ID: 1106336679

View in Genome Browser
Species Human (GRCh38)
Location 13:28789509-28789531
Sequence CAGTCCCAATGAGATGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3518
Summary {0: 120, 1: 697, 2: 1037, 3: 772, 4: 892}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106336673_1106336679 5 Left 1106336673 13:28789481-28789503 CCTCTGTGGGCTGCACCCACTGC 0: 16
1: 390
2: 652
3: 965
4: 894
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336674_1106336679 -10 Left 1106336674 13:28789496-28789518 CCCACTGCCTAACCAGTCCCAAT 0: 52
1: 401
2: 947
3: 1026
4: 838
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336668_1106336679 21 Left 1106336668 13:28789465-28789487 CCCTGCTTCTGCTTGCCCTCTGT 0: 39
1: 124
2: 357
3: 680
4: 1396
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336669_1106336679 20 Left 1106336669 13:28789466-28789488 CCTGCTTCTGCTTGCCCTCTGTG 0: 39
1: 114
2: 362
3: 691
4: 1471
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336667_1106336679 24 Left 1106336667 13:28789462-28789484 CCACCCTGCTTCTGCTTGCCCTC 0: 67
1: 274
2: 555
3: 796
4: 1307
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336665_1106336679 26 Left 1106336665 13:28789460-28789482 CCCCACCCTGCTTCTGCTTGCCC 0: 63
1: 240
2: 550
3: 1053
4: 2832
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336672_1106336679 6 Left 1106336672 13:28789480-28789502 CCCTCTGTGGGCTGCACCCACTG 0: 360
1: 628
2: 956
3: 647
4: 577
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892
1106336666_1106336679 25 Left 1106336666 13:28789461-28789483 CCCACCCTGCTTCTGCTTGCCCT 0: 75
1: 252
2: 589
3: 812
4: 1291
Right 1106336679 13:28789509-28789531 CAGTCCCAATGAGATGAACTGGG 0: 120
1: 697
2: 1037
3: 772
4: 892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106336679 Original CRISPR CAGTCCCAATGAGATGAACT GGG Intergenic
Too many off-targets to display for this crispr