ID: 1106332098

View in Genome Browser
Species Human (GRCh38)
Location 13:28748715-28748737
Sequence CCAACCATTGACATTGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106332092_1106332098 16 Left 1106332092 13:28748676-28748698 CCTGGTTAGAGGTTGGTTGGTGG No data
Right 1106332098 13:28748715-28748737 CCAACCATTGACATTGAGTTGGG No data
1106332087_1106332098 29 Left 1106332087 13:28748663-28748685 CCAGTGAAAAGTCCCTGGTTAGA No data
Right 1106332098 13:28748715-28748737 CCAACCATTGACATTGAGTTGGG No data
1106332091_1106332098 17 Left 1106332091 13:28748675-28748697 CCCTGGTTAGAGGTTGGTTGGTG No data
Right 1106332098 13:28748715-28748737 CCAACCATTGACATTGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106332098 Original CRISPR CCAACCATTGACATTGAGTT GGG Intergenic
No off target data available for this crispr