ID: 1106336667

View in Genome Browser
Species Human (GRCh38)
Location 13:28789462-28789484
Sequence GAGGGCAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2999
Summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106336667_1106336679 24 Left 1106336667 13:28789462-28789484 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336667_1106336678 23 Left 1106336667 13:28789462-28789484 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106336667 Original CRISPR GAGGGCAAGCAGAAGCAGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr