ID: 1106331825

View in Genome Browser
Species Human (GRCh38)
Location 13:28746413-28746435
Sequence CTCCATCTTGAATAGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106331825_1106331834 28 Left 1106331825 13:28746413-28746435 CCCGGCTCCTATTCAAGATGGAG No data
Right 1106331834 13:28746464-28746486 ATGGTGATGGAGAAAGGAAAGGG No data
1106331825_1106331829 9 Left 1106331825 13:28746413-28746435 CCCGGCTCCTATTCAAGATGGAG No data
Right 1106331829 13:28746445-28746467 TTCACATGCCTCTGACACAATGG No data
1106331825_1106331832 22 Left 1106331825 13:28746413-28746435 CCCGGCTCCTATTCAAGATGGAG No data
Right 1106331832 13:28746458-28746480 GACACAATGGTGATGGAGAAAGG No data
1106331825_1106331830 15 Left 1106331825 13:28746413-28746435 CCCGGCTCCTATTCAAGATGGAG No data
Right 1106331830 13:28746451-28746473 TGCCTCTGACACAATGGTGATGG No data
1106331825_1106331833 27 Left 1106331825 13:28746413-28746435 CCCGGCTCCTATTCAAGATGGAG No data
Right 1106331833 13:28746463-28746485 AATGGTGATGGAGAAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106331825 Original CRISPR CTCCATCTTGAATAGGAGCC GGG (reversed) Intergenic
No off target data available for this crispr