ID: 1106334447

View in Genome Browser
Species Human (GRCh38)
Location 13:28770525-28770547
Sequence CATCATCTAGGTTTTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106334442_1106334447 5 Left 1106334442 13:28770497-28770519 CCATGGTGGTTTGCTGCACCTAT 0: 2771
1: 7061
2: 7370
3: 18035
4: 9070
Right 1106334447 13:28770525-28770547 CATCATCTAGGTTTTAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106334447 Original CRISPR CATCATCTAGGTTTTAAGAC TGG Intergenic
No off target data available for this crispr