ID: 1106329925

View in Genome Browser
Species Human (GRCh38)
Location 13:28730624-28730646
Sequence GGTAACAAAGTACCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106329920_1106329925 11 Left 1106329920 13:28730590-28730612 CCTGAAGACTCGAGAGTCAGTTT No data
Right 1106329925 13:28730624-28730646 GGTAACAAAGTACCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106329925 Original CRISPR GGTAACAAAGTACCACAAGC TGG Intergenic
No off target data available for this crispr