ID: 1106336678

View in Genome Browser
Species Human (GRCh38)
Location 13:28789508-28789530
Sequence CCAGTCCCAATGAGATGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1409
Summary {0: 152, 1: 412, 2: 383, 3: 237, 4: 225}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106336667_1106336678 23 Left 1106336667 13:28789462-28789484 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336673_1106336678 4 Left 1106336673 13:28789481-28789503 CCTCTGTGGGCTGCACCCACTGC 0: 16
1: 390
2: 652
3: 965
4: 894
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336672_1106336678 5 Left 1106336672 13:28789480-28789502 CCCTCTGTGGGCTGCACCCACTG 0: 360
1: 628
2: 956
3: 647
4: 577
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336668_1106336678 20 Left 1106336668 13:28789465-28789487 CCCTGCTTCTGCTTGCCCTCTGT 0: 39
1: 124
2: 357
3: 680
4: 1396
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336665_1106336678 25 Left 1106336665 13:28789460-28789482 CCCCACCCTGCTTCTGCTTGCCC 0: 63
1: 240
2: 550
3: 1053
4: 2832
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336666_1106336678 24 Left 1106336666 13:28789461-28789483 CCCACCCTGCTTCTGCTTGCCCT 0: 75
1: 252
2: 589
3: 812
4: 1291
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225
1106336669_1106336678 19 Left 1106336669 13:28789466-28789488 CCTGCTTCTGCTTGCCCTCTGTG 0: 39
1: 114
2: 362
3: 691
4: 1471
Right 1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG 0: 152
1: 412
2: 383
3: 237
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106336678 Original CRISPR CCAGTCCCAATGAGATGAAC TGG Intergenic
902965178 1:19995878-19995900 CTGGACCCAATGAGATGAACAGG + Intergenic
903567001 1:24275093-24275115 TCAGTACCAATGAGATGAGCTGG + Intergenic
904110706 1:28123853-28123875 CCACTCCCCATGACATGACCTGG + Intergenic
906557759 1:46728140-46728162 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
906604080 1:47153150-47153172 CCAGTCCCAAACTGATGAACAGG - Intergenic
906740041 1:48173557-48173579 CCAGTCTCAATGACATGAGCTGG + Intergenic
906843187 1:49161393-49161415 CCAGTCCCAATGAGATGAACTGG + Intronic
907436113 1:54449291-54449313 CAAGCCCCAGTGAGATGAGCTGG + Intergenic
907565536 1:55430360-55430382 CCAGTCACAGTGAGATGAGCTGG - Intergenic
908584718 1:65555053-65555075 CCAGTAGGAATGAGATGAGCCGG + Intronic
908598371 1:65711871-65711893 CCAGTACCATTGAGATGAACCGG + Intergenic
908611497 1:65865722-65865744 ACAGTCCCAATGAGATGAACTGG + Intronic
908666708 1:66500362-66500384 ACAGTCCAAAAGAGATGAACAGG + Intergenic
908724163 1:67157137-67157159 CCAGTCCCAATGAGATGAACTGG + Intronic
908813797 1:68011235-68011257 TTAGTCCCAATGAGCAGAACTGG + Intergenic
908903766 1:68985185-68985207 CCAGTCCCAGTGAGATGAATTGG - Intergenic
909403203 1:75257849-75257871 CTAGTCCCACTGAGATGTACTGG - Intronic
909415585 1:75402487-75402509 CCAGTCCCTATGAGATGAGCAGG - Intronic
909493218 1:76248151-76248173 CCAGACCCATTGAGATGAACTGG + Intronic
909672314 1:78203204-78203226 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
910604761 1:89071695-89071717 TCAGTCCCAATGAGATGAACAGG - Intergenic
910606347 1:89088876-89088898 ACCGTCCCAATGAGATGAACTGG + Intergenic
910626844 1:89316433-89316455 CCAGTCCCAATGAGATGAACAGG - Intergenic
910635790 1:89405773-89405795 CCAGTCTCAATGAGATGAACAGG + Intergenic
910635798 1:89405838-89405860 CCAGTCCCAATGAGATGAACAGG + Intergenic
910799437 1:91131060-91131082 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
910805816 1:91188961-91188983 CCAGTCCCAATCTGATGAGCTGG + Intergenic
910827927 1:91428777-91428799 CCAGTCCTAGTGAGATGAACCGG + Intergenic
911284704 1:95975255-95975277 CCAGTCCCAGTGAGATGAACTGG + Intergenic
911541444 1:99162576-99162598 CCAGTCTCAATGTGATTAACTGG + Intergenic
911583729 1:99666048-99666070 CCAGTACAAATGTGATGATCTGG + Intronic
911632560 1:100199696-100199718 CCAGTCCCAATGAGATGAACCGG - Intronic
911938550 1:104011811-104011833 CCAGTCTCAATAAGATGAATTGG + Intergenic
912076818 1:105885047-105885069 CCAGTCCCAAAGAGATGATTTGG + Intergenic
912235243 1:107844119-107844141 GCAGCCCCAATGAAATGAGCTGG - Intronic
912271126 1:108209783-108209805 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
912276208 1:108261638-108261660 TCAGTCCCAGTGAGATGAACTGG - Intergenic
912292020 1:108432720-108432742 TCAGTCCCAGTGAGATGAACTGG + Intronic
912301489 1:108521080-108521102 CCAGTCCCAGTGAGATGAACCGG + Intergenic
912374822 1:109201561-109201583 CCACTCCTATTGGGATGAACTGG - Intronic
912675704 1:111679188-111679210 CCAGTCCCAGTGAGATGAACTGG - Intronic
912894957 1:113576499-113576521 CCAGTCCCAACGAGATTATCTGG + Intronic
912966144 1:114239362-114239384 CCAGTCCTAATGAGATGAGCTGG - Intergenic
913036387 1:114969986-114970008 CCAGTCCCAATGAGATGAACTGG + Intronic
913108751 1:115639814-115639836 CCAGTCCCAATGAGATAAGCTGG + Intergenic
913428398 1:118760988-118761010 CCACTCCCAATGAGATGAACTGG - Intergenic
913507141 1:119527201-119527223 CCAGTCCCAATGAGATGAACCGG + Intergenic
914218580 1:145656494-145656516 TCAGTCCCAATGAGAGAACCTGG + Intronic
914457962 1:147854669-147854691 CCAGTCTTAATAAGATGAGCTGG - Intergenic
914471139 1:147979185-147979207 TCAGTCCCAATGAGAGAACCTGG + Intronic
915046039 1:153018068-153018090 TCAGTCCCAATGAGATGCACTGG - Intergenic
915654581 1:157348613-157348635 CCAGTCCCAATGAAATGAGCCGG + Intergenic
915763181 1:158336189-158336211 CAAGCCCCAGTGAGATGAACCGG - Intergenic
915865677 1:159495394-159495416 CCAGTCCCAGTGAGATGAACTGG + Intergenic
915876436 1:159616173-159616195 CCAGCCCCAATGAGATGAACTGG - Intergenic
916140453 1:161692962-161692984 CCATTTCCAGTGAGATGAACTGG - Intergenic
916379606 1:164195401-164195423 TCAGTTCCAGTGAGATGGACGGG - Intergenic
916406186 1:164500279-164500301 CAACTCCCAATGAGATGAGCTGG - Intergenic
916545578 1:165801232-165801254 CCAATCCCTATGAGATGAGCCGG - Intronic
916614952 1:166429790-166429812 CCACTCCCAATGAGAAGAGCGGG + Intergenic
916731690 1:167572242-167572264 CCAGTCCCAGTGAGATGAACAGG + Intergenic
916973357 1:170048637-170048659 CCAGTCCCAGTGAGATGAACTGG - Intronic
917009858 1:170458417-170458439 TCAGTCCCAATGAGATAAGCTGG + Intergenic
917019283 1:170568973-170568995 CCAGTCCCTGTGAGATGAACCGG - Intergenic
917023464 1:170614869-170614891 CCAGTCCCAATGAGATGAACTGG + Intergenic
917091635 1:171359322-171359344 CCACTCCCAATGAGATGAGCCGG - Intergenic
917131890 1:171751558-171751580 TCAGTCCCATTCAGATGATCAGG - Intergenic
917257595 1:173132262-173132284 CCAGTCCCAATGAGATGAGCTGG + Intergenic
917357669 1:174143671-174143693 CCAGTCCCAATGAGATGAGCTGG - Intergenic
917401470 1:174653607-174653629 CCAGTCTCAATGAGATGAGCTGG + Intronic
917405885 1:174708443-174708465 CCAGTCCCAGTGAGATGAACCGG - Intronic
918159938 1:181889183-181889205 CCATTCCCAGTGAGATGAACTGG - Intergenic
918163268 1:181920534-181920556 TCAGTCCCAATGAGATAAGCTGG - Intergenic
918360482 1:183751891-183751913 CCAGTCCCAGTGAGATGAACTGG + Intronic
918396683 1:184120251-184120273 TCAGACCCCATGAGATGAAAAGG - Intergenic
918501586 1:185201592-185201614 CCAGTCCCAATGAGATGAGTCGG + Intronic
918786204 1:188768286-188768308 TCAGTCCCAATGAGATGAACTGG - Intergenic
918904397 1:190474764-190474786 CTAGTCCCCAAGAGTTGAACCGG - Intronic
919404778 1:197165895-197165917 CCAGTCCCAGTGAGATGAGCTGG - Intronic
919461763 1:197884861-197884883 TCAGTCCTAATGACATGAACCGG + Intergenic
919598902 1:199599232-199599254 CCAGTCCCAGTAAGATGAGCTGG - Intergenic
920985499 1:210885209-210885231 CCAGTCACAGTGAGATGAGCCGG - Intronic
921401482 1:214727979-214728001 CCAGTCCCAATGAGATGAACTGG + Intergenic
921484959 1:215704154-215704176 CCAGTCCCAGTGGGATGAACCGG + Intronic
921962142 1:221047233-221047255 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
921976245 1:221206682-221206704 CCAGTCCCAATGAGATGAACTGG - Intergenic
922066118 1:222145596-222145618 CCAGTCCCAGGGAGATGAACCGG - Intergenic
922230217 1:223679315-223679337 CCAGTCACACTGAGCTGTACAGG + Intergenic
922253506 1:223871488-223871510 CCAGTCCCAGTGAGATGAACTGG + Intergenic
922396711 1:225209799-225209821 CCAGTCCTATTGAGATGAGCTGG - Intronic
922399738 1:225239517-225239539 TCAGTCCCAGTGAGAGAAACTGG + Intronic
922609623 1:226915740-226915762 CCAGACCTAAACAGATGAACTGG - Intronic
923194512 1:231652107-231652129 CCAGTCCCAATGAGATAAACAGG + Intronic
923853334 1:237820322-237820344 CCAGTCCCAGTGAGATGAACTGG - Intronic
924823198 1:247513853-247513875 CCAGTCCCAGTGAGATGAGCTGG + Intronic
924829100 1:247573530-247573552 CCAGTCCCAATGAGATGAACTGG + Intronic
924878136 1:248128405-248128427 CCAGTCCCAATGAGATGAACTGG - Intergenic
924883382 1:248187639-248187661 CCAGTCCCAGTGAGATGAACTGG - Intergenic
924894125 1:248317306-248317328 CCAGCCCCAGTGAGATGAACTGG + Intergenic
1063273464 10:4537867-4537889 GCAATCCCAATGACAAGAACCGG - Intergenic
1063990616 10:11558074-11558096 CCAGTCACATTCAGATGCACAGG + Intronic
1064757765 10:18587589-18587611 CCAGTCCCAGTGAGATGAACTGG - Intronic
1065076092 10:22080638-22080660 CCAGTCCCAATGAGATGAACTGG + Intergenic
1065121079 10:22530800-22530822 CCAGTCGCAGTGAGATGAACTGG + Intergenic
1065364921 10:24926055-24926077 CCAGTCCCTAGGAGGTGGACTGG - Intronic
1065427321 10:25619282-25619304 CCAGTCCCAATGAGATGAACTGG - Intergenic
1065621517 10:27587120-27587142 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1065651648 10:27899109-27899131 CAAGTCCCAATGAGATGAGATGG - Intronic
1065907555 10:30271916-30271938 TCAGTTCCAATGAGATAAAGAGG - Intergenic
1066140877 10:32502400-32502422 CCAGTCCTATTGAGATGTACTGG + Intronic
1066615477 10:37289103-37289125 CTAGTCCCAATGAGATGAACAGG + Intronic
1067162259 10:43836890-43836912 CCAGTCCCAATGAGACGAGCCGG + Intergenic
1067209787 10:44250245-44250267 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1067332365 10:45333965-45333987 CCAGTCCAAATGAGATGAGCCGG + Intergenic
1067579653 10:47434157-47434179 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1067859504 10:49830609-49830631 CTACTCCCAAAGAGATGAATGGG + Intronic
1068086182 10:52375567-52375589 TCAGTCCCAGTGAGATGAACTGG + Intergenic
1068410501 10:56647267-56647289 CCAGTCCCAGTGAAATGAACTGG + Intergenic
1068470055 10:57448828-57448850 GCAGTCCCAATGAGATGAGCCGG + Intergenic
1068575067 10:58675934-58675956 CCAGTCCCACTGAGATGAACCGG - Intronic
1068622917 10:59207227-59207249 CCAGTCCCAATGAGATGAGCTGG - Intronic
1068646095 10:59470219-59470241 TCAGTCCCAATGAGGTAAACCGG - Intergenic
1068951480 10:62782104-62782126 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1069093556 10:64230284-64230306 TCAGTTCCAATGAGTTGAACCGG + Intergenic
1069120911 10:64567838-64567860 CTAGTTCCAATGAGATGGACAGG + Intergenic
1069140007 10:64810777-64810799 TAAGTCCCAGTGAGATGAACTGG + Intergenic
1069403433 10:68074603-68074625 CCAGTCCCCATGAGCTGATCTGG - Intronic
1070213077 10:74347231-74347253 TTAGTCCCAATGAGATGAACTGG - Intronic
1071272324 10:84019720-84019742 CCAGTCCCAATGAGATGAGGTGG - Intergenic
1071341420 10:84652213-84652235 CCAGTCCCAGTGAGATGAGATGG + Intergenic
1071401871 10:85280723-85280745 CCAGTCCCAATGAGATGAGGTGG + Intergenic
1071949025 10:90681919-90681941 CCAGTCCCAGTGAGTTGAGTTGG - Intergenic
1071975950 10:90955642-90955664 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1072024904 10:91445684-91445706 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1072365449 10:94704071-94704093 CTAGTCCCAGTGAGATGAACCGG + Intronic
1072837990 10:98737400-98737422 CCAGTCCCAATGAGATGAAGTGG - Intronic
1072876083 10:99174913-99174935 CCAGTCCCAGTGAGATGAACCGG - Intronic
1073537828 10:104293935-104293957 CCAGTCCCAGGGAGGTTAACGGG - Intronic
1073884103 10:108018987-108019009 CCAGTCCCAAAGAGATAAGTCGG - Intergenic
1074017087 10:109545437-109545459 CCAGTCCTAATGAGATAAATTGG - Intergenic
1074795602 10:116939507-116939529 CCAGTTCCAGTGAGATGAGCCGG + Intronic
1077302010 11:1851808-1851830 CCAGCGCCATGGAGATGAACAGG - Intergenic
1077713568 11:4559220-4559242 CCAGTCTCAATGAGATGAACTGG - Intergenic
1077803775 11:5569381-5569403 TCAGTTCCAATGAGATAAGCCGG - Intronic
1078331576 11:10426423-10426445 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1078392998 11:10952601-10952623 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1078686283 11:13535007-13535029 CTAGTCCCAGTGAGATGAACTGG + Intergenic
1078743812 11:14092021-14092043 CCAGTCCCAGTGAGATGAACAGG + Intronic
1078809520 11:14743902-14743924 CCAGTCCCATTGAGATGAGCTGG + Intronic
1078814211 11:14802490-14802512 CCAGTCCCAGTGAGACGAACTGG + Intronic
1079264785 11:18920897-18920919 CCAGTCTCAATGAGATGAACTGG - Intergenic
1079266960 11:18943044-18943066 CCAGTCTCAATGAGATGAACTGG - Intergenic
1079463750 11:20708355-20708377 CAAGCCCCAGTGAGATGAACTGG + Intronic
1079588140 11:22150539-22150561 TCAGTCCCAATGAGAGAACCTGG + Intergenic
1079654044 11:22965927-22965949 CCAGTCCCAATGAAATGAATAGG + Intergenic
1079739039 11:24035074-24035096 TCAGTCCCAATGTGATAACCTGG + Intergenic
1079759510 11:24310861-24310883 CCATTCCAAATGGGATAAACTGG - Intergenic
1079799868 11:24854971-24854993 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1080334454 11:31180500-31180522 CCCGTCCCAATGAGACGAGATGG - Intronic
1080337072 11:31209910-31209932 CCAGACACAATGAGATGATGTGG + Intronic
1080709972 11:34737624-34737646 CCAGTCCCAATGAGATGAACTGG - Intergenic
1080977070 11:37356371-37356393 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1081021952 11:37958374-37958396 CCATTCCAAATGAGATAAATTGG + Intergenic
1081118187 11:39231871-39231893 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1081165965 11:39809767-39809789 CCAGTCCCATTGAGATGAACTGG - Intergenic
1081221494 11:40469180-40469202 CCAGTCCTAGTGAGATGACCCGG - Intronic
1081252446 11:40851477-40851499 CTGGTCCCAGTGAGATGAACTGG + Intronic
1081317813 11:41651425-41651447 CTAGTCCCAATGAGATAAATTGG + Intergenic
1082729868 11:56782594-56782616 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1082867171 11:57910759-57910781 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1082872233 11:57953875-57953897 CCAGTCCCAATGAGATAAGCTGG + Intergenic
1082903684 11:58283629-58283651 CCAATCCCAACGAGATGAACTGG + Intergenic
1082924297 11:58529835-58529857 TCAGTCTCAATGAGATGAACCGG - Intronic
1083368409 11:62157898-62157920 CCAGTCCCAGTGAGGTGAACTGG - Intergenic
1083385618 11:62307002-62307024 CCAATCCCAATGAGATGAGCTGG + Intergenic
1083497034 11:63064447-63064469 CCAGTCCCGATGAGATGAACTGG + Intergenic
1083499086 11:63087235-63087257 CCAGTCCCAATGAGATGAACTGG - Intronic
1083506947 11:63166977-63166999 CCAGTCCCAGTGAGATGAACCGG - Intronic
1083516321 11:63262153-63262175 CCAGTCCCAATGAGACGAGCCGG + Intronic
1083516488 11:63263534-63263556 TCAGTCCCAATGAGAGAACCTGG + Intronic
1083535132 11:63460177-63460199 CCAGTCGCAATGAGATAAACAGG + Intergenic
1085827565 11:79864503-79864525 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1086246271 11:84756920-84756942 CAACTCCCAATGAGATAAATGGG + Intronic
1086300414 11:85421286-85421308 CCAGTCCCAATGAGATGAGCTGG + Intronic
1086312398 11:85549321-85549343 CCAGTCACAATGAGATGAACCGG + Intronic
1086348794 11:85924431-85924453 CCAGTTCCAGTGAGATGAGCTGG - Intergenic
1086532453 11:87801524-87801546 CCATTCCCAATGAGATGAGCTGG + Intergenic
1086735746 11:90302966-90302988 CCAGTCCCAATGCAATGAACTGG + Intergenic
1087305660 11:96486929-96486951 TCAGTCCCAATAAGATGAACTGG - Intronic
1087484801 11:98747982-98748004 CCAGTTCCAGTGAGATGAACCGG - Intergenic
1087667697 11:101070123-101070145 CCAGTCCCAATGAGATGAGGTGG - Intronic
1087703887 11:101467047-101467069 CCAGTCCCTATGAGATGAACTGG + Intronic
1087712086 11:101566681-101566703 CCTGTCCCAGTGAGATGAAGTGG - Intronic
1087718811 11:101639055-101639077 CCAGTCCCAGTGGGATGAACCGG - Intronic
1087925048 11:103910397-103910419 CCAGTCCCAGTGAGATGAACTGG - Intronic
1088034706 11:105297018-105297040 GCAGTCCCAATGAGATGAACAGG + Intergenic
1088037330 11:105333905-105333927 CCAGTTCCAATGAGACAATCTGG - Intergenic
1088066380 11:105725694-105725716 TTAGTCCCAATGAGATGAACCGG - Intronic
1088212021 11:107466796-107466818 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1088719413 11:112578867-112578889 CCAGTCCCCATCTGATGGACTGG + Intergenic
1089285567 11:117405493-117405515 CCAGCCCCAATGAGATGAGCTGG + Intronic
1090307398 11:125703243-125703265 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1090312605 11:125755722-125755744 ACATTCCCAGTGAGATGAACTGG - Intergenic
1090318330 11:125817756-125817778 CCAGTCCCAATGAGATGAACTGG - Intergenic
1090321041 11:125844212-125844234 CCAGTCCTAATGAGAGAACCTGG - Intergenic
1090725182 11:129518440-129518462 CTAGTCCCAGTGAGATTAACTGG + Intergenic
1090811610 11:130249594-130249616 CTAGTCCCAGTGAGATGAACAGG - Intronic
1091090127 11:132763155-132763177 CCAGTCCCAATGAGATGAACTGG + Intronic
1091712324 12:2750679-2750701 CCAGTCCCAATGAGATAAGCTGG + Intergenic
1092332069 12:7594025-7594047 CCAGTTCTAATGAGATGAACCGG - Intergenic
1092581776 12:9849925-9849947 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1092629044 12:10358873-10358895 CCAGTCCCAATTAGATGAACTGG + Intergenic
1092637491 12:10467241-10467263 CCAGTACCAATGAGATAAACTGG + Intergenic
1092638802 12:10481472-10481494 CCAGTCCCAATGAGATGAACTGG - Intergenic
1092703162 12:11256144-11256166 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1093336146 12:17906456-17906478 CCAGTCCTTATGAGATGAGCCGG + Intergenic
1093340556 12:17967848-17967870 TCAGTCCCAATGAGAGAAGCTGG + Intergenic
1093402211 12:18760752-18760774 CCAGTCCCAATGAGATGAACTGG - Intergenic
1093608173 12:21119783-21119805 CCAGTTGCAATGAGATGAACTGG + Intronic
1093610432 12:21149502-21149524 CCAGTCTCAAAGAGATGAGCTGG - Intronic
1093694664 12:22146283-22146305 CCAGTCCCAATGAGATGAGCTGG - Intronic
1093714402 12:22365718-22365740 CCAGTCCTAATGAGATGAGCCGG - Intronic
1093835702 12:23825415-23825437 CCAGTCCCACTGAGATGAACCGG + Intronic
1093974019 12:25401271-25401293 CCATTCCGAATGGGAGGAACTGG - Intergenic
1094061179 12:26316647-26316669 CCAGTCCCAGCAAGATGAACTGG + Intergenic
1094266498 12:28565945-28565967 CCAATCTCTATGAGATGAACAGG + Intronic
1094755309 12:33462553-33462575 CCAGTCCCAATGAGATGAACTGG - Intergenic
1095230589 12:39734249-39734271 CCAGTCCCAGTAGGATGAGCTGG + Intronic
1095356323 12:41280013-41280035 CCAGTCCCAATGAGAAGAACCGG - Intronic
1095406253 12:41870321-41870343 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1095595206 12:43950949-43950971 CCAGTCCCAGTAGGATGAACTGG - Intronic
1095674150 12:44897418-44897440 CTAGTCCCAATGAGATGAATTGG - Intronic
1095920710 12:47526916-47526938 CAAGTCCCAGTGAGATGAACTGG + Intergenic
1095930841 12:47623954-47623976 TCAGGCCCAGTGAGATGAACAGG - Intergenic
1096895761 12:54819433-54819455 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1096941767 12:55355025-55355047 CCAGTCCCAATGAGATGAACCGG - Intergenic
1096967849 12:55642863-55642885 CCAGTCCAGATGAGAGGAAGTGG - Intergenic
1097412041 12:59267720-59267742 CCAGTCCCAATGAGATGAACTGG - Intergenic
1097488339 12:60234471-60234493 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1097619414 12:61922400-61922422 CCAGTCCTAATGAGATGAACTGG - Intronic
1097635289 12:62114332-62114354 CCAGTCCCAATGAGATGAGCTGG + Intronic
1097737293 12:63196314-63196336 CCAATCCCAATGAGATAAGCTGG - Intergenic
1097752895 12:63377882-63377904 CCAGTCCCAATGAGATGAACTGG - Intergenic
1097898896 12:64853832-64853854 CCAGTCTCAGTGAGATGAACGGG + Intronic
1098193697 12:67977254-67977276 CCAGTTCCAGTGAGATGAACTGG + Intergenic
1098438878 12:70497537-70497559 CCAGCCCCAGTAAGATGAACTGG + Intergenic
1098706801 12:73702119-73702141 CCAGTCGCAGTGAGATGAGCTGG - Intergenic
1098780065 12:74676176-74676198 CCAGTCTCAGTGAGATGAGCCGG - Intergenic
1098840085 12:75467448-75467470 CTAGTCCCAATGAGATAAACTGG + Intergenic
1099022620 12:77424892-77424914 CCAGTGCCAATGAGATGAGCTGG + Intergenic
1099030738 12:77523587-77523609 CTAGTCCCAATGAGATGAACCGG - Intergenic
1099087039 12:78258154-78258176 CAAGCCCCAGTGAGATGACCTGG + Intergenic
1099107797 12:78518723-78518745 CCCGTCCCAATGAGATGAGGAGG - Intergenic
1099183853 12:79497202-79497224 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1099239022 12:80116391-80116413 CAAGTCCCAGTGAGATGAACTGG + Intergenic
1099253812 12:80290232-80290254 CCAGTCCTAGAGAGATGAACTGG + Intronic
1099435350 12:82635508-82635530 CCAGTCCCAATGAGATGAACCGG + Intergenic
1099486342 12:83233155-83233177 CCAGTCCCAATGAGATGAGTTGG + Intergenic
1099491936 12:83299546-83299568 ACCGTCCCAATGAGATGAATTGG - Intergenic
1099697559 12:86041021-86041043 CCAGTCTCAATGAGATGAATCGG + Intronic
1099745063 12:86690642-86690664 GAAGTCCCAGTGAGATGAGCCGG + Intronic
1099897463 12:88667254-88667276 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1100123501 12:91395699-91395721 CCATTCCAAATGAGATAAATTGG - Intergenic
1100739950 12:97581189-97581211 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1100808241 12:98310860-98310882 CCAGTCCCAATGAGATGAACCGG - Intergenic
1100896177 12:99185544-99185566 ACCGTCCCAATGAGACAAACCGG - Intronic
1101069959 12:101063226-101063248 CCAGTCCCAATGAGATGAGCTGG + Intronic
1101472777 12:105013862-105013884 CCAGTCCCAATGAGGTGAGCTGG + Intronic
1101488090 12:105185588-105185610 CCAGTCCCAGTGAGATAAGCTGG + Intronic
1103154726 12:118674615-118674637 CCAATCTCAGTGAGATGAACCGG + Intergenic
1103169248 12:118799493-118799515 CCAGTCCCAATGACATGAGCTGG + Intergenic
1104115699 12:125746888-125746910 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1104741979 12:131184389-131184411 CCACTCCAAATGGGAGGAACTGG + Intergenic
1105355008 13:19652229-19652251 CCAGTCCCAATGAGATGAACCGG - Intronic
1105552575 13:21411202-21411224 CCAGTCCCAATGAGATGAAGAGG + Intronic
1105769314 13:23593901-23593923 CCAGTCCCAATGAGATGAGCTGG - Intronic
1106335181 13:28777214-28777236 CCAGTCCCAGTGAGATGAGCAGG + Intergenic
1106336678 13:28789508-28789530 CCAGTCCCAATGAGATGAACTGG + Intergenic
1106378901 13:29216701-29216723 CCAGTCCCAATGTGATGAACCGG + Intronic
1106429329 13:29665383-29665405 CTAGTCCCATTGAGATCAACTGG - Intergenic
1106650777 13:31688029-31688051 CCAGTCCCAATGAGATGAACTGG - Intergenic
1106874315 13:34055126-34055148 CCAGTCCCAATGAGATGAACTGG + Intergenic
1107289921 13:38840296-38840318 CCAGTCCTAATAAGATGAACTGG + Intronic
1107314921 13:39120359-39120381 TCAGTCCCAGTGAGGTGAACTGG + Intergenic
1107473548 13:40713194-40713216 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1107551572 13:41480623-41480645 CCAGTACCAATGAGATGAACCGG + Intergenic
1107648077 13:42516074-42516096 CCAGTCCTAATGAGTTGGGCCGG - Intergenic
1107970943 13:45641516-45641538 CCATTCCCAGTGAGATGAACTGG + Intergenic
1108048896 13:46409432-46409454 CCAGTCCCAATGAGATGAGCTGG + Intronic
1108186555 13:47893744-47893766 CCAGTCACAATGAGAGGCACTGG + Intergenic
1108236737 13:48416231-48416253 CCAGTCTCAATGAGATGAGCTGG - Intronic
1108262890 13:48675989-48676011 CCAGTCCCAATGAGATGAGCTGG + Intronic
1108850204 13:54718752-54718774 CAGGTCCCAACCAGATGAACTGG + Intergenic
1108940475 13:55947455-55947477 CCAGTCCCAGGGAGATGAACTGG - Intergenic
1109033768 13:57229745-57229767 CCAGTCCCAATGAGTTAAGCTGG - Intergenic
1109187799 13:59291492-59291514 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1109195837 13:59376921-59376943 CCTGTTCCAATGAGATGAGCTGG - Intergenic
1109366511 13:61364014-61364036 CCAGTCTGAATGAGATGAACGGG - Intergenic
1109457576 13:62612063-62612085 CCAGTCCCAATTAGATGAACTGG + Intergenic
1109541428 13:63782778-63782800 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1109731460 13:66419454-66419476 TCAGTCCTAGTGAGATGAACTGG - Intronic
1109891108 13:68616628-68616650 CCAGTCCCAGTGAGATGACCTGG - Intergenic
1109902887 13:68796220-68796242 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1110135427 13:72062217-72062239 CCAGTCCCAGTAAGATGAACTGG - Intergenic
1110337182 13:74346382-74346404 CCAGTCCCAATGAGAAGAACTGG - Intergenic
1110389620 13:74959241-74959263 CCAGTCCCAGTGAGATAAGCTGG - Intergenic
1110737245 13:78951418-78951440 CCAGTCCTGATGAAATGAACTGG + Intergenic
1111055987 13:82952413-82952435 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1111114121 13:83754228-83754250 CCAGTCCCAATGAGATGAACTGG - Intergenic
1111343197 13:86914485-86914507 CCATTCCAAATGAGATAAATTGG - Intergenic
1111627864 13:90813000-90813022 CCAGTCCCAATGAGGTGAGCCGG - Intergenic
1112151820 13:96772966-96772988 CCAGTCCCAGTGAGATGACCTGG - Intronic
1112259227 13:97863338-97863360 CCATTCCAAATGGGATAAACTGG + Intergenic
1112546607 13:100377151-100377173 CCAGTCCCAGTGAGATGAGCCGG + Intronic
1112620245 13:101047266-101047288 CCAGTCCCAGTGAGATAAACCGG + Intergenic
1112928740 13:104709914-104709936 CCATTCAGAAGGAGATGAACCGG + Intergenic
1113131648 13:107043274-107043296 CCAGTCCCTATGAGATGAGCTGG + Intergenic
1113269370 13:108655861-108655883 CCATTCCAAATGAGAGAAACTGG - Intronic
1113785024 13:112997900-112997922 CCTGTCCCAATCAGTTAAACAGG - Intronic
1114133654 14:19821270-19821292 CCAGTCCCAATGAGATGAGCTGG + Intronic
1114335930 14:21690063-21690085 CCAGTCCCAAGGAGATGAGCTGG - Intergenic
1114433693 14:22685822-22685844 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1114695570 14:24624055-24624077 CAAGTCCCAATGAGATGAACAGG + Intergenic
1114709975 14:24768253-24768275 CGAGTCCCAATGAGATGAGCCGG - Intergenic
1114741660 14:25104365-25104387 CCAGTCCCATTGAGATGAGCCGG - Intergenic
1114817566 14:25978950-25978972 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1114870203 14:26646134-26646156 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1114958108 14:27848894-27848916 TCAGTCCCAATGAGAGAATCTGG - Intergenic
1115043011 14:28955077-28955099 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1115124097 14:29972132-29972154 CCAGTCCCAATGAGATGAACTGG - Intronic
1115265287 14:31494225-31494247 TCAGTCTGAATGAGATGAACTGG - Intronic
1115277166 14:31621630-31621652 CCAGTCCCAATGAAATGAACTGG + Intronic
1115357071 14:32460383-32460405 CCAGCCCCAGTGAGATCAAATGG - Intronic
1115691121 14:35844528-35844550 CCAGTCTCAGTGAGATGAACCGG + Intronic
1115721189 14:36162569-36162591 CCAGTCCCAATGAGATTAACTGG + Intergenic
1115833142 14:37364153-37364175 CCAATCCCAATGAGATGAACTGG + Intronic
1115867324 14:37761339-37761361 CCAGTCCCGATAAGATGAACTGG + Intronic
1115912257 14:38269301-38269323 CCAGTCCCAGTGAGATAAACTGG + Intergenic
1115974500 14:38981534-38981556 CCAGTCCCAATGAGATGAACCGG + Intergenic
1116428565 14:44820119-44820141 TCAGTCCCAATGAGAGAACCTGG - Intergenic
1116511974 14:45757097-45757119 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1116572534 14:46535441-46535463 CCAGTCCCAATGAGGTGAGCTGG + Intergenic
1116743759 14:48792261-48792283 CCATTCCCAGTGAGATGAATCGG - Intergenic
1116771572 14:49132131-49132153 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1116781667 14:49243896-49243918 TCAGTCCCAATGAGATAAACAGG - Intergenic
1117599903 14:57364706-57364728 CCAGTGCCAATGAGACGAACCGG - Intergenic
1117850156 14:59958950-59958972 CCAGTCTCACTGAGATGAACAGG + Intronic
1117859280 14:60073285-60073307 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1117932281 14:60855645-60855667 CCAGTCCCAGTGAGATGAACTGG + Intronic
1118559939 14:67067972-67067994 CCCATCCCAATGAGATGAACTGG + Intronic
1119018573 14:71085184-71085206 CCAGTCCCAATGCGATGAGCCGG + Intronic
1120338661 14:83190627-83190649 CCAGTTCCATTGAGATGAACTGG + Intergenic
1120554206 14:85908312-85908334 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1120565416 14:86048648-86048670 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1120624974 14:86813814-86813836 CCAGTCCCAATGACATGAGCTGG + Intergenic
1120770032 14:88369647-88369669 CCAGTTCCAATGAGATGAACTGG - Intergenic
1120799031 14:88668977-88668999 TCAGTCCCAATGAGAGAACCTGG - Intronic
1120843251 14:89105167-89105189 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1122276002 14:100591134-100591156 CCAGTCACACTGAGATGAGATGG - Intergenic
1123175262 14:106410676-106410698 TCAGTAGCAATGAGATGAGCTGG - Intergenic
1202943426 14_KI270726v1_random:5103-5125 TCAGTAGCAATGAGATGAGCTGG + Intergenic
1123576727 15:21676838-21676860 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1123613349 15:22119306-22119328 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1124474769 15:30023226-30023248 ACAGTCTCAATGAGATGAAGTGG + Intergenic
1124893848 15:33757942-33757964 CCAGCCCCAATGAGATGAACTGG - Intronic
1124937578 15:34186893-34186915 CCAGTCCCAAGGACAAGAATGGG + Intronic
1125219467 15:37317177-37317199 TCAGTCCCAGTAAGATGAACCGG - Intergenic
1125227073 15:37407951-37407973 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1125354645 15:38803814-38803836 CCCGTCCCAATAAGATGAACTGG + Intergenic
1125984667 15:44038653-44038675 CCAGTCCCAATGAGATGAACTGG - Intronic
1126050739 15:44682891-44682913 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1126528785 15:49688942-49688964 CCAGTCCCAATGTGGGGAAAGGG - Intergenic
1126952293 15:53894181-53894203 TCAGTCCCAGTGAGATGAACTGG + Intergenic
1127029927 15:54850832-54850854 CCCGTCCCAATGAGATGAGGTGG - Intergenic
1127317974 15:57815438-57815460 CCAGTCCCAATGAGATGAAATGG + Intergenic
1127339495 15:58026493-58026515 CCAGTCCCAGTGAAATGAACCGG - Intronic
1128857607 15:71032319-71032341 CCAGTCCCAATGAGATGAACTGG + Intronic
1128883581 15:71265253-71265275 CCAGTCCCAGTGTGATAAGCTGG - Intronic
1129495688 15:75977655-75977677 CCAGTCCCAGTGAGATAAGCCGG + Intronic
1129508049 15:76099417-76099439 CGAGTCCCAGTGAGATGAACCGG + Intronic
1130030495 15:80308959-80308981 TCAGTCCCAATGAGAGAACCTGG + Intergenic
1131643532 15:94317559-94317581 CCAGTCACACTGAGCTGCACTGG + Intronic
1131716049 15:95112050-95112072 CCAGGCCCAGGGTGATGAACTGG + Intergenic
1131743574 15:95420926-95420948 CCATTCCCAATGGGATAAATTGG + Intergenic
1132096314 15:98987784-98987806 CCAGTCCCAATGAGATGAACTGG - Intronic
1202985595 15_KI270727v1_random:411083-411105 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1133161694 16:3916072-3916094 CCAGGCCCAGTGAGCTGACCTGG + Intergenic
1133559420 16:6936917-6936939 ACAGTCCCAATGAGATCACATGG - Intronic
1137296220 16:47096836-47096858 CCAGTCCCAGTGAAATGAGCTGG - Intronic
1137335770 16:47547123-47547145 CTATTCCCAATGAGGTGAACCGG + Intronic
1137336568 16:47554858-47554880 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1137489370 16:48918797-48918819 CCAGCACCAATGAGGTGAACAGG + Intergenic
1138706539 16:58920982-58921004 CTAGTCCCAATGAGAAGAGCTGG + Intergenic
1138843749 16:60539613-60539635 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1139222156 16:65194587-65194609 CCAGTCCCAGTGAAATGAACAGG + Intergenic
1140054196 16:71511193-71511215 CAAGCCCCAGTGAGATGAACCGG + Intronic
1140650701 16:77084935-77084957 ACATTCCCAGTGAGATGAATGGG + Intergenic
1140695095 16:77525069-77525091 CCAGTCCTGATGAGATGAACCGG - Intergenic
1141246197 16:82309757-82309779 CCAGTCCCAATGAGATGAACTGG + Intergenic
1143427233 17:6849543-6849565 CCAGTCCCAATGAGATGAACTGG + Intergenic
1144323806 17:14157529-14157551 CCAATCCCATAGAGATGAACAGG - Intronic
1146309378 17:31755386-31755408 CCAGTCTCACTGTGCTGAACAGG + Intergenic
1146418257 17:32657108-32657130 CCAGCCTCAATGACATGAAAAGG + Intronic
1146826070 17:36024102-36024124 CCAGTCCCAATGAGCTGAACTGG + Intergenic
1148136639 17:45296775-45296797 CCACTCCCTATGGGAGGAACAGG - Intronic
1148403351 17:47386980-47387002 CCAGTCCCAATGAGATGAGCAGG + Intronic
1148967283 17:51446771-51446793 TCAGTCCCAGTGAGATGAACTGG - Intergenic
1148980954 17:51574505-51574527 TCAGTCCCAATGAGATGAACTGG - Intergenic
1149191986 17:54073443-54073465 CCCATCCCAATGAGATGAACCGG + Intergenic
1149212164 17:54316468-54316490 CCCGTCCTAGTGAGATGAACCGG - Intergenic
1149281369 17:55108749-55108771 CCAGTCCCAATGAGATAAGCTGG + Intronic
1149365362 17:55938791-55938813 CCAGTCCTAATGAGATGAACCGG - Intergenic
1149626257 17:58083055-58083077 CCAGTCCCAAGGAGAAAAAAGGG - Intergenic
1150090671 17:62322423-62322445 CCAGTTCCAATGAGATGAACTGG - Intergenic
1150545680 17:66155190-66155212 CCAGTCCCAGTGAGATTAGCCGG - Intronic
1150884531 17:69070392-69070414 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1151000162 17:70366649-70366671 CCAGGCCCAGGGAGATGAAGAGG + Intergenic
1151064288 17:71132335-71132357 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1153059468 18:980435-980457 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1153119102 18:1700067-1700089 CCAGTCCCAATGAGATGAACAGG - Intergenic
1153562336 18:6383651-6383673 CCAATCCCAATGAGATGAACTGG + Intronic
1153702515 18:7711131-7711153 CCAGTCCCAATGAGATGAGCCGG - Intronic
1153717944 18:7869537-7869559 CCAGTCCCAATGTGATGAGCTGG + Intronic
1153798366 18:8646528-8646550 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1154288827 18:13086525-13086547 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1155384837 18:25266549-25266571 GCAGTCCCAATGAGATGAACTGG - Intronic
1155395218 18:25379877-25379899 CCAGTCCCAATGTGATGAGCTGG - Intergenic
1155489992 18:26391400-26391422 ACAGTCCCAATGGGAAGAACAGG - Exonic
1156084473 18:33382487-33382509 TCAGTCACGATGAGATGAACTGG - Intronic
1156188472 18:34690475-34690497 CCAGTCCCATTGAGATGAACTGG + Intronic
1156230839 18:35152528-35152550 CCAGTCCCAATGAGAGGAACTGG + Intergenic
1156328954 18:36101377-36101399 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1156582272 18:38392370-38392392 CCAGTCCTAATGAGATGAACTGG - Intergenic
1156941071 18:42767425-42767447 CCATTCCAAATGAGAGGAACTGG - Intronic
1156979379 18:43266116-43266138 CCAGTCCCAATGCAATGAACTGG + Intergenic
1157067388 18:44367292-44367314 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1157068020 18:44374663-44374685 CCAGTCCCAATGAGATGAACAGG - Intergenic
1157071649 18:44416019-44416041 CCAGTCCCAATGACATGAGCTGG - Intergenic
1157178962 18:45478325-45478347 CCAGTCCCAATGAGATGAGCTGG + Intronic
1157419398 18:47532339-47532361 CATGTCTTAATGAGATGAACTGG - Intergenic
1157695200 18:49716794-49716816 CCAGTCCCAGTAAGATGAGCCGG + Intergenic
1158399126 18:57104846-57104868 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1158853276 18:61517386-61517408 CCACTCCCATTGAGATGAGCCGG - Intronic
1159254626 18:65930667-65930689 GTAGTCCCAGTGAGATGAACCGG - Intergenic
1159520221 18:69510468-69510490 AAAGTCCAAATGAGATGAATTGG + Intronic
1159562093 18:70007058-70007080 CCAGCTCCAGTGAGATGAGCTGG - Intronic
1159570819 18:70110363-70110385 CCAGTCCCAGTGAGATGAACCGG - Intronic
1159581229 18:70236519-70236541 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1159661314 18:71098462-71098484 GCAGTCCTAATGAGATGAACTGG + Intergenic
1159690683 18:71483349-71483371 CCATTCCCAATGAGACGAAAGGG + Intergenic
1160466745 18:79083750-79083772 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1163989791 19:20987997-20988019 GCAGTCACAATGAGATGAACTGG - Intergenic
1164047635 19:21555977-21555999 CCAGTCCCAGTTGGATGAACTGG + Intronic
1164112647 19:22184157-22184179 CCAGTCCCGTTGAGATAAACCGG - Intronic
1164152438 19:22566494-22566516 TCAGTCCCAATGAGATGAACTGG + Intergenic
1164210180 19:23091699-23091721 CCATTCCAAATGAGATAAATTGG - Intronic
1164416503 19:28050336-28050358 CGAGTACCAATGAGATGAACTGG - Intergenic
1165009121 19:32830934-32830956 CCAGTTCAGATGAGCTGAACAGG + Intronic
1165472718 19:36012793-36012815 CCAGTCTCAATGATCTGAACTGG + Intronic
1165970491 19:39624605-39624627 CCAGTAGCGATGAGATGAACCGG + Intergenic
1166263098 19:41656838-41656860 CCAGTCCCAATGAGATGAGCTGG - Intronic
1167974221 19:53210645-53210667 CCAATTCCAGTGAGATGAAGTGG + Intergenic
1168340434 19:55620251-55620273 CCAGTTCCAAAGATATTAACTGG + Intergenic
1168530948 19:57128107-57128129 CTAGTCCCGATGTGATGAACTGG + Intronic
925252541 2:2452032-2452054 CCAGTCCCAGTGAGATGACCTGG + Intergenic
925484593 2:4313697-4313719 CCAGTCTTAGTGAGATGAGCTGG + Intergenic
925627956 2:5860910-5860932 CCAGTCCCAATGAGATGAACTGG + Intergenic
926181503 2:10648322-10648344 CCAGACACAAAGAGTTGAACGGG + Intronic
926483544 2:13428130-13428152 CCTGTCCCAATGAGATGAACTGG + Intergenic
926508503 2:13744972-13744994 CCAGTCCCAATTAGACGAGCTGG - Intergenic
927021418 2:19020833-19020855 CCAGTCCCAATGAGATGAACTGG + Intergenic
927182705 2:20458404-20458426 CCAGTCCCAATGAGAGGAGCTGG - Intergenic
927306552 2:21580208-21580230 CAAGTCCCAATGAGTTAAATGGG - Intergenic
927955911 2:27207249-27207271 CCAGTGCCTATGAGGTGAGCAGG - Exonic
928488190 2:31754148-31754170 CCGGACCCAGTGAGATGAACTGG - Intergenic
929064841 2:37963041-37963063 CCAGTCCCAATGAGATGAACTGG + Intronic
929131270 2:38575523-38575545 CCAGACTTAATGATATGAACTGG - Intronic
930176143 2:48303275-48303297 CCAGTCCCAGTGAGATGAACAGG + Intergenic
930323240 2:49881990-49882012 CCATTCCCAGTGAGATGGATTGG - Intergenic
931030305 2:58168249-58168271 CCAGTCCCAATGAGGTGAGCCGG - Intronic
931479232 2:62622616-62622638 CCAGTCCCGATGAGATGAGCCGG + Intergenic
931480291 2:62633086-62633108 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
931566338 2:63619821-63619843 CCAGTCCCAATGAGATGAGCTGG - Intronic
931855310 2:66296873-66296895 CCAGTCCCAGAGATATAAACAGG - Intergenic
931886791 2:66626318-66626340 CCAGTCCCAATGAGATGAACTGG + Intergenic
932048299 2:68372570-68372592 CCAGTCCCATGATGATGAACAGG + Intronic
932511907 2:72300870-72300892 CCAGTCCCAATGAGATGAACCGG + Intronic
932646878 2:73511509-73511531 CCAGTCTCAATGAGATGAACTGG + Intronic
932868755 2:75374919-75374941 CCAGTCCCAATGAGATGAACCGG + Intergenic
932899410 2:75681229-75681251 CCAGGCCCAATGAGATGAACTGG - Intronic
933324155 2:80814916-80814938 CCAGTCCCAATTAGATGAACTGG - Intergenic
933355547 2:81205882-81205904 CCAGTCCCAAAGAGATGATCTGG - Intergenic
933413301 2:81951546-81951568 CCAGCCCCAATGAGATGAGCTGG + Intergenic
933488380 2:82950865-82950887 CCAGTCCCAATGAGATGAGCCGG + Intergenic
933607426 2:84398242-84398264 CCAGTCCCAATGAGATGAACTGG - Intergenic
935399345 2:102644130-102644152 CCAGTCCCAATGAGATGACCCGG - Intronic
935852169 2:107235129-107235151 CCAGTCCCAATGAGATGAACTGG - Intergenic
935961397 2:108429244-108429266 CCAGTCCCAATGAGATGAGCTGG - Intergenic
936169457 2:110155705-110155727 CCATTCCAAATGGGATAAACTGG - Intronic
936769620 2:115895423-115895445 CCAGTCCTAATGAGATGAGCAGG + Intergenic
936900024 2:117472294-117472316 CCAGTCCCAATGAGATGAACAGG - Intergenic
937188349 2:120068079-120068101 CCAGCCCCAATGAGATGAGCTGG - Intronic
937526047 2:122771877-122771899 CAAGTTCCAATGAGATGAATAGG - Intergenic
937679229 2:124626374-124626396 TCAGTCCCAATTAGATGAACTGG - Intronic
937807199 2:126160587-126160609 ACAGTCCCAATGAGATGAGCCGG - Intergenic
937893205 2:126956386-126956408 CCAGTCCCAATGAGATGAGCTGG - Intergenic
938144648 2:128823488-128823510 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
938568192 2:132539385-132539407 CCAGTCCCAATGGGATGAAATGG + Intronic
938952410 2:136267081-136267103 CCAGTCCCAGTGAGATGAACCGG + Intergenic
939023043 2:136980953-136980975 TCAGTCCCAGTGAGATAACCTGG + Intronic
939640939 2:144639023-144639045 CCAGTCTCAATGAGATAAGCTGG + Intergenic
939652711 2:144785075-144785097 CCAGTCCCAATAAGATGAGCTGG - Intergenic
939840521 2:147182314-147182336 CCAGTCCCAATGAGATGAACCGG - Intergenic
939941910 2:148361819-148361841 CTAGTTCCAATGAGATGAGCTGG - Intronic
940030648 2:149257987-149258009 CCAGTCCCAGTGAGATGAACCGG + Intergenic
940054633 2:149500553-149500575 TCAGTCTCAGTGAGATGAATTGG + Intergenic
940124766 2:150311117-150311139 CCTGTCCCAATGAGATGAACTGG - Intergenic
940370463 2:152895677-152895699 CCAGTCCCAATGAGATGAGCTGG - Intergenic
940408176 2:153329145-153329167 CCAGTCCCAATGAGATGAACCGG + Intergenic
940565251 2:155351873-155351895 CCAGTCCCAGTGAGATCAACTGG + Intergenic
940572531 2:155456791-155456813 CCAATCCATATGAGATAAACAGG - Intergenic
940594100 2:155767399-155767421 CCAGTCCCAGTGAGATGAACCGG + Intergenic
940998926 2:160180788-160180810 CCAGTCCCAGTGAGATGAGCTGG - Intronic
941115107 2:161462740-161462762 TCAGTCCCAATGAGATGAACCGG + Intronic
941119505 2:161513011-161513033 CCAGTCCCAATGACATGAGCTGG - Intronic
941239481 2:163017955-163017977 CCAGTCCCAGTGAAATGAACTGG + Intergenic
941276495 2:163497484-163497506 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
941477951 2:165971596-165971618 CCAGTCCCAGTGAGATGAACTGG - Intergenic
941518810 2:166511889-166511911 GCAGTCCCAATGAGATGAATTGG + Intergenic
941682431 2:168413385-168413407 CCAGTCCCAATGAGATGAGCTGG + Intergenic
942410940 2:175708914-175708936 CCAGCCTCAACGAGATTAACTGG - Intergenic
942431390 2:175914642-175914664 CCAGTCCCAATGAGATGAACGGG + Intergenic
942722132 2:178965424-178965446 CGAGTACCAATGAGATGAACCGG - Intronic
943074736 2:183179867-183179889 CCAGTCCCAGTGAGATGAACCGG + Intergenic
943085097 2:183301157-183301179 CCAGTCCCAATAAGACGAAATGG + Intergenic
943094791 2:183416418-183416440 CCAGTCCCAATGAGATGAACAGG - Intergenic
943105605 2:183543339-183543361 CCAGTCCCAATGAGACGAGCTGG - Intergenic
943147779 2:184066479-184066501 CCAGTCCCAGTGAGATGAACTGG + Intergenic
943240476 2:185377360-185377382 CCAGTCCCAAGGAGATGAACTGG + Intergenic
943350626 2:186792813-186792835 CTAGTCCGTATGAGATGAACTGG - Intergenic
943352427 2:186811865-186811887 CCAGTCCCAGTGAGATGAACCGG - Intergenic
943409700 2:187532379-187532401 CCAGTCCCAATGAGATGAGCTGG - Intronic
943437596 2:187885800-187885822 CCATTCCAAATGAGAAAAACTGG + Intergenic
943548640 2:189311774-189311796 CCAGGTCCAATGTGATGAGCTGG - Intergenic
943552587 2:189358066-189358088 CCAGTCCCAATGAGATAAACCGG + Intergenic
943599222 2:189893560-189893582 CCAGTCCCAGTGAAATGAGCCGG + Intronic
943660386 2:190553963-190553985 CCAGTCCCAGTGAGATGAACTGG - Intergenic
944267809 2:197748047-197748069 CCAGTCCCAGTGAGATGAGCTGG - Intronic
944291941 2:198018031-198018053 CCAATCCCAGTGAGATGAACCGG - Intronic
944347281 2:198684554-198684576 CCAGTCCCAATGAGATGAACTGG - Intergenic
944613060 2:201430839-201430861 CAAGCCCCAGTGAGATGAACCGG + Intronic
944635311 2:201670858-201670880 CCAGTCCCAGTGAGATGAGCTGG - Intronic
944764253 2:202848937-202848959 CCAGTCCCAGTGAGATGAACTGG - Intronic
945207137 2:207344260-207344282 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
945466947 2:210181113-210181135 CGAGTCCCAGTGAGATGAGTTGG - Intergenic
945486997 2:210407536-210407558 CCAGTCCCAATGAGATGAACCGG + Intergenic
945533815 2:210987328-210987350 CCAGTCCCAATGAGATGAACTGG + Intergenic
946065414 2:216983039-216983061 CCAGTCCCAATAAGATGAACTGG + Intergenic
946649089 2:221871848-221871870 CCAGTCCCAGTGAGATGAACTGG - Intergenic
946696907 2:222368771-222368793 CCAGTCCCAATGAGAAGAACCGG + Intergenic
946790307 2:223293964-223293986 CCAATCTCAATGAGATGAGCTGG + Intergenic
947033414 2:225824352-225824374 CCAGTCCCAGTAAGATGAACTGG - Intergenic
947085957 2:226453725-226453747 CCAGTCCCAACGAGATGAGCCGG - Intergenic
947311668 2:228809660-228809682 CCAGTCTCAGTGAGATGAGCTGG + Intergenic
1168938699 20:1690713-1690735 CCCGTCCCAGTGAGATGAGCTGG - Intergenic
1169320926 20:4632647-4632669 CCATTCCAAATGAGAGGAATTGG - Intergenic
1169397140 20:5242057-5242079 CCAGTCCCAATGAGATGAGTTGG + Intergenic
1169421421 20:5463709-5463731 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1169960427 20:11153101-11153123 TCAGTCCCAGTGAGATGAGCCGG + Intergenic
1169984197 20:11423460-11423482 CCAGTCCCAATGAAGTGAACTGG + Intergenic
1170294144 20:14806253-14806275 CCAGTCCCAGTGAGATCAACCGG - Intronic
1171441300 20:25165735-25165757 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1171513494 20:25707051-25707073 GCAGTCCCAATGAGATGAACTGG + Intergenic
1172466675 20:35160742-35160764 CCAGTCCCAATTAGATAAACCGG - Intergenic
1173318737 20:41968522-41968544 CCAGTCCCAATGAGATGAACTGG + Intergenic
1174970105 20:55265290-55265312 CCAGTCCCAGTGACATGGAGAGG + Intergenic
1176987770 21:15456677-15456699 TCAGTCCCAATGAGAGAAACAGG + Intergenic
1177092055 21:16781632-16781654 CCAGTCCCAGTGAGATAAGCTGG - Intergenic
1177156473 21:17506292-17506314 CCAATCCTAAAGAGATTAACTGG + Intergenic
1177313144 21:19423953-19423975 CCAGTCCTAATGAGATGAACTGG - Intergenic
1177387358 21:20425463-20425485 CCAGGCCCAATACGATGAGCTGG - Intergenic
1177425801 21:20921879-20921901 CCAGTCCCAAAGAGATGAGCCGG - Intergenic
1177517834 21:22177738-22177760 CGAGTCCCAATGAGATGAACTGG - Intergenic
1177694486 21:24554689-24554711 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1178007026 21:28233847-28233869 CCATTCCCAATAAGATGAACCGG - Intergenic
1178393471 21:32219276-32219298 CCAGTCCCAAGGAGATGAACCGG - Intergenic
1178864543 21:36317017-36317039 GCAGTCTCAATGAGATGAGCCGG + Intergenic
1179827146 21:43972506-43972528 CCTGTCCCAATGAAATAAAATGG + Intronic
1180641052 22:17299655-17299677 CCAGTCCCAATGAGATGAATAGG + Intergenic
1182952590 22:34391150-34391172 CCAGTCCCAGTGAGATAAGCTGG + Intergenic
1183021585 22:35031287-35031309 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1183182811 22:36272221-36272243 CCAGTCCCAATGAGATGAACTGG + Intergenic
949227301 3:1710484-1710506 TCAGACCCAATGTCATGAACTGG + Intergenic
949377575 3:3407467-3407489 CCAGTCCCAGTGAGTTTTACTGG - Intergenic
949423607 3:3891948-3891970 CCAGTCCCAATGAGATGAGCTGG + Intronic
949583268 3:5412320-5412342 CCAGTCCCAAAGAGATGATCCGG - Intergenic
949640484 3:6030367-6030389 CCAATCCCAATGAGACGAACTGG + Intergenic
949683504 3:6541821-6541843 CCAGTCCCAATGAGATGAACTGG + Intergenic
949954955 3:9259949-9259971 CCAGGCCCAATGAGATGAGGTGG - Intronic
950991936 3:17449036-17449058 CCAGTCCCAATGAGATGAGAAGG - Intronic
951135888 3:19103753-19103775 CCAGTCCCCATGAGATGACTTGG + Intergenic
951183237 3:19682822-19682844 CCAGTCCCAGTGAGACAACCAGG + Intergenic
951237807 3:20255022-20255044 CCAGTCCCAGTGAGATGAACTGG + Intergenic
951254591 3:20433455-20433477 CCTGTCCCAGTGAGATGAGCCGG + Intergenic
951286663 3:20821417-20821439 CAAGCCCCAGTGAGATGAACCGG + Intergenic
951347333 3:21561487-21561509 CCAGTCCCAATGAGATGAACTGG + Intronic
951415221 3:22414882-22414904 CCAGTCCCAGTGAGATGAATCGG + Intergenic
951434322 3:22643781-22643803 CCAGTCCCAATGAGATGAACTGG + Intergenic
951503762 3:23418383-23418405 CCAGTCCCAGTAAGATGAGTAGG + Intronic
951741589 3:25931280-25931302 CCAGTCCCAATGAGATGAACTGG - Intergenic
951826573 3:26875611-26875633 CCAGTCCCAATAAGATGAACCGG - Intergenic
952105455 3:30065088-30065110 CCATTCCAAATGGGAGGAACTGG + Intergenic
952608157 3:35174148-35174170 CCAGTCCCAGTGAAATGAACTGG + Intergenic
953073972 3:39551004-39551026 CTAGTCCTAGTGAGATGAACTGG - Intergenic
953286550 3:41616442-41616464 TCAGTCCCAGTGAGATGAACTGG - Intronic
953555878 3:43946399-43946421 CCAGTCTCAGTGAGATGAGCCGG + Intergenic
954507554 3:51091806-51091828 CCAGTCCCAGTGAGATGAACCGG - Intronic
954508288 3:51097953-51097975 CCAGCCCCAATGAGATGAGCTGG + Intronic
954524850 3:51261215-51261237 CCAGTCCCAATGAGATGAGCCGG - Intronic
954530970 3:51320119-51320141 CCAGTCCCAATGAGATGAGCTGG - Intronic
954935690 3:54324396-54324418 CCATTACCAATGAGATGACAGGG - Intronic
954950435 3:54468231-54468253 CCAGTCCCAATGAGATGACTTGG - Intronic
955078594 3:55637049-55637071 CCAGTCCCCAGGAGAGGGACAGG - Intronic
955414396 3:58678937-58678959 CCAGTCCTAATGAGATAAGCCGG + Intergenic
955439662 3:58942373-58942395 CCAGTCCCAGTGAAATGAGCCGG - Intronic
955447708 3:59031996-59032018 CCAGTCTCAGTGAGATGAGCTGG - Intronic
955454060 3:59100850-59100872 CCAGTCCTAATGAGATGAACTGG + Intergenic
955630350 3:60966449-60966471 CAAGCCCCAGTGAGATGAACCGG + Intronic
955868968 3:63417168-63417190 CCATTCCAAATGGGATAAACTGG + Intronic
956005725 3:64776587-64776609 CCAGTCCCAGTGAGATGAACTGG - Intergenic
956157424 3:66312841-66312863 CCAGTCCCATTGAGATGAACCGG + Intronic
956192428 3:66620608-66620630 CTGGACCCAATGAGATGAGCTGG - Intergenic
956207813 3:66772163-66772185 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
956243307 3:67154083-67154105 CCAGTCCCAGTGAGATGAACTGG - Intergenic
956302000 3:67781957-67781979 CCAGTCCCAATGAGATGAACTGG + Intergenic
956935929 3:74101855-74101877 CCACTGCCAATGGGATCAACAGG - Intergenic
957009442 3:74986666-74986688 CCAGTCCCAATGAGATGAACTGG + Intergenic
957474753 3:80709227-80709249 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
957489400 3:80905179-80905201 CCAGTCCCAATGAGAAGAACTGG - Intergenic
957695640 3:83635598-83635620 CCAGTCCCAATGAAGTGAGCAGG - Intergenic
957747767 3:84366641-84366663 CCAGTCCCAGTGAGATAAACTGG + Intergenic
957850525 3:85800748-85800770 CCAGTCCCATTGAGATGAACTGG + Intronic
957953080 3:87149686-87149708 CCATTCCAAATGAGATAAATGGG + Intergenic
957993347 3:87654214-87654236 ACCATCCCAATGAGATGAACTGG + Intergenic
958094759 3:88929613-88929635 CCAGTCTCAATGAGATGAAGTGG - Intergenic
958434625 3:94081250-94081272 CCAGTCCCAATGAGATGAACCGG + Intronic
958694654 3:97511522-97511544 CCAGTCCCAATTAGATGAGTCGG + Intronic
959091898 3:101911726-101911748 CGAGTCCCAGTAAGATGAACAGG + Intergenic
959120209 3:102223417-102223439 CCAGTCCCAATGAGATAAACCGG + Intronic
959278126 3:104304111-104304133 CCCATCCCATTGAGTTGAACTGG - Intergenic
959494858 3:107038450-107038472 CCAGTCCCGATGAGATGAACTGG - Intergenic
959505836 3:107155821-107155843 CCAGTCCCAGTGAGATGAACTGG - Intergenic
959734889 3:109647688-109647710 CTAGTCCCAGTGAGATGAGCCGG - Intergenic
959800901 3:110494808-110494830 CCAGTCCCAGTGAGATGAACCGG - Intergenic
959842773 3:110998399-110998421 CCAGTCCCAATGAGATGAGCCGG - Intergenic
960763412 3:121097655-121097677 CCATTCCCAGTGAGATGAACCGG + Intronic
960827796 3:121811085-121811107 CCAGTCCCAATGAGATGAACTGG - Intronic
960952029 3:123005595-123005617 CCAGTTACAATGAGAGGAATTGG - Intronic
962064286 3:131963051-131963073 CCAGTCCCAATCAGATGAACCGG - Intronic
962512247 3:136114065-136114087 CCAGTCCCAATGAGATGAACTGG - Intronic
962642447 3:137401161-137401183 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
962668298 3:137679138-137679160 CCAGTCCCAATGAGATGAATTGG - Intergenic
963027352 3:140933184-140933206 CCAGTCCCAACGACATGAACTGG - Intergenic
963401823 3:144807327-144807349 CCAGTCCCAGTGAAACGAATTGG + Intergenic
963410943 3:144926839-144926861 CCAGTCCCATTGAGATGAACTGG + Intergenic
963629386 3:147713503-147713525 CCAGTTCCAATGAGATAAGCTGG + Intergenic
963898573 3:150711935-150711957 CCAGTCTCAATGAGATGAACTGG - Intergenic
963980138 3:151528503-151528525 CCATTCCCAGTGAGATGAACAGG - Intergenic
963998650 3:151740333-151740355 ACAATCCCAATGAGGTGAACTGG + Intronic
964010244 3:151884779-151884801 CCAGTCCCAGTTATATGAACCGG - Intergenic
964010278 3:151884946-151884968 CCAGTCCCAGTTATATGAACCGG - Intergenic
964053006 3:152419375-152419397 CCAGTCCCAGTGAGATGAACTGG - Intronic
964232391 3:154486596-154486618 CCAGTCCCAGTGAGATGAACTGG - Intergenic
964371458 3:156004427-156004449 CCAGTCCCAATGAGATGAGCTGG + Intergenic
964378120 3:156069518-156069540 CTAGTCCCCGTGAGATGAACTGG + Intronic
964649199 3:158991912-158991934 CCAGTCCCAAAGAGATGAACTGG + Intronic
964904741 3:161706888-161706910 CCAGCCCCAGTGAGATGAACTGG - Intergenic
965017331 3:163174497-163174519 CCAGTCACAATAAGATGAGCTGG - Intergenic
965288898 3:166850191-166850213 TCAGTCCCAAGGAGAGGACCTGG + Intergenic
965497178 3:169413154-169413176 CCAGTCCCAGTGAGATGAACTGG - Intronic
965511014 3:169568019-169568041 CGAGTCCCAATGAGATGAGCTGG - Intronic
965550457 3:169959724-169959746 CCAGTTCTAATTAGATGCACTGG + Intergenic
965655134 3:170975613-170975635 CCAGTCCTAATGAGATGAACGGG + Intergenic
965801386 3:172497242-172497264 CCAGTCCCAGTGAGATAAACTGG + Intergenic
965880353 3:173381950-173381972 CCAGTCCCAATGAGATGAGCTGG - Intergenic
966250987 3:177865524-177865546 CCAGTCCCAATGAGATGAGCCGG - Intergenic
966309311 3:178576145-178576167 CCAGTCCCAATGAGATGAGCCGG - Intronic
966493630 3:180556090-180556112 CCAGTCCCAGTGAGATGAATGGG - Intergenic
966533392 3:181004849-181004871 CCAGTCCCAATGAGATGAGTTGG + Intergenic
966638009 3:182157048-182157070 CTAGTCCCAGTGAGATGAGCTGG + Intergenic
967181598 3:186909890-186909912 CCAGTCCCTGTGAGATGAACTGG + Intergenic
967419662 3:189259339-189259361 TCAGTCCCAATGAGATGAACTGG + Intronic
967715492 3:192757856-192757878 CCAGTTCCAGTGAGATGAACTGG - Intronic
969054316 4:4392165-4392187 CCCATCCCAATGGGATGAAGGGG + Intronic
969164911 4:5299138-5299160 CCAGTTCCAGTGAGATGAACTGG + Intronic
969909275 4:10428414-10428436 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
970185459 4:13446690-13446712 CCAGTCCCAATGAGATGAACTGG + Intronic
970214616 4:13745711-13745733 CCAGTCCTAATGAGATGAACAGG + Intergenic
970304631 4:14718742-14718764 CCAGCCCCAATGAGATGAACTGG - Intergenic
970714632 4:18907561-18907583 CCAGTCCCAGTGAGATGAACTGG - Intergenic
970784556 4:19780413-19780435 CCAGTCCCAGTGAGATGAACTGG + Intergenic
971286156 4:25291713-25291735 CCAGTCCCAATGAAAGAACCTGG + Intergenic
971430154 4:26556862-26556884 CAATTCCCAATGAGATGAGCTGG + Intergenic
971673698 4:29596011-29596033 CCAGTCCCAATTAGTTGAGCTGG + Intergenic
971749111 4:30623827-30623849 CCAGTCCCAATGAAATGAGCAGG - Intergenic
971883148 4:32409182-32409204 CCAGTCTAAATGAGAAGAACTGG - Intergenic
971943288 4:33241914-33241936 CCAGTCTCAATGAGATGAACAGG + Intergenic
972372540 4:38438539-38438561 CCAGTCTTAATGAGATGAACTGG + Intergenic
972538743 4:40020995-40021017 CCAGGCCCAATATGATGAGCTGG + Intergenic
972860896 4:43168612-43168634 TCCGTCCCAATGAACTGAACTGG - Intergenic
972863560 4:43202160-43202182 CCTTTCCCAATGAGGTGAATAGG + Intergenic
973081941 4:46003593-46003615 CAAGTCCCAGTGACATGAGCCGG + Intergenic
973321700 4:48817088-48817110 CCAGTCCCAGTGAGATGAACTGG - Intronic
973556911 4:52092550-52092572 CCAGTTCCAATGAGATGAACTGG + Intronic
973562556 4:52151298-52151320 CCAGTCCCAGTGAGAGGAACTGG - Intergenic
973715311 4:53670154-53670176 TTAGTCCCAGTGAGATGATCTGG + Intronic
973732203 4:53833450-53833472 CCAGTCCCATTGAGATGAACTGG - Intronic
974161662 4:58149361-58149383 CCAGTCCCAGTGAGATGAATCGG - Intergenic
974265834 4:59584587-59584609 CCAATCCCAATGAGATGAATTGG + Intergenic
974301977 4:60081117-60081139 CCAGTCCCAGTGAGATGAACTGG - Intergenic
974557014 4:63464385-63464407 CCATTCCAAATGAGATAAACTGG + Intergenic
974560008 4:63505759-63505781 CTAGTCCCAGTGAGATGAACTGG - Intergenic
974573250 4:63683056-63683078 TCAGTCCCAATGAGATTAACAGG + Intergenic
974851871 4:67413079-67413101 CTAGTCCCAATGAGATGAGCTGG + Intergenic
975104023 4:70548359-70548381 CCAGTCTCAATGAGATGAGCAGG - Intergenic
975149515 4:71005306-71005328 CCAGTCCCAATGAGATGAATTGG + Intronic
975177809 4:71308523-71308545 CCAGTCCCAGTGAGATGAACTGG - Intronic
975213056 4:71723014-71723036 CCAGTCCCAATGAGATGAACTGG + Intergenic
975245767 4:72119578-72119600 CCAGTCCCAATGAGATGAACTGG - Intronic
975305569 4:72846079-72846101 CAAGTCCCAATGAGATGAACTGG - Intergenic
975350513 4:73340386-73340408 CTAGTCCCAATGAGATGAGCTGG + Intergenic
975466428 4:74714298-74714320 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
975479256 4:74859666-74859688 CTAGTCCCACTGAGATGAACAGG - Intergenic
975524157 4:75331100-75331122 CCAGTCCCAATGAGATAAACTGG - Intergenic
975620420 4:76290946-76290968 CTAGTCCCAATGACACGAACAGG + Intronic
975638689 4:76477775-76477797 CCAGTCCCAATGAGATGAGCTGG - Intronic
975764589 4:77654538-77654560 CTAGTCCCAGTGAGATGAGCTGG - Intergenic
976024029 4:80665069-80665091 TCAGTCTCAATGAGATGAGCTGG + Intronic
976061356 4:81131311-81131333 CCAGTCCTAATGAGATAAGCTGG + Intronic
976065461 4:81183291-81183313 CCAGTCCCAGTGAGATGAGCTGG - Intronic
976092621 4:81473479-81473501 CCAGTCCCAGTGAGATGAACTGG - Intronic
976290428 4:83412079-83412101 CCATTCCCAGAGAGAAGAACTGG + Intronic
976446069 4:85130458-85130480 CCAGTCCCAATGAGATGAGCTGG + Intergenic
976810026 4:89090371-89090393 CCAGTCCCAATGAGATGAGCTGG + Intronic
976861404 4:89671225-89671247 CCAGTCCCAATGAGATGAACTGG - Intergenic
977185731 4:93933101-93933123 CCAGTCCCAATGAGATGAGCTGG + Intergenic
977467843 4:97403693-97403715 CCAGTCCTAGTGAGATGAACCGG + Intronic
977500180 4:97828187-97828209 CCAGTCCCAATGAGATGAACTGG - Intronic
977524463 4:98126587-98126609 TCAGTCCCAATGAGAGAACCTGG + Intronic
977561442 4:98537332-98537354 CCAGTCCCAGTGAGATGAACCGG + Intronic
977631570 4:99248546-99248568 CCAGTCCCAATGAGTTGAACTGG + Intergenic
977774335 4:100900261-100900283 CCGGTCCCAATGAGATAAGCTGG - Intergenic
977792843 4:101128546-101128568 CCAGTCCCAGTGAAATGAACCGG - Intronic
977897907 4:102384650-102384672 CCAGTCCCAGTGAGATGAACTGG + Intronic
977986076 4:103385194-103385216 CTAGTCCCAGTGAGATGAATGGG - Intergenic
977994365 4:103484534-103484556 CCAGTCCCAATGAGATGAGCTGG - Intergenic
978186161 4:105858749-105858771 CAAGTCCCAGTGAGATGAATGGG + Intronic
978601513 4:110432506-110432528 CCAGTCCCAGTGAGATGAGCCGG + Intronic
978906721 4:114013512-114013534 CCAGTCCCAATGAGATGAACTGG + Intergenic
979012236 4:115387046-115387068 CCAGTCCCAATGAGAGGAACTGG - Intergenic
979022959 4:115525611-115525633 CCCATCCCAATGACATGAACTGG + Intergenic
979023037 4:115526929-115526951 CCAGTCCCAATGAGTTGAATTGG - Intergenic
979115188 4:116814916-116814938 CCAGTCCCAGTGACATGAACTGG - Intergenic
979162846 4:117485626-117485648 CTACTCCCACCGAGATGAACAGG - Intergenic
979417364 4:120460437-120460459 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
979512172 4:121567300-121567322 CCAGTCTCAATGAGACGGACCGG - Intergenic
979819470 4:125152176-125152198 TGAGTACCAATGAGATGAACTGG + Intergenic
980090466 4:128437526-128437548 CAATCCCCAGTGAGATGAACCGG + Intergenic
980100417 4:128536222-128536244 CCAGTCCCAATGAGATGAACTGG + Intergenic
980157728 4:129126861-129126883 CCAGTCCCAATGAGATGAGCCGG + Intergenic
980200512 4:129651352-129651374 CCAGTCCCAAAGAGATGAACTGG - Intergenic
980215063 4:129842156-129842178 CCTATCCCTATGAGATGAACTGG - Intergenic
980223391 4:129948329-129948351 GCAATCCCAATGAGACAAACTGG + Intergenic
980285753 4:130776834-130776856 CTAGTCCTAATGAGATGAACTGG - Intergenic
980583731 4:134786947-134786969 CCAGTCCCAATGAGATGAGCTGG + Intergenic
980634020 4:135474302-135474324 CCAGCCCCAGTGAGATAAACCGG + Intergenic
980769245 4:137350676-137350698 CCAGTCCCAGTGACATAAACTGG - Intergenic
980855144 4:138431239-138431261 CCAGTCCCAATGAGATGAACTGG - Intergenic
981273077 4:142867516-142867538 CCAGTCCCAGTAAGATGAGCTGG - Intergenic
981290770 4:143071864-143071886 TCAGTCCCAATGAGAGAACCTGG + Intergenic
981481572 4:145243838-145243860 CAAGTCCCAGTGAGATAAGCTGG + Intergenic
981671445 4:147292270-147292292 CCAGTTCCAATGAGATGAGCCGG - Intergenic
981749759 4:148082364-148082386 CCAGTCCAAATGAGATAAGCCGG - Intronic
981788073 4:148503211-148503233 TCAGTCCTGATGAGATGAACTGG + Intergenic
981796344 4:148599316-148599338 CCAGTCCCAATGAGATGAACTGG + Intergenic
982060365 4:151598373-151598395 CCAGTCCCAATGAGATGAACCGG + Intronic
982393528 4:154891786-154891808 CAAGTCCCAGTGAGATTAACTGG - Intergenic
982725694 4:158903318-158903340 CCACTCCCAATGAGATGAGCCGG + Intronic
982733332 4:158979524-158979546 CCAGTTCCAGTGAGATGAGCCGG - Intronic
982815480 4:159878266-159878288 CCAGTCCCATTGAGATGAACTGG + Intergenic
982825646 4:160001452-160001474 CCAGTCCCAATGAGATGAGCTGG - Intergenic
982848071 4:160276363-160276385 CCAGTCCCAGTAAGAGGAACTGG - Intergenic
982909312 4:161118588-161118610 CCAGTCCCAATGATGTGAACCGG + Intergenic
982915487 4:161203747-161203769 CCAGTCCCAATGAGATGAACTGG - Intergenic
983167786 4:164498063-164498085 TGAGTCCCAGTGAGATGAACTGG + Intergenic
983364695 4:166770210-166770232 TAAGCCCCAGTGAGATGAACCGG + Intronic
983388104 4:167092092-167092114 CCAGTCCCAGTGAGATGAGCTGG - Intronic
983485995 4:168331691-168331713 CCAGTCCCATTGAGATGAACTGG + Intergenic
983543196 4:168935075-168935097 CCAGTCCCAATGAGATGAGCTGG - Intronic
983596400 4:169472476-169472498 CCAGTCCCAATGAGATGAACTGG + Intronic
983602844 4:169549299-169549321 CCAGTTCCAATGAGATGAACTGG + Intronic
983775005 4:171595294-171595316 TCAGTCCCAATGAGAGAACCTGG + Intergenic
983840761 4:172455013-172455035 CCAGTCCCAGTGAGATGGGCTGG - Intronic
983949551 4:173622900-173622922 CCAGTCCCAATGAGATGAGCTGG + Intergenic
984354104 4:178636780-178636802 CCAGTCCCAATGAGATGAGCCGG - Intergenic
984454374 4:179945714-179945736 CCATTCCAAATGGGATAAACTGG - Intergenic
984475800 4:180232838-180232860 CCAGTCCCACTGTCATGAAGAGG - Intergenic
984493588 4:180468209-180468231 ACAATCCCAATGAGATGAGCCGG - Intergenic
984618542 4:181926811-181926833 CCAGTCCCAATGAGATGAGCTGG - Intergenic
984902851 4:184600492-184600514 CCAGTCCCAATGAGATGAGCCGG - Intergenic
985317318 4:188672295-188672317 CCAGTCCCAGTGAGATGAACTGG - Intergenic
986110252 5:4709432-4709454 CCAGTCTCAGTGAGGTGAACTGG - Intergenic
986358446 5:6951918-6951940 CCAGTCCCAATGTGACAAACAGG - Intergenic
986378920 5:7163127-7163149 CCAGTCCCAATGAGATGAACCGG + Intergenic
986664882 5:10093387-10093409 CCAGTCCGAATGAGATGAACTGG - Intergenic
986920618 5:12674609-12674631 CCAGTCCCAGTGAGACGAGCTGG + Intergenic
986996542 5:13613705-13613727 CCAGTCCCGATGAGATGAACTGG - Intergenic
987656444 5:20814431-20814453 CCAGACCCAATGAGATGAGCTGG - Intergenic
987704715 5:21447363-21447385 CCATTCCCAATGAGATGAATGGG + Intergenic
987720661 5:21628279-21628301 CGAGTCCCAATGAGATGAGCTGG + Intergenic
987924167 5:24318296-24318318 CCATTCCCAGTGGGATTAACTGG + Intergenic
988021373 5:25626758-25626780 CAAGTCCCAGTGAGATGAACTGG - Intergenic
988167914 5:27617637-27617659 CCAGTCCCAATGCGATGAACTGG + Intergenic
988402013 5:30775236-30775258 CCAGTCCCAATGAGATGAACTGG - Intergenic
988618122 5:32794807-32794829 CAAGTCCCAATGAGATAAACTGG - Intergenic
988628109 5:32899206-32899228 TCAGTCCCTGTGAGATGAGCCGG + Intergenic
988719115 5:33858809-33858831 CCAGTCCCAATGAGATGAGCTGG - Intronic
988767113 5:34389514-34389536 CCAGACCCAATGAGATGAGCTGG + Intergenic
988772685 5:34448137-34448159 GCAGTCCCAGTGAGATGAACTGG + Intergenic
988774893 5:34468902-34468924 CCAGTCCCAATGAGATGAACAGG - Intergenic
988802809 5:34712370-34712392 CAAGTCTCAATGGGAGGAACAGG + Intronic
988970702 5:36465059-36465081 CCAGTCCCAATGAGATAAACTGG - Intergenic
989675345 5:43966273-43966295 CCAGTCCCAATGAGATGAACTGG + Intergenic
989825250 5:45847600-45847622 CCAGTCCCAGTGAGATAAGCTGG - Intergenic
990098768 5:52156440-52156462 CCAGTCTTGATGAGATGAACTGG - Intergenic
990164425 5:52978275-52978297 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
990183861 5:53191676-53191698 CCAGTCCCAATGAGATGAGCTGG + Intergenic
990231279 5:53715807-53715829 CCAGTCCCACTGAGATGAACTGG - Intergenic
990673980 5:58162660-58162682 CCAGTCCCAATGAGATGAGCTGG + Intergenic
990745951 5:58959426-58959448 CCAGTCCCAATGAGATAAGCTGG + Intergenic
990803415 5:59631546-59631568 CCAGGTCCAGTGAGATGAGCTGG - Intronic
990837716 5:60041601-60041623 CCAGTCCCAATGAGATGAGCTGG - Intronic
990897686 5:60716275-60716297 CCAGTCCCAATGAGATGAACTGG + Intergenic
991223486 5:64242888-64242910 CCAGTTCCAGTGAGATGAACTGG - Intronic
991236606 5:64406763-64406785 CCAGTCCCAGTGAGATGAACTGG - Intergenic
991397858 5:66223221-66223243 CCCGTCCCAATGAGATGAACTGG + Intergenic
991971505 5:72146250-72146272 CTAGTCCAAATTAGATGAGCTGG - Intronic
992025982 5:72669573-72669595 CTAGTCCCGATGACATGAGCCGG - Intergenic
992055219 5:72982251-72982273 CTAGCCCCAGTGAGATGAGCCGG + Intronic
992287196 5:75247944-75247966 CCAGTCACAATGAGATGAGCCGG - Intergenic
992292519 5:75293590-75293612 CCAGTCCCATTGAGATGAGCTGG + Intergenic
992317068 5:75566710-75566732 TCAGTCCCAGTGAGGTGAGCCGG + Intronic
992908607 5:81373165-81373187 CCAGTCTCAATGAGATGAACTGG - Intronic
992976990 5:82130686-82130708 CCAGTCCCAGTGAGATGAGCCGG + Intronic
992977793 5:82138563-82138585 CGAGTCCCAATGAGATGAACTGG + Intronic
993081199 5:83302532-83302554 CCAGTCCCAATGAGATGAAACGG + Intronic
993119048 5:83753368-83753390 CCAGTCCCAATAAGATGAACTGG - Intergenic
993381955 5:87218209-87218231 CCAGTCCCAATGAGATGAGCTGG + Intergenic
993402591 5:87472429-87472451 CCAGTCCCAATGAGATGAAATGG - Intergenic
993455195 5:88120038-88120060 CCATTCCCAGTGAGATGAGCCGG - Intergenic
993673860 5:90794780-90794802 CCAGTCCCAGTGAGATGAACCGG - Intronic
993757721 5:91751543-91751565 CCAGTCCCAACAAGATGAACTGG + Intergenic
993911458 5:93689856-93689878 CCAGTTCCAGTGAGATAAGCTGG - Intronic
993961056 5:94296744-94296766 CCAGTCCCAGTGAGATGAGCTGG + Intronic
994005257 5:94829309-94829331 CAAGTCCCAGTGAGATGAACCGG + Intronic
994138049 5:96309794-96309816 CCAGTCCCATTGAGATGAACTGG + Intergenic
994233625 5:97336728-97336750 CCAGTCTCAATGTGATGAGCTGG + Intergenic
994438161 5:99764113-99764135 CCAGTCCCAATGAGATGAACTGG + Intergenic
994575076 5:101567495-101567517 CCAGTTCCAATGAGATGAGCTGG + Intergenic
994622563 5:102179849-102179871 CCAGTCCCAATGAGATGAACTGG + Intergenic
994641862 5:102420917-102420939 TGAGTCCCGGTGAGATGAACCGG - Intronic
994918133 5:106005249-106005271 CCAGTCCCAGTGAGATGAACCGG + Intergenic
995094001 5:108213629-108213651 CCAGTCCCAGTGAGATGAACCGG + Intronic
995108107 5:108398571-108398593 CCAGTCCCAATGAGTTGAACCGG - Intergenic
995111768 5:108437064-108437086 CCAGTCCCAGTGAGATGAACTGG - Intergenic
995162596 5:108998490-108998512 CCAGTCCCAGTGAGATGAACCGG + Intronic
995179220 5:109214541-109214563 CAAGCCCCAGTGAGATTAACCGG + Intergenic
995301823 5:110594105-110594127 CCAGTCCCAATGAGATGAACTGG - Intronic
995398799 5:111717552-111717574 CCAGTCCCAATGAGATGAATGGG + Intronic
995612267 5:113923403-113923425 TCAGTCCCAATGAGATGAGCTGG - Intergenic
995633870 5:114163026-114163048 CAATCCCCAGTGAGATGAACCGG + Intergenic
995695643 5:114875993-114876015 CCAGTCCCAGTGAGATGAACTGG - Intergenic
995785826 5:115826242-115826264 CCAGTCCCAATGAGATGAACAGG + Intergenic
995808468 5:116080000-116080022 CCAGTCCCAATGAGATGAACCGG - Intergenic
995811241 5:116109037-116109059 TCAGTCCCAGTGAGATGAACTGG + Intronic
996280834 5:121727069-121727091 CCAGTCCCAATGAGATGAACAGG + Intergenic
996426710 5:123320655-123320677 CTAGTCTCAGTGAGATGAACTGG + Intergenic
996592180 5:125160494-125160516 CCAGTCGCAATGAGATGAACTGG - Intergenic
996910974 5:128656314-128656336 CCAGTCCCAATGAGATGAGCAGG + Intronic
996987592 5:129585238-129585260 CCAGTCCCAGTGAGATGAGCCGG + Intronic
997217933 5:132129764-132129786 CTAGTCCCAATGAGATGAACCGG + Intergenic
997252190 5:132397926-132397948 CTAGTCCCAACGAGATGAGCCGG - Intergenic
998691915 5:144596336-144596358 CCAGTCTCAATGAGATGAGCTGG + Intergenic
998768208 5:145512252-145512274 CCAGTCCCAATTAGATTAACTGG - Intronic
998780245 5:145647879-145647901 CAAGTCCCAATGAGATGAACTGG + Intronic
998927576 5:147142879-147142901 CCAGTCCCAGTGAGATGAACTGG + Intergenic
998934098 5:147216106-147216128 CAAGTCCCAGTGAGATGAACTGG - Intergenic
998977011 5:147659374-147659396 CCAGTCCCAGTGAGATGAACTGG + Intronic
999108089 5:149091495-149091517 CCATTCCAAATGAGATAAATGGG - Intergenic
999468569 5:151830947-151830969 CCAGTCCCAGTGAGATGAGCTGG - Intronic
999502478 5:152160647-152160669 CCAGCCCCAGTGGGATGAACCGG + Intergenic
999602500 5:153282653-153282675 CCAGTCCCAATGAGATGAACTGG - Intergenic
999983831 5:156984237-156984259 CCAGTCCCTATGAGATGAGCTGG - Intergenic
1000141169 5:158404601-158404623 CCATTCCAAATGAGAGAAACTGG - Intergenic
1000194869 5:158947533-158947555 CCAATCCCAATGAGATGAACTGG + Intronic
1000372984 5:160554990-160555012 CCAGTGGCAGTGAGATGAACAGG - Intergenic
1000376213 5:160584373-160584395 GCACTCCCAGTGAGATGAGCTGG + Intronic
1000417574 5:160998589-160998611 CTGGTCCCAGTGAGATGAACTGG + Intergenic
1000582303 5:163048979-163049001 CTAGTACCAATGAGATGAGCCGG + Intergenic
1000660441 5:163932622-163932644 CCAATCCCAGTGAGATGAACTGG - Intergenic
1000738541 5:164934785-164934807 CCAGTCCCAATGAGATAAACCGG + Intergenic
1000820281 5:165973998-165974020 CCAGTCCCATTGAGATAAACAGG + Intergenic
1002673446 5:180889497-180889519 TCAGTCCCACTGAGATAAGCCGG - Intergenic
1002685685 5:181007836-181007858 CCAGTCCCAATGAGATGAACAGG - Intergenic
1002996025 6:2286340-2286362 CCAGTCCCAGTGAGATAAAGCGG - Intergenic
1004503826 6:16231378-16231400 CCTGTCCCAATGGGATGGAAGGG - Intergenic
1005202748 6:23364995-23365017 CAATCCCCAGTGAGATGAACCGG + Intergenic
1005274088 6:24198302-24198324 CCAGTCCCAATGAGATGAGCCGG - Intronic
1005378189 6:25207047-25207069 CCAGTCCCAGTGAAATGAACTGG - Intergenic
1005778450 6:29162353-29162375 CCAGTCCTAATGAGAGGAACGGG + Intergenic
1005815306 6:29547245-29547267 CCAGTCCCAATAAGATGAACTGG - Intergenic
1006199866 6:32279010-32279032 CCAGTCCCAATGAGATGAACTGG - Intergenic
1007710794 6:43822805-43822827 CAAGTCCAAATGAGGGGAACTGG + Intergenic
1007858038 6:44878724-44878746 CCAGTCCCAATGAGATAAGCTGG - Intronic
1008053867 6:46926775-46926797 CCAGTCCCATGGAGAAGAGCAGG + Intronic
1008176292 6:48271387-48271409 CCAGTCTCAATGAGATGAACAGG + Intergenic
1008425308 6:51349649-51349671 CCAGTCCCAAAGAGATGAACCGG + Intergenic
1008575570 6:52856899-52856921 CCAGTCCCAATGAGATGAACTGG + Intronic
1008785017 6:55158106-55158128 CCAGTCCCAATGAGAGGAGCTGG - Intronic
1008865323 6:56203766-56203788 CCAGTCCCAGTGAGATGAACTGG - Intronic
1008896931 6:56566539-56566561 CCAGTCCCAATGAGATGAGCTGG + Intronic
1008997780 6:57679461-57679483 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1009054235 6:58316272-58316294 CCAGTCCTAATGAGATGAGCTGG - Intergenic
1009186272 6:60578799-60578821 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1009236900 6:61134307-61134329 CCAGTCCTAATGAGATGAGCTGG + Intergenic
1009264023 6:61531592-61531614 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1009455171 6:63848484-63848506 CCAGTCCCAATGAGATGAACTGG - Intronic
1009458658 6:63887456-63887478 CCAGTCCCAACGAGATGAACTGG - Intronic
1009536576 6:64896233-64896255 CCAGTACCAGGGAGATGAACTGG - Intronic
1009570084 6:65374187-65374209 CCAGTCCCAATGAGATGAACAGG - Intronic
1009718344 6:67428722-67428744 CCAGTCCCAATGAAATGAAACGG + Intergenic
1009727954 6:67558678-67558700 CCAGTTCCAATGAGATGAACTGG + Intergenic
1009740336 6:67734893-67734915 CCAGTCCCAATGAGATGAACTGG + Intergenic
1009797757 6:68494563-68494585 CCAGTCCCAATGAGATGAACAGG - Intergenic
1009880420 6:69560264-69560286 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1009959596 6:70501803-70501825 CCAGTGCCAATGTGATGAACTGG + Intronic
1010006136 6:70997793-70997815 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1010276247 6:73971920-73971942 CCAGTCCCAATCAGATGAACCGG - Intergenic
1010447091 6:75960211-75960233 CCAGTCCCAGTGAGATGAGTTGG + Intronic
1010522151 6:76850300-76850322 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1010668402 6:78656146-78656168 CCAGTCCCAATGTGATGAACAGG + Intergenic
1010681910 6:78807983-78808005 CCAGTCCCAATGAGATGAACTGG + Intergenic
1010936491 6:81869395-81869417 CCAGTCCCAATGAGAAGAGCTGG - Intergenic
1010973204 6:82284535-82284557 CCAGTTCCAATGAGATGAACTGG + Intergenic
1011065406 6:83320953-83320975 CCCATCCCAATGAGATGAACCGG - Intronic
1011086429 6:83546444-83546466 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1011299020 6:85854244-85854266 CCAGTCGCAATGAGATGAGCTGG + Intergenic
1011301533 6:85879247-85879269 CCAGTCCCAATAAGATGAGCTGG + Intergenic
1011766175 6:90622913-90622935 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1011773356 6:90700247-90700269 CCAGCCTCAATCAGATGATCAGG - Intergenic
1011776882 6:90740086-90740108 CCAGTCCTAATGAGATGAGCTGG + Intergenic
1011831326 6:91375033-91375055 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1012083168 6:94785781-94785803 CCAGTCCCAATGAGATGAGCAGG + Intergenic
1012128020 6:95454588-95454610 CCAGTCCTAATGAGATGAACTGG + Intergenic
1012302971 6:97612665-97612687 CCAGTTCCAGTGAGATGAGCTGG + Intergenic
1012343560 6:98157489-98157511 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1012597215 6:101054490-101054512 CCAGTCCCAATAAGATGAACTGG + Intergenic
1012644487 6:101661815-101661837 CTAGTCCCAATGAGATGAGCTGG + Intronic
1012674673 6:102100554-102100576 CCAGTCCCACTGAGATGAACTGG - Intergenic
1012701057 6:102458402-102458424 CCAGTCCCAATGAGATGAACTGG - Intergenic
1012870793 6:104670881-104670903 CCAGTCCCAATGTGATGAGCTGG - Intergenic
1012922504 6:105234330-105234352 CTGGTCCCAATGAGATGAACAGG + Intergenic
1012933187 6:105338518-105338540 CAAGCCCCAGTGAGATGAACCGG - Intronic
1013024943 6:106262657-106262679 CCGGTCCCAACAAGATGACCTGG - Intronic
1013275703 6:108582880-108582902 GCAGTCCAGGTGAGATGAACAGG - Intronic
1013390146 6:109678756-109678778 CCAGTCCCAGTGAGATGAGCTGG - Intronic
1013452893 6:110302962-110302984 CCAGTCCCAATGAGATGAGCCGG - Intronic
1013920249 6:115394938-115394960 CCAGTCCCAGTGTGATGAACTGG + Intergenic
1013964107 6:115935146-115935168 CCAGTCCCACTGATATGAACTGG - Exonic
1013972818 6:116041549-116041571 ACAGTCCCAATGAGATGATCCGG - Intronic
1014058577 6:117044434-117044456 CCAGTCCCAATGAGATAAGCTGG + Intergenic
1014129186 6:117811324-117811346 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1014223639 6:118823437-118823459 GTAGTCCCAATGCGATGAACTGG + Intronic
1014278750 6:119417766-119417788 CCAGTCCCAATGATATGAACCGG - Intergenic
1014387156 6:120816532-120816554 CCAGTAACAATGAGATGAACTGG + Intergenic
1014466226 6:121760298-121760320 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1014523989 6:122479089-122479111 TCAGTCCCGATGAGATGAGCTGG + Intronic
1014584513 6:123182255-123182277 CCAGTCCCAATGAGATGAACAGG - Intergenic
1014666015 6:124238635-124238657 CCAGTCCCAATGAGATGAGGTGG - Intronic
1014753606 6:125280039-125280061 CCAGTCCCAGTGAGATGAACCGG - Intronic
1014836646 6:126167455-126167477 CCAGTCCCAATGAGACGAAGTGG + Intergenic
1014907067 6:127043347-127043369 CCAGTCTCAGTGAGATGAACTGG - Intergenic
1015108819 6:129568777-129568799 CCAGTCCCAATGAGATGAGTAGG - Intergenic
1015163103 6:130174502-130174524 CCAGTCCCAATGAGATGAAGTGG + Intronic
1015290976 6:131538353-131538375 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1015433315 6:133155435-133155457 CCAATCCCAATGAGATGAACCGG + Intergenic
1015471775 6:133614410-133614432 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1015587261 6:134789182-134789204 TCAGTCCCAATGAGAGAACCTGG - Intergenic
1015623493 6:135156673-135156695 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1015883376 6:137891749-137891771 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1016067505 6:139699269-139699291 CCAGGCCAACTGAGATGAGCTGG - Intergenic
1016111373 6:140229937-140229959 ACAGTCCCAATGAGATGAACCGG - Intergenic
1016592953 6:145766376-145766398 CCATTCCAAATGAGAGAAACTGG - Intergenic
1016691624 6:146943920-146943942 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1016717460 6:147251087-147251109 CCAATCCCAATGAGATGAGCTGG - Intronic
1016847282 6:148581001-148581023 CCAGTAACAATGGGATGATCTGG - Intergenic
1017197515 6:151717198-151717220 CCAGTCCCAATGAGATGAGCTGG + Intronic
1017322532 6:153110736-153110758 GCAGTCGCAATGAGATGAGCTGG - Intronic
1017968802 6:159290878-159290900 CAAATCCCAATGAGATGAAAGGG + Intergenic
1018094610 6:160374348-160374370 CTAGTCCCAGTGAGATGAGCTGG + Intronic
1018114732 6:160572216-160572238 CCAGTCCCAATGAGATGAGCCGG + Intronic
1018329559 6:162712598-162712620 CCAGTCTCCATGATATAAACAGG + Intronic
1018797725 6:167200208-167200230 CCAGCCCCAATGAGATGAACAGG + Intergenic
1018805701 6:167258109-167258131 TAAGTCCCAGTGAGATGAACTGG - Intergenic
1019240706 6:170660394-170660416 CCTGTCCCCATGAGAGGCACTGG + Intergenic
1020333304 7:7041930-7041952 CCAATCCCAATGAGATGAACCGG - Intergenic
1020339082 7:7089618-7089640 CCAGTCTCAGTGAGATGAGCTGG + Intergenic
1020391512 7:7662656-7662678 CCAGTCCCAATGAGATGAGCCGG + Intronic
1020428495 7:8095728-8095750 CCAGTCCCTATGAGATGGACTGG - Intergenic
1020608676 7:10368071-10368093 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1020693914 7:11391937-11391959 CGAGTCCCAATGAAATGAATTGG + Intronic
1020753507 7:12171198-12171220 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1020823940 7:13003307-13003329 CCAGTCCCAGTGAGATAAGCTGG + Intergenic
1020935399 7:14458498-14458520 CCAGTCCAAATGAGAGGAGCTGG - Intronic
1021207764 7:17806756-17806778 CTAGTCCCAGTGAGATGAGCTGG - Intronic
1021224656 7:18013176-18013198 CCAGTTCCAGTGAGATGAACTGG + Intergenic
1021322221 7:19226699-19226721 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1021347760 7:19548586-19548608 GCAGTCCCAATGAGATGAGCCGG + Intergenic
1021483844 7:21146338-21146360 CCAGTCCCAGCGAGATGAACTGG - Intergenic
1021502447 7:21345841-21345863 CCAGTCCCTATGAGATGAACTGG + Intergenic
1021749437 7:23780178-23780200 CTAGTCCCAGTGAGATAAGCCGG + Intronic
1021782361 7:24118456-24118478 CCAGTCCCAATGAGATGAACCGG + Intergenic
1022058940 7:26770796-26770818 CCAGTCCCAATGAGATAAGCTGG + Intronic
1022092629 7:27117521-27117543 CCAGACCCAAGGATCTGAACCGG - Intronic
1022390843 7:29943213-29943235 CCAGTCCCAAGGAGCTGCTCGGG + Intronic
1023511132 7:40954476-40954498 CAAGCCCCAGTGAGATGAACTGG + Intergenic
1023894220 7:44418725-44418747 CTAGTCCCAATGAGATGAACAGG - Intronic
1023909999 7:44547081-44547103 CCAGTCCCAATGAGATGAACTGG - Intergenic
1024372980 7:48607385-48607407 CCAGTCTCAATGAGATGAACCGG + Intronic
1024665004 7:51537119-51537141 CCAGTTCCAATGAGATGAACCGG + Intergenic
1025041599 7:55650878-55650900 TCAGTCCCAATGAGACAACCTGG - Intergenic
1025638016 7:63340454-63340476 CCAGTCCTAATGAGATGAACTGG + Intergenic
1025644680 7:63407645-63407667 CCAGTCCTAATGAGATGAACTGG - Intergenic
1025714306 7:63941062-63941084 CCAGTCCCAATGAGATGAACTGG - Intergenic
1026488081 7:70838141-70838163 CCAGTCCCATTGAGATGAACTGG - Intergenic
1027582773 7:80019925-80019947 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1027790299 7:82633196-82633218 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1027843262 7:83341415-83341437 CCAGTCCTAATGAGATGAGCTGG - Intergenic
1028048472 7:86152769-86152791 CCAGTCCAAATGGGAGGAATTGG - Intergenic
1028326918 7:89539667-89539689 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1028378015 7:90167946-90167968 CCGGTCCCAATGGGATGAACCGG - Intronic
1028430059 7:90736163-90736185 CCAGTCCCAGTGAGATGAACCGG + Intronic
1028523546 7:91758840-91758862 CCAGTCCCAATGAGATGAACTGG - Intronic
1028606628 7:92662778-92662800 CCAGTCCTAATGGCATGACCTGG - Intronic
1028630367 7:92927023-92927045 CCATTCCCAGTGAGACGAACCGG + Intergenic
1028991163 7:97050709-97050731 CCAGTCCCAGTGAGATGAATCGG - Intergenic
1028998457 7:97127141-97127163 CCAGTCCCAGTGAGATGAACAGG + Intronic
1029845345 7:103406522-103406544 CCATGCCCAATGAGGTGAGCCGG + Intronic
1029854777 7:103504557-103504579 CCAGTCCCAATGAGATGAACCGG - Intronic
1030159309 7:106491386-106491408 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1030533939 7:110743587-110743609 CCAGTCCCATTGAGATGAACGGG - Intronic
1030703180 7:112662903-112662925 CCAGTCCCAATGAGATGAACTGG + Intergenic
1030705721 7:112690504-112690526 CCAGTCCCAATGAGATGACCTGG + Intergenic
1030781042 7:113600544-113600566 CCAGTCCCAATGAGATGAACAGG - Intergenic
1030801251 7:113856068-113856090 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1031397833 7:121293848-121293870 CCAGTCCCAGTGAGATGGACCGG + Intronic
1031717389 7:125125561-125125583 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1031903072 7:127430627-127430649 ACAGTCCCAATGAGATGAGCTGG + Intronic
1032296027 7:130639070-130639092 CCAGTCCCAGTGAGAAGAGCCGG + Intronic
1032312679 7:130802866-130802888 CCAGTCCCAATAAGATGACCAGG + Intergenic
1032367619 7:131315219-131315241 CCAGTCCCAATGGAATGAACTGG - Intronic
1032604154 7:133330793-133330815 CCAGTCCCAGTGAGATGAACCGG + Intronic
1032659845 7:133970686-133970708 CCGGTCCCAATGAGATGAGCTGG + Intronic
1032893213 7:136222269-136222291 CCAGTCCCAATGCAATGAACTGG - Intergenic
1033287051 7:140050261-140050283 CCAATCCCAATGAGAACAATGGG + Intronic
1033679955 7:143584188-143584210 CCAGTCCCTATGAGATGAACCGG - Intergenic
1033691879 7:143745255-143745277 CCAGTCCCTATGAGATGAACCGG + Intergenic
1036553679 8:9838466-9838488 CCAGTCCCAGTGAGGTGAACCGG - Intergenic
1036661589 8:10712724-10712746 CCTGTCCCAATGGGGTCAACAGG + Intergenic
1036842082 8:12131749-12131771 CCACTTCCAATGAGTGGAACCGG - Intergenic
1037398283 8:18466986-18467008 CCAGTCCCAGTGAGATGATCCGG - Intergenic
1037664448 8:20956153-20956175 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1039133763 8:34297371-34297393 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1039282883 8:36006213-36006235 TCAGTCCCAGCGAGATGAGCTGG - Intergenic
1040694838 8:49983876-49983898 TCATTCCCAGTGAGATGAATGGG + Intronic
1040708228 8:50154454-50154476 CGTGCCCCAGTGAGATGAACCGG + Intronic
1040779803 8:51094777-51094799 CTAGTCCCAATGAGAGGAATTGG - Intergenic
1040943142 8:52852985-52853007 CCAGTCCCATTGAGATGAACTGG + Intergenic
1040968901 8:53112833-53112855 CCAGTCCCAGTAAGATGAACTGG + Intergenic
1041154962 8:54976684-54976706 GTAGTCCCAATGAGATGAACTGG - Intergenic
1041287211 8:56273340-56273362 CCAGTCCCAATGAGATGAAGAGG - Intergenic
1041323407 8:56637658-56637680 CCAGTCTCAATGAGAAGAGCTGG + Intergenic
1041419171 8:57647324-57647346 CCAGTCCCAACGAGAAAAACTGG + Intergenic
1041584052 8:59495433-59495455 GCAGTCCCAATGAGATGAGCTGG + Intergenic
1041836549 8:62223224-62223246 CTAGTTCCAATGAGATGAGCCGG - Intergenic
1041838423 8:62242577-62242599 CCAGTCCCAATGAGATGAGTCGG + Intergenic
1042073847 8:64967163-64967185 CCATTCCAAATGAGATAAATTGG + Intergenic
1042110830 8:65379735-65379757 CCAGCCCCAATGAGATGAGCTGG - Intergenic
1042195462 8:66228321-66228343 CCAGTTCCAATTAGAAGAATTGG - Intergenic
1042622805 8:70724717-70724739 CCAGTCCCAATGAGATGAACTGG + Intronic
1042773528 8:72404905-72404927 TCAGTCCCAGTGAGATAAACAGG - Intergenic
1042812998 8:72846287-72846309 CCACTCCCAATGAGATGAACTGG + Intronic
1042969396 8:74391521-74391543 CCTTTCCCAATGAGATGACCTGG + Intronic
1043036758 8:75208681-75208703 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1043080829 8:75763131-75763153 CCAGTCCCAGTGAAATTAACTGG - Intergenic
1043253761 8:78106918-78106940 CCAGTCCCAATGAGATGATCTGG + Intergenic
1043309466 8:78840189-78840211 ACAGTACCAATGACATGAAAGGG - Intergenic
1043366410 8:79537781-79537803 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1043647328 8:82536713-82536735 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1044131002 8:88524986-88525008 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1044312464 8:90709381-90709403 CCAGTCCCAGCGAGATGAACTGG + Intronic
1044378127 8:91500153-91500175 CCAGTCCCGATGAGATGAACAGG + Intergenic
1044503469 8:92990552-92990574 CCAGTTCCAATGAGATGAGCCGG - Intronic
1044509569 8:93058805-93058827 CCAGTACCAGTGAGATGAACTGG + Intergenic
1044873544 8:96642827-96642849 TCAGTCCCAATGAGAGAACCTGG + Intergenic
1044940356 8:97335480-97335502 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1044960918 8:97529958-97529980 CCAGTCCCATTGAGATGAGCTGG - Intergenic
1045151884 8:99416759-99416781 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1045212012 8:100108473-100108495 CCAGTCCCAATGAGATGAACTGG - Intronic
1045390490 8:101710074-101710096 CCAGTCCCAATGAGATGAACTGG - Intronic
1045618814 8:103951410-103951432 GCAGTCCCAATGAGATGAACTGG - Intronic
1045783591 8:105896772-105896794 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1045797644 8:106065055-106065077 CCAGTCCCAGTGAGATGAAATGG - Intergenic
1045883292 8:107065523-107065545 CCAGTCCCAATGAGATGAACTGG + Intergenic
1046014539 8:108589855-108589877 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1046048069 8:108986902-108986924 CCAGTCCCATTGAGATGAACCGG + Intergenic
1046068092 8:109219348-109219370 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1046106407 8:109672330-109672352 CCAGCCCCAATGAGATGAGCTGG - Intronic
1046153569 8:110258246-110258268 CCAGTACCAATGAGACGAGCTGG + Intergenic
1046219853 8:111200452-111200474 CCAGTCCCAATGAGATGAACTGG - Intergenic
1046295769 8:112217926-112217948 CCAGTCCCAATGACATGAACTGG - Intergenic
1046947564 8:119988352-119988374 CCAGTCCCAATGAGATGAACCGG + Intronic
1047060655 8:121220980-121221002 CCAGTGCCTATGAGATGTAGTGG + Intergenic
1047121205 8:121907743-121907765 CCAGTCTTAATGAAATGAACAGG - Intergenic
1048282344 8:133114647-133114669 CCAGTCCCAGTGGGAAGAATGGG + Intronic
1049872464 8:144991139-144991161 CCAGTCCCAATGAGATGAACTGG + Intergenic
1049964511 9:766563-766585 CCAGTCCTAATGAGATGGCCAGG - Intergenic
1050234487 9:3563222-3563244 CCAGCCCCAATGGGATGAGCCGG + Intergenic
1050239979 9:3624695-3624717 CCAGCCCCAATGAGATGAACCGG + Intergenic
1050346172 9:4690329-4690351 CCAGTCCCTCTGAGATGAAGTGG + Intronic
1050369125 9:4902425-4902447 TCAGTCCCAATGAGATGAACTGG + Intergenic
1050700248 9:8330217-8330239 CCAGTCCCAATGAGATGAAATGG + Intronic
1050750708 9:8933209-8933231 CCAGTTCCAATGAGATGAGCAGG + Intronic
1050943257 9:11486195-11486217 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1050973997 9:11912770-11912792 CCTGTCCCAATGAGATGAACTGG + Intergenic
1051112177 9:13651457-13651479 CTAGTCCCAGTGAGATGAACTGG + Intergenic
1051199346 9:14599246-14599268 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1051230368 9:14949524-14949546 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1051322034 9:15914987-15915009 CCGGCCCCAGTGAGTTGAACCGG + Intronic
1051353818 9:16223181-16223203 CCAGTCCCAATGAGATGAACCGG - Intronic
1051447550 9:17156072-17156094 CGAGTCCCAATGAGATGAACCGG + Intronic
1051452065 9:17207681-17207703 CCAGTCCCAATGAGATGAACTGG + Intronic
1051571577 9:18564352-18564374 CCAGTCCCAGTGAGATGACCGGG + Intronic
1051603358 9:18896532-18896554 TCAGTCCCAATGAGAGAACCTGG - Intronic
1051695904 9:19767643-19767665 CCAGTCCCAGTGAGGTGAACCGG + Intronic
1051982839 9:23045534-23045556 TCAGTCCCAATGAGATGAACTGG - Intergenic
1051998368 9:23247531-23247553 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1052052808 9:23866939-23866961 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1052061632 9:23966992-23967014 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1052144137 9:25026204-25026226 GCAGTCCCAGTGAGATGAACTGG + Intergenic
1052241276 9:26277203-26277225 CCTGTCCCAGTGAGATAAACCGG - Intergenic
1052326405 9:27220604-27220626 CCAGTCCCTATGAGATGAGCCGG - Intronic
1052329275 9:27251282-27251304 CCAGTCCCAGTGAGGTGAACCGG - Intergenic
1052336489 9:27324950-27324972 CCAGTCCCAGTGAAATGAGCTGG + Intergenic
1052506272 9:29358762-29358784 CCAGTCCCAATTAGATGAACTGG - Intergenic
1052746730 9:32448696-32448718 CCAGTCCCAATGAGATGAACCGG + Intronic
1052752651 9:32508398-32508420 CCAGTCCCAGTGAGGTGAACCGG - Intronic
1053424436 9:38001853-38001875 ACAGCCCAAAGGAGATGAACAGG + Intronic
1053608255 9:39681731-39681753 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1053866095 9:42438091-42438113 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1054245276 9:62660678-62660700 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1054559404 9:66695209-66695231 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1054719979 9:68594495-68594517 CCTGTCCCAATGAGATGAGCCGG + Intergenic
1054986073 9:71262854-71262876 CCAGTCCCAATGAGATGAACCGG + Intronic
1055125813 9:72717101-72717123 CCAGTCCCAATGAAATGAACTGG + Intronic
1055210228 9:73782841-73782863 CCAGTCCCAATGAGATGAACTGG - Intergenic
1055339061 9:75262280-75262302 CCAGTCCCAATGAGATGAACCGG + Intergenic
1055391048 9:75822097-75822119 CTAGTCCCAGTGAGATAAGCCGG + Intergenic
1055537965 9:77268490-77268512 CCAGTCCCACTGAGATGAGCCGG + Intronic
1055628665 9:78200753-78200775 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1055894747 9:81162386-81162408 CCAGTCCCAATGAGATGAACCGG - Intergenic
1056003617 9:82243343-82243365 CGAGTCCCAGTGAGATGAGCCGG + Intergenic
1056123640 9:83513762-83513784 CCAGTTCCAATGAGATGAACTGG - Intronic
1056302721 9:85258491-85258513 GCAGTCCCAATGAGATGAGCTGG + Intergenic
1056320819 9:85433192-85433214 CCAGTTCCAATGAGATGAGCCGG - Intergenic
1056344871 9:85682148-85682170 CCAATCCTAATGAGAGGAAAAGG - Intronic
1056837745 9:89970992-89971014 CCAGGCCCAAAGAGAAGACCAGG + Intergenic
1057460223 9:95254378-95254400 CCAGTCCCAGTGAGATGAGCCGG - Intronic
1057840467 9:98481980-98482002 CCTGTCCCATGGAGAAGAACAGG + Intronic
1058034677 9:100237696-100237718 CCAGTCCCAATGAGATGAACTGG + Intronic
1058093337 9:100829933-100829955 CCAGTCCCAATGAGAAGAACTGG + Intergenic
1058259726 9:102814157-102814179 CAAGTCCCAATGAGATGAACAGG - Intergenic
1058265703 9:102897209-102897231 CCAGTCCCAGTGAGATGAACAGG - Intergenic
1058393086 9:104519962-104519984 CCAGTCCCAATGAGATGAACTGG - Intergenic
1058408379 9:104703268-104703290 CCAGTCACAGTGAGATGAGCTGG - Intergenic
1058492252 9:105515482-105515504 CCAGTCCCAATGAGATGAACCGG - Intronic
1058492850 9:105520476-105520498 CAAGTCTCAAAGAGAGGAACTGG + Intronic
1058683489 9:107460426-107460448 CCAGTCCCACAGAGCTGAGCTGG - Intergenic
1059004307 9:110384363-110384385 TCAGTCCCAATGAGAGAACCTGG + Intronic
1059088753 9:111334098-111334120 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1059513259 9:114869472-114869494 CCAGTCCCAGTGAGATAAACTGG - Intergenic
1059519321 9:114925141-114925163 CCAGTGGCAGTGAGCTGAACAGG + Intronic
1059864722 9:118501532-118501554 CCTGTCCCAATCAGATGAACTGG + Intergenic
1062297519 9:135840668-135840690 TCAGCCCCAATGAAATGAGCTGG - Intronic
1186181411 X:6976542-6976564 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1186332822 X:8554246-8554268 CCAGTCCTAATGAGATGAGCCGG - Intronic
1186354148 X:8772926-8772948 CCAGTCTCAATGAGATTAACTGG - Intergenic
1186370105 X:8937733-8937755 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1186599898 X:11025137-11025159 CCATTCCCAATGAGATGAGCTGG + Intergenic
1186773403 X:12839702-12839724 CCAGTCCCAAAGAGATGAGCTGG + Intergenic
1186832422 X:13404095-13404117 CCAGTCTCAATGAGATGAACTGG - Intergenic
1186961045 X:14736579-14736601 CCAGTCCCAGTGAGATGAGCCGG + Intergenic
1186993744 X:15097202-15097224 TCAGGGCCAATGAGATGGACAGG - Intergenic
1187574844 X:20542962-20542984 CCATTCCAAATGAGAGAAACTGG - Intergenic
1187605089 X:20874363-20874385 TCAGTCCCAATGAGATGAACTGG - Intergenic
1187729170 X:22235173-22235195 CCAGTCCCAATGAGATGAACTGG + Intronic
1187729474 X:22238234-22238256 CCAGTCCCAGTGAGATGAACCGG - Intronic
1187784221 X:22866478-22866500 CAAGTCCCAATGAGATGAGCTGG - Intergenic
1187840504 X:23482223-23482245 TCAGTCCCAATGAGATGAGCCGG + Intergenic
1188130107 X:26420107-26420129 CCAGTACCATTGAGATGAGCTGG + Intergenic
1188193119 X:27196784-27196806 CCAGTCCCAATGAGATAAATCGG - Intergenic
1188561337 X:31471489-31471511 CCAGTCCCAGTGAGATGAGCCGG + Intronic
1188893391 X:35636704-35636726 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1188915548 X:35905207-35905229 CCAGTCCTGATGAAATGAACTGG + Intergenic
1188922019 X:35987949-35987971 CCAGTCCCAATGAGATGAACTGG + Intronic
1188927513 X:36063152-36063174 ACAGTAACAATGAGATGAAAAGG - Intronic
1189243256 X:39541958-39541980 CCAGTCCCAGTGAGATGAGCTGG - Intergenic
1189590558 X:42506825-42506847 GCAGTCCCAATGAGATGAGCTGG - Intergenic
1189713501 X:43840589-43840611 CCAGTCCCAGTGAGATGAACTGG - Intronic
1189754042 X:44252931-44252953 GCAGTCCCAATGAGATGAGCCGG - Intronic
1189937663 X:46086920-46086942 CCAGTCTCAATGAGATGAGCAGG - Intergenic
1190341556 X:49300352-49300374 TGAGTCCCAGTGAGATGAGCCGG + Intronic
1190495176 X:51021406-51021428 CCAGTCCCAATGAGATGAACAGG + Intergenic
1190944057 X:55073397-55073419 CCAGTCCCAATAAGATGAACTGG + Intergenic
1190959863 X:55235167-55235189 CCAGTCCCAATGAGATGAGCTGG + Intronic
1190963818 X:55278441-55278463 CCGGTCTCAATGAGATGAACTGG + Intronic
1190966508 X:55306039-55306061 CCAGGCCCAGTGAGATCAACTGG + Intergenic
1191072106 X:56411366-56411388 CCAGTCCCAATGAAATGAGCTGG + Intergenic
1191094439 X:56659473-56659495 CCAGTCCCAATGAGATGAACTGG + Intergenic
1191097515 X:56688941-56688963 CCAGTCCCATTGATATGAACTGG + Intergenic
1191115323 X:56846536-56846558 CCAGTCCCACTGAGATGAACTGG - Intergenic
1191133370 X:57038348-57038370 CCATTCCCAATCAGATGAGCTGG + Intergenic
1191135496 X:57059291-57059313 CCAGACCCAATTACATGAGCCGG + Intergenic
1191155683 X:57270632-57270654 CCAGTCCCATTGAGATGAACCGG - Intergenic
1191172065 X:57458633-57458655 CCAGTCCCAGCGAGATGATTAGG - Intronic
1191174254 X:57482581-57482603 CCAGTCCCTACGAGATGAACTGG + Intronic
1191185662 X:57608110-57608132 TCAGTCCCAATGAGAGGATCTGG + Intergenic
1191206637 X:57841878-57841900 GCAGTCCCAATTATTTGAACCGG - Intergenic
1191591242 X:62887911-62887933 CCAGTCCGCATGAGATGAACAGG - Intergenic
1191606154 X:63065429-63065451 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1191650875 X:63536808-63536830 TCAGTCCCAATGAGATGAACTGG - Intergenic
1191686645 X:63899236-63899258 CCAGTCCCAATGAGATGAACTGG - Intergenic
1191705030 X:64085499-64085521 CCAGTCCCAAAGAGATGAACTGG - Intergenic
1191766813 X:64706391-64706413 CCGGTGTCAATGAGATGAACTGG + Intergenic
1191788859 X:64946438-64946460 CCAGTCCCAACGAGAGGAACCGG + Intronic
1191802622 X:65098546-65098568 CCAGTCCCAATGAGATGAACAGG - Intergenic
1191873027 X:65765720-65765742 CCATTCCCTATGAGAGGAGCTGG + Intergenic
1191909035 X:66127557-66127579 CCAGTCCCAATGAGATGAACTGG + Intergenic
1191928781 X:66344991-66345013 CCAGTCCCAATGAGATGAACTGG + Intergenic
1191941745 X:66488995-66489017 CCAGTCTCAATGAGATGAACTGG - Intergenic
1191947659 X:66553589-66553611 CCAGTCCCAATGAGATGATCTGG - Intergenic
1191962399 X:66718401-66718423 CCAGTTCCAATGTTATGAGCTGG - Intergenic
1191987318 X:66995481-66995503 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1192023949 X:67427710-67427732 CCAGTCCCAATGAGATGAATTGG + Intergenic
1192030619 X:67509004-67509026 CTAGTCCCAATGAGATGAACAGG - Intergenic
1192129076 X:68530807-68530829 CCAGTCCCAATGAGATGAACTGG + Intronic
1192287736 X:69756063-69756085 CAAGCCCCAGTGAGATGAAGCGG + Intronic
1192524457 X:71829764-71829786 CCAGTCCCAATGAGATGAGTCGG - Intergenic
1192637250 X:72831292-72831314 CCAGTACCAACGAGATGAACTGG + Intronic
1192644464 X:72889522-72889544 CCAGTACCAACGAGATGAACTGG - Intronic
1192674495 X:73182184-73182206 CCAGTGTCAATGAGATGAGCTGG - Intergenic
1192701847 X:73482512-73482534 CCAGCCCCAGTAAGATGAACTGG + Intergenic
1192712935 X:73610409-73610431 CCATTCCTAACAAGATGAACTGG + Intronic
1192755903 X:74046857-74046879 CCAATTCCGATGAGATGAGCTGG + Intergenic
1192759285 X:74078392-74078414 CCTGTCCCAATAAAATGAACAGG + Intergenic
1192766021 X:74140436-74140458 CCAGTCCCAGTGCGATGAACAGG - Intergenic
1192878495 X:75257887-75257909 CCAGTCCCAGTGAGAGGGACCGG - Intergenic
1192884357 X:75320871-75320893 ACAGTCCCAATGAGATGAAGTGG + Intergenic
1192916135 X:75652787-75652809 CCAGTCCCAGTTGGATGAACTGG + Intergenic
1192934041 X:75839590-75839612 CCAGTCCCAATGAGACGAACTGG + Intergenic
1192953259 X:76039942-76039964 CGAGTCCCAGTGAGATGAACTGG + Intergenic
1192958266 X:76096186-76096208 TCAGTCCCAAAGAGATGAGCTGG + Intergenic
1192964070 X:76159123-76159145 CCAGTCCCAGTGAGATGAACTGG - Intergenic
1192966642 X:76183612-76183634 CCAGTCCCAATGAGATGAGCTGG + Intergenic
1192971216 X:76233450-76233472 CCAGTCCCAGTGAAATGAACTGG - Intergenic
1192993936 X:76492455-76492477 CCAGTCCCAATGAGATGAATTGG - Intergenic
1192998111 X:76533738-76533760 CCAGTTCCAATGAGATGAACTGG + Intergenic
1193003738 X:76591771-76591793 CCAGTCCCAGTGAAATGAACAGG + Intergenic
1193040550 X:76999312-76999334 CCAGTTCCAATGAGATGAACCGG + Intergenic
1193071802 X:77314490-77314512 CCAGTCCCAGTGAGATGAAAAGG - Intergenic
1193073746 X:77333398-77333420 ACAGTCCCAATGTGATAACCTGG + Intergenic
1193079253 X:77390004-77390026 CCAATCCCAATGAGCTGAGCTGG - Intergenic
1193113857 X:77756677-77756699 CCAGTCCCAATGAGATGAACTGG + Intronic
1193190462 X:78564087-78564109 TCAGTCCCAATGAGATGAACTGG + Intergenic
1193334555 X:80273527-80273549 CCAGTCCCACTGAGATGAGCTGG - Intergenic
1193341396 X:80353016-80353038 CCAGTCCCAATGAGATGAACAGG + Intronic
1193350760 X:80462281-80462303 CCAGTCCCAGTGAGACGAGCCGG - Intergenic
1193352119 X:80475487-80475509 CCTGTCCCAGTGAGATGAGCCGG + Intergenic
1193382263 X:80828518-80828540 CCAGTCCCAATGAGATGAAATGG + Intergenic
1193398193 X:81010573-81010595 CCAGTCCCAATGAGATGAACAGG + Intergenic
1193398482 X:81013984-81014006 CCAGTCCCAATGAGATGAACTGG - Intergenic
1193404387 X:81083735-81083757 CCAGTCCCAATTAGATGAAGTGG - Intergenic
1193409272 X:81143470-81143492 CCAGTCCCAATGAGATGAACTGG - Intronic
1193501028 X:82275367-82275389 CCATTCCAAATGAGACAAACTGG + Intergenic
1193514301 X:82445397-82445419 CCAGTCCCAATGAGATGAACTGG - Intergenic
1193548060 X:82853128-82853150 CCAGTCCCAGTGAGATTAGCTGG + Intergenic
1193562571 X:83037590-83037612 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1193571585 X:83151490-83151512 CCAGTCCCAATGAGATAAACTGG - Intergenic
1193645616 X:84065917-84065939 CCAGTCCCAGTGAGACGAACTGG - Intronic
1193700031 X:84748922-84748944 CCAGCCCCAATGAGATGAGCTGG + Intergenic
1193774117 X:85622249-85622271 CCAGTCCCAATGAGATGAAGTGG - Intergenic
1193895473 X:87110050-87110072 TCAGTCCCAATGAGAGAACCTGG - Intergenic
1193897170 X:87128415-87128437 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1193906837 X:87254252-87254274 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1193949245 X:87778211-87778233 CCAGTTTCAATAAGATGAGCTGG - Intergenic
1194315382 X:92369839-92369861 CCAGTTCCAATGAGATGAACTGG + Intronic
1194631528 X:96291502-96291524 CTAGTCCCAATGAAATGAACAGG - Intergenic
1194643499 X:96429928-96429950 CCAGTCTCAGTGAGATGAACCGG + Intergenic
1194652517 X:96533069-96533091 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1194771704 X:97915057-97915079 CCAGACCCAATGAGATGATCCGG - Intergenic
1194953621 X:100154229-100154251 TCAGTCCCAATGGGAATAACTGG + Intergenic
1194954511 X:100162902-100162924 CCAGTCTGAATGAGATGAGCTGG + Intergenic
1194959157 X:100215126-100215148 CCAGTCTCAATGAGATGAGCTGG + Intergenic
1194961142 X:100236821-100236843 CCACTCCCAATGAGATGAGCCGG + Intergenic
1194963911 X:100266627-100266649 CCAGTCCCAATGACATGAGTTGG - Intergenic
1195102201 X:101566653-101566675 CCAGTCCCAGTGAGATGAACCGG - Intergenic
1195127529 X:101822853-101822875 CAAGTCCCAATGAGATGAACTGG + Intergenic
1195140010 X:101949970-101949992 CCAGTCCCAATGAGATGAACAGG - Intergenic
1195351283 X:103998757-103998779 CCAGTCCCAATGATATGAACAGG + Intergenic
1195414133 X:104602132-104602154 CCAGTCCCAATGAGATGAATGGG - Intronic
1195434781 X:104829471-104829493 CCAGTCCCAATGAAATGAACTGG + Intronic
1195436003 X:104843734-104843756 CCAGTCCCATTGAGATGAACTGG + Intronic
1195468954 X:105211778-105211800 CCAGTCCTGTTGAGATGAATTGG - Intronic
1195580388 X:106494193-106494215 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1195774886 X:108391851-108391873 CCAGTCCCAATGAGATGAACCGG + Intronic
1195810720 X:108825550-108825572 CCAGTCCCAATGAAATGAACTGG + Intergenic
1195820963 X:108944706-108944728 CCAGTCCCAATGAGATAAACTGG + Intergenic
1195842659 X:109191807-109191829 CCAGTCCCAATGAGATGAACTGG - Intergenic
1195844368 X:109209918-109209940 CCAGTCCCAATGAGACAAACAGG + Intergenic
1196133304 X:112180979-112181001 CCAGTCCCAATGAGATGAGCCGG - Intergenic
1196229388 X:113203275-113203297 TCAGTCCCAATGAGAGAACCTGG + Intergenic
1196273256 X:113736363-113736385 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1196281274 X:113825857-113825879 CCAGTCCCAGTGAGATGAGTCGG + Intergenic
1196308162 X:114128145-114128167 CCAGTTCCAATGAGATTAACCGG + Intergenic
1196476531 X:116092515-116092537 CCATTGCCAATGCGATGAACTGG + Intergenic
1196545827 X:116962931-116962953 CCAGTCCCAGTGAGATGAACTGG + Intergenic
1196587115 X:117443246-117443268 CCAGTCCCAATGAGATGAACAGG - Intergenic
1196603060 X:117623434-117623456 GCGGTCCCAATGAGATGAATCGG + Intergenic
1196960305 X:120993394-120993416 CCAGTCCCAATGAGATGAGCCGG + Intergenic
1197184654 X:123573310-123573332 CCAGTCCCTGTGAGATGAACTGG - Intergenic
1197191001 X:123648106-123648128 CCAGTCCCACTGAGATGAGCCGG - Intronic
1197319020 X:125005681-125005703 CAAGTCGCAATGAGATAAACTGG - Intergenic
1197350226 X:125373078-125373100 CCAGTCCCAATGAGATGAACCGG + Intergenic
1197395686 X:125923671-125923693 CCAATTCCACTGAGATGAACCGG + Intergenic
1197403660 X:126025385-126025407 TCAGTCCCAGTGAAATGAGCTGG - Intergenic
1197505905 X:127305617-127305639 CCTGTCCCAGTGAGATGAACTGG - Intergenic
1197614411 X:128675397-128675419 CCAGTCCCAGTGAGATGAACCGG + Intergenic
1198002367 X:132452010-132452032 CCAGTCCCAGTGAGATGAGCTGG + Intronic
1198060657 X:133042536-133042558 CCAGTCCCTGTGAGATGAACTGG + Intronic
1198062510 X:133061600-133061622 CCAGTCCCAGTGAGATTAACAGG - Intronic
1198072004 X:133158857-133158879 CCAGTCCCAATGAGATGAACCGG - Intergenic
1198295490 X:135282829-135282851 CCAGTCCCAATGAGATGAGCTGG + Intronic
1198511182 X:137353356-137353378 CCAGGCCCATTGAGATGGCCTGG - Intergenic
1198518899 X:137433181-137433203 CCAGTCCCAATAAGATGCGCTGG - Intergenic
1198555719 X:137791832-137791854 CCAGTCCCAATGAGATGAGCTGG - Intergenic
1198645587 X:138802434-138802456 CCAGTCCCAATGAGATGAACTGG + Intronic
1198678654 X:139157906-139157928 CCAGTCCCATTGAGATGAGCTGG - Intronic
1198680641 X:139178053-139178075 CCAGGCCCAATGAGATGAGCTGG + Intronic
1198753447 X:139958705-139958727 GTAGTTCCAGTGAGATGAACTGG - Intronic
1198753452 X:139958738-139958760 GCAGTCCCAATGAGATGAACTGG - Intronic
1198784569 X:140273225-140273247 CCAGTCCCAATGAGATTAACTGG + Intergenic
1199004214 X:142675711-142675733 TCAGTCCCAGTGAGATGAACTGG + Intergenic
1199012265 X:142771120-142771142 CCAGTCCCAGAGAGATGCACTGG + Intergenic
1199068020 X:143443011-143443033 CCAGTCCCAATGCGATGAACGGG + Intergenic
1199308326 X:146293138-146293160 TCAGTCCCAATGAGAGAACCTGG + Intergenic
1199401528 X:147405080-147405102 CCAGCCCCAATGAGATGAACTGG - Intergenic
1199436522 X:147819169-147819191 CCAGTCCCAGTGAGATGAGCCGG - Intergenic
1199452294 X:147990329-147990351 CCAGTCCCAATGAGATGAACAGG + Intronic
1199469906 X:148182389-148182411 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1199477459 X:148260756-148260778 CCAGTCCCAGTGAGATGAGCTGG + Intergenic
1199524985 X:148782026-148782048 CCAGTCCCAATGAGATGAACTGG + Intronic
1199830602 X:151545869-151545891 CCAGTCCCAATCAGATGAACTGG - Intergenic
1199908673 X:152261488-152261510 CCATTCCAAATGAGAGAAACTGG + Intronic
1200333128 X:155319357-155319379 CCAGTCCCAATGAGATGAGCTGG - Intronic
1200388592 X:155918649-155918671 CCAGTCCCAATGAGATGAGCCGG + Intronic
1200471964 Y:3595645-3595667 CCAGGCCCAGTGAGATAAACTGG + Intergenic
1200623432 Y:5481374-5481396 CCAGTTCCAATGAGATGAACTGG + Intronic
1200740354 Y:6847142-6847164 CTAGTCCCAGTGAGGTGAACTGG + Intergenic
1201312734 Y:12611815-12611837 CTAGTCCCAGTGAGATGAACTGG - Intergenic
1201359183 Y:13127588-13127610 CCAGTCCCAGTGAGATGAACAGG + Intergenic
1201371565 Y:13269888-13269910 CCAGTCCCAGTGAGATGAGGAGG + Intronic
1201376652 Y:13330328-13330350 CCAGTCCCAGTGAGATAAACTGG - Intronic
1201390725 Y:13494404-13494426 TCAGTCAAAATGAGATGAACAGG - Intergenic
1201543133 Y:15131486-15131508 CCAGTCTCAGTGAGATGGACCGG - Intergenic
1201563667 Y:15344207-15344229 CTAGTCCCAGTGAGACGAGCTGG + Intergenic
1201608639 Y:15815932-15815954 CCAGTCCCAATGAGATGAACAGG - Intergenic
1201611798 Y:15851478-15851500 CAAGTTCCAATGAGATAAACCGG - Intergenic
1201651536 Y:16294405-16294427 CTAGTCCAAATGAGATGAGCTGG - Intergenic
1201690077 Y:16753364-16753386 CCAGTCCCAATGAGACGAGCTGG + Intergenic
1201782472 Y:17738576-17738598 CCACGTCCAGTGAGATGAACTGG + Intergenic
1201819081 Y:18167412-18167434 CCACGTCCAGTGAGATGAACTGG - Intergenic
1201853993 Y:18520817-18520839 CCAGTCCCAACGAGATGAACTGG - Intergenic
1201879328 Y:18799567-18799589 CCAGTCCCAACGAGATGAACTGG + Intronic
1201961995 Y:19690736-19690758 CCAGTGCCAGTGAGATGAGCTGG + Intergenic
1201987510 Y:19985729-19985751 CCAGTCCCAATGAGTTAAACTGG + Intergenic
1202040172 Y:20674618-20674640 TCAGTCCCAATGAGATGAACTGG - Intergenic
1202096363 Y:21251644-21251666 ACATTCCCAATGAGATTAACTGG + Intergenic
1202342327 Y:23882614-23882636 CCAGTCCCAATGAGATGAACTGG + Intergenic
1202528442 Y:25787471-25787493 CCAGTCCCAATGAGATGAACTGG - Intergenic