intronic
978298206 4:107233860-107233882 TTCTAATTTCCTCATTATCAAGG + Intronic
978767575 4:112420187-112420209 TAATTATTTCCTCATTGCCTGGG - Intronic
979748109 4:124242527-124242549 TTCTCACTTCCACAGTCCCATGG + Intergenic
981492298 4:145352585-145352607 TCCTCATGTCCTTATCCCCATGG + Intergenic
984669897 4:182470737-182470759 GACCCATTCCCACATTCCCATGG - Intronic
984672954 4:182513077-182513099 TCCTCACTTCTTCCTTCCCATGG - Intronic
985067618 4:186138754-186138776 TTCTCATTGCCTCATTGCAAGGG + Intronic
985438257 4:189955999-189956021 GACTAATTTCCTCATCCCCTAGG + Intronic
987168284 5:15224137-15224159 TCCTCAGTTCCTCATTTCCAAGG + Intergenic
989338760 5:40350150-40350172 TCCTTGTTTCTTCATTCCCAGGG - Intergenic
989438424 5:41441427-41441449 TACTCCTCTCCTCATTCTAATGG + Intronic
991600844 5:68350121-68350143 TAGTCATTTGTTCATTTCCAAGG - Intergenic
992773499 5:80070209-80070231 TGCTCCTTTGCTCAATCCCAGGG - Intronic
993740373 5:91531281-91531303 AACTCATTTCCTCAGTTACAGGG - Intergenic
994144719 5:96382166-96382188 TCCTCATTTCCTCTTTCCATAGG + Intergenic
996171772 5:120302111-120302133 TCCTCATTTCCTCATCTCTAAGG - Intergenic
996506957 5:124278113-124278135 AACTCTCTTCCTCATGCCCACGG + Intergenic
996839309 5:127829014-127829036 TCCTCATTACCTCTTTCCAAAGG - Intergenic
998224979 5:140320022-140320044 AACACATTTCCTCTTTCTCATGG + Intergenic
998748887 5:145295019-145295041 TATTGATTTCCTCAACCCCAGGG + Intergenic
1000463700 5:161549832-161549854 TACTTGTTTCATCATTCCCTGGG - Intronic
1000637738 5:163663024-163663046 TCCCCATTTGCTCTTTCCCAAGG + Intergenic
1000939604 5:167344675-167344697 AACTCAATTTCTCATTCCTATGG + Intronic
1001906505 5:175478268-175478290 TTATCATTTCTTTATTCCCAGGG - Intronic
1002113108 5:176934341-176934363 TACTCATTCCTGCATTCTCATGG - Intronic
1002785705 6:398216-398238 TAAGCATTGCCTCTTTCCCATGG - Intronic
1004078714 6:12369829-12369851 CACTCATTTCCTCCTTGCCAGGG - Intergenic
1005871699 6:29978782-29978804 TACTGATTTCCTTTTTCCCAGGG + Intergenic
1007336815 6:41160386-41160408 TACTCCTGACCTCATTTCCATGG + Intronic
1007723153 6:43897916-43897938 TAGTCATTTCCTGGCTCCCAGGG - Intergenic
1008076711 6:47153241-47153263 TATCCAGATCCTCATTCCCAAGG + Intergenic
1008322507 6:50134102-50134124 TACTCATTTACACACTTCCAGGG - Intergenic
1008908347 6:56705881-56705903 TTTTGATTTCCTAATTCCCAAGG + Intronic
1011157421 6:84348558-84348580 TGTTTATTTCCTCATTTCCAAGG - Intergenic
1012001000 6:93655066-93655088 TACTCATTTTATCATTGCTAAGG + Intergenic
1012292880 6:97481021-97481043 TACTTTTTTCCTCTTTCCCAAGG + Intergenic
1012552986 6:100481329-100481351 TGATCATTTCCTCATTACCAAGG - Intergenic
1012745637 6:103083592-103083614 TACTCTCCTTCTCATTCCCATGG + Intergenic
1013912278 6:115290713-115290735 TACTAATTTCCTTATTCCAGAGG + Intergenic
1014318555 6:119897180-119897202 TACTTATCTCCTCTTTCCTAAGG + Intergenic
1014540695 6:122672195-122672217 TACTCTTCTCCTCCTTCTCAGGG - Intronic
1014622806 6:123690555-123690577 TAATAATTTCCACATTACCATGG - Intergenic
1014689034 6:124538786-124538808 TACTAATTTTCTCATTCGCTCGG + Intronic
1014756846 6:125310660-125310682 TGCTCATTTTCTCTTTCCTAGGG + Intergenic
1014804425 6:125813129-125813151 AACTAATTTTCTCATCCCCAAGG - Intronic
1016266105 6:142234362-142234384 TACTCTTTTTGCCATTCCCAGGG + Intergenic
1017625143 6:156340524-156340546 TACTCATTTTCTCAAGCCCAGGG + Intergenic
1018636309 6:165862086-165862108 CACCCATTCCCACATTCCCATGG + Intronic
1021390263 7:20084398-20084420 CATTCTTTTCCCCATTCCCATGG + Intergenic
1021737135 7:23650862-23650884 TCCATATTCCCTCATTCCCAGGG + Intergenic
1023076147 7:36484347-36484369 TATTAATTTGCTCATTCCCTTGG + Intergenic
1023130471 7:36997800-36997822 CTCTCCATTCCTCATTCCCATGG - Intronic
1023131899 7:37011843-37011865 TCCTCCTTCCCTCTTTCCCAGGG + Intronic
1025565810 7:62432769-62432791 TTTTCATGTCCTAATTCCCAGGG - Intergenic
1026375843 7:69749999-69750021 TAAACTTTTCCTCATCCCCAGGG - Intronic
1026496959 7:70911814-70911836 TCCTCATTTCCTCTTTCCCAGGG + Intergenic
1027412301 7:77933534-77933556 TTTTCATTTCTTCAATCCCAAGG - Intronic
1027532750 7:79355120-79355142 TACTCATTTCCTCTTTAACCAGG + Intronic
1030191227 7:106812273-106812295 AACTCATTCCTTCCTTCCCAGGG + Intergenic
1031193003 7:118578578-118578600 TTCTCCTTTGTTCATTCCCATGG - Intergenic
1032758642 7:134916381-134916403 TATTCATTTCCTCCTTCCCAGGG - Intronic
1033535516 7:142308447-142308469 TAATCATTCCCCCATTCCCAGGG - Intergenic
1033591997 7:142816735-142816757 TAGCCATTTTCTCATTCACAGGG + Intergenic
1034262990 7:149768638-149768660 AACTCATCTCCTCATACCCAGGG - Intronic
1036628866 8:10496465-10496487 TCTTCCTTTCCTCATTCCCAGGG - Intergenic
1037522918 8:19697592-19697614 TACTCACTCCCTCACTCCCCAGG - Intronic
1037579898 8:20238926-20238948 CACTCCTTTCCTCTTTCCGAGGG + Intergenic
1037833703 8:22204031-22204053 TAAGCATTTCCTGATTCCTATGG + Intronic
1038098864 8:24349336-24349358 AAACCATTTCCTCATTCTCAAGG + Intronic
1040456227 8:47600789-47600811 TACCAAGTTCCTCATTGCCAAGG - Intronic
1040825545 8:51616701-51616723 TACACATCACTTCATTCCCATGG + Intronic
1041093420 8:54326049-54326071 TCCTCATTTTCCCAGTCCCATGG + Intergenic
1041362477 8:57067501-57067523 TCCTCATGTCCTCATGCCCCTGG - Intergenic
1042440469 8:68820351-68820373 TAACCATTTCCTCATGGCCAAGG + Intergenic
1042868006 8:73372359-73372381 GACCCATTACCTCATTCACAGGG - Intergenic
1042999190 8:74736559-74736581 TACACATTTCACAATTCCCACGG - Intronic
1043997716 8:86839809-86839831 ATCTAATTTCCTCTTTCCCAAGG - Intergenic
1045843065 8:106601703-106601725 TACTCTTTTCCTCCTGCCTATGG + Intronic
1046706651 8:117460876-117460898 GACACATTGCCTCATTCCCTTGG - Intergenic
1047198578 8:122744037-122744059 AACTAATTTTCTCATTACCAAGG - Intergenic
1047304427 8:123641509-123641531 TGTTCATCTCCGCATTCCCAGGG - Intergenic
1048819041 8:138362903-138362925 TGGTCATCTACTCATTCCCAAGG - Intronic
1049833529 8:144717941-144717963 TACTAACATCCTCAGTCCCAGGG + Intergenic
1051141745 9:13986600-13986622 TCCTCTTTTCCACCTTCCCACGG + Intergenic
1051864442 9:21663661-21663683 TACTTTTTTCCTGATTCCCAGGG + Intergenic
1052372187 9:27677558-27677580 TAATCATGTCCTAATTACCAAGG + Intergenic
1053037448 9:34837446-34837468 TCCTCAATTCTTTATTCCCATGG + Intergenic
1053726848 9:41012577-41012599 GACTAATTTCCTCATCCCCTAGG + Intergenic
1054339095 9:63839218-63839240 GACTAATTTCCTCATCCCCTAGG - Intergenic
1054793377 9:69276489-69276511 TCCACATTTCCACATTCCTAAGG + Intergenic
1055159576 9:73109151-73109173 ATTTCTTTTCCTCATTCCCATGG + Intergenic
1055804048 9:80073361-80073383 TACTATTTTCCTTATTACCATGG + Intergenic
1057569942 9:96196998-96197020 CACTCATGTCCTCAATCACAGGG - Intergenic
1057775878 9:98008993-98009015 TACTTATCTCCTGATTCACAGGG + Intronic
1058775150 9:108276000-108276022 TAGTTCTTTCCTCCTTCCCAAGG + Intergenic
1059699194 9:116758801-116758823 TACTCATCTCTGTATTCCCAGGG + Intronic
1060348959 9:122840679-122840701 AACTGATGTCCTCATTCCAAAGG + Intergenic
1061771202 9:132923613-132923635 TACTCATTTCCCTATCCCTAAGG + Intronic
1061914298 9:133741258-133741280 TGCTCATGTCCTCTTTCACAGGG - Intergenic
1202803669 9_KI270720v1_random:27609-27631 GACTAATTTCCTCATCCCCTAGG - Intergenic
1203635789 Un_KI270750v1:109433-109455 TTCTCATTGCATCATTTCCAGGG - Intergenic
1187202512 X:17148829-17148851 TACTAATTTCCCCATTCTTAGGG + Exonic
1187680687 X:21764700-21764722 TCCCCATTTCCTCCTTCCCCTGG + Intergenic
1189868529 X:45357521-45357543 TATTCTTTTCCTCATTCTTAAGG - Intergenic
1190773704 X:53535894-53535916 TACATAATTCCTCATTCCCAAGG - Intronic
1195835522 X:109110949-109110971 CACTCATGTCCCCATTCCCTTGG + Intergenic
1196060399 X:111402249-111402271 TAGTCATTTCCTCTAGCCCAAGG - Intronic
1199004516 X:142679591-142679613 TTCTCATTTCACCATTCCCTTGG + Intergenic
1199983226 X:152932540-152932562 GATTCCTTTCCTCATTTCCAGGG - Intronic
1201619261 Y:15937327-15937349 GACTCATCTCCTCTTTCCTAAGG - Intergenic