ID: 1106340826

View in Genome Browser
Species Human (GRCh38)
Location 13:28824987-28825009
Sequence CCACCTGACCAGAGTGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106340820_1106340826 29 Left 1106340820 13:28824935-28824957 CCTCACTGAAAGGAGATGTTGAG 0: 1
1: 0
2: 1
3: 23
4: 221
Right 1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1106340823_1106340826 1 Left 1106340823 13:28824963-28824985 CCCTAAAGGAGATGGAAGAGTGA 0: 1
1: 0
2: 3
3: 30
4: 289
Right 1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178
1106340824_1106340826 0 Left 1106340824 13:28824964-28824986 CCTAAAGGAGATGGAAGAGTGAG 0: 1
1: 0
2: 5
3: 51
4: 394
Right 1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106340826 Original CRISPR CCACCTGACCAGAGTGCAGC TGG Intronic
900080920 1:856779-856801 CCACCTGACCTGAGAGTGGCGGG - Intergenic
900162077 1:1228592-1228614 CCACCTGAACGGGGTGAAGCTGG - Exonic
900915205 1:5632677-5632699 CCGCCTGGCCACAGGGCAGCAGG - Intergenic
901438741 1:9264812-9264834 CCAGCTGGCCGGAGTGCGGCAGG - Exonic
901464690 1:9413634-9413656 CCACCTGAGCAGGGTGAGGCCGG + Intergenic
901489603 1:9589796-9589818 CCACCTTTCCAGAGGGCAGGGGG + Intronic
902781220 1:18706133-18706155 CCACCTGCCCAGAGTGAGGAGGG - Intronic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
904867500 1:33592383-33592405 ACACCTGAGCTGACTGCAGCAGG - Intronic
906279836 1:44545631-44545653 AGACCTGACCAGAGTGTAGAGGG + Intronic
906821205 1:48932073-48932095 CCACCTGAGCAGTATGCAGTGGG + Intronic
907240731 1:53079539-53079561 CCACCTCACCAGTCTGCAGAGGG + Intronic
907418619 1:54331642-54331664 CCAGCTGACCAGCGTGTTGCAGG - Intronic
907689172 1:56645308-56645330 CCGCCTACCCACAGTGCAGCGGG - Exonic
915496682 1:156286738-156286760 CTACCTGACCAGATTGCCACAGG - Intronic
916056044 1:161069528-161069550 CCTCCTGGCCTGAGTGCTGCAGG + Exonic
917610011 1:176679611-176679633 CCACTTGACCCAAGGGCAGCTGG + Intronic
918046454 1:180944491-180944513 CCAGGGGACCACAGTGCAGCTGG + Exonic
920920998 1:210297100-210297122 ACATCTGACAAGAGTGCAGAGGG - Intergenic
922155422 1:223037084-223037106 CCAACAGACCAGGGAGCAGCTGG + Intergenic
922894247 1:229088256-229088278 CCACCTGACTACTGTGCAGGCGG + Intergenic
924589274 1:245387779-245387801 ACACCTGCCCAAAGTGTAGCTGG + Intronic
1062773593 10:125692-125714 CCAATTGACCACAGTTCAGCAGG - Intergenic
1064005840 10:11698303-11698325 CCAACTGAGCAGAGGGTAGCAGG - Intergenic
1064987510 10:21225870-21225892 CCAGCTGACCACAGTGGGGCAGG - Intergenic
1065857099 10:29839510-29839532 CCACCTGGACAGAGGGCAACTGG + Intergenic
1067054455 10:43042829-43042851 GCACCTGTCCAGTGTGAAGCAGG - Intergenic
1067116143 10:43436948-43436970 CCAGCGGACAAGAGGGCAGCTGG + Intronic
1067787675 10:49262558-49262580 CCACATGACCAGACCCCAGCAGG + Intergenic
1068266570 10:54657164-54657186 ACTCCTGGCCATAGTGCAGCTGG - Intronic
1069356003 10:67585546-67585568 CCACCTGCCAAGATTGAAGCAGG - Intronic
1069717465 10:70530159-70530181 CCACCTCTCCAGCATGCAGCAGG - Intronic
1070689840 10:78516412-78516434 CCTCCTGCCCTGTGTGCAGCTGG + Intergenic
1074974687 10:118570508-118570530 CCAGCTGACTAGTGTTCAGCAGG + Intergenic
1075423885 10:122327005-122327027 CCACTGGACCAGAGAGGAGCAGG + Intronic
1076079485 10:127565833-127565855 CCATGTGACCAAGGTGCAGCTGG + Intergenic
1076934200 10:133556571-133556593 CCCCCTGACCACTGAGCAGCAGG + Intronic
1079076143 11:17386579-17386601 CCACCGGCCCAGAGTGTGGCTGG + Exonic
1081905180 11:46664716-46664738 CCACATGCCCACAGTGCAGGGGG - Intronic
1083627544 11:64079267-64079289 CCACCTGTGCTGTGTGCAGCTGG + Intronic
1083908747 11:65692665-65692687 CCACCTGACCTCAGTTCATCTGG - Intergenic
1089146378 11:116332299-116332321 CCACCAGACAGGAGGGCAGCAGG + Intergenic
1090245255 11:125211673-125211695 CCAGCTGCCCAGGGTGGAGCCGG + Intronic
1090909668 11:131107516-131107538 CCACATGACCAGGTTCCAGCTGG - Intergenic
1091340312 11:134806930-134806952 CCACCTTCCCAGAGAGCAGCTGG - Intergenic
1095372063 12:41480167-41480189 CCACCTGTTGAGAGAGCAGCTGG + Intronic
1096462267 12:51828628-51828650 CCACAGGACCCGAGGGCAGCAGG - Intergenic
1096599317 12:52718231-52718253 CCACATGACCAAAGTGGAGCTGG - Intergenic
1097745880 12:63302656-63302678 CCACATGACCTTAGTGGAGCGGG - Intergenic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1106145260 13:27044418-27044440 CTGTCTGACCAGGGTGCAGCAGG - Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1106862227 13:33922020-33922042 ACACCTGCCCAGAGGGCTGCTGG + Intronic
1108786276 13:53905745-53905767 CCACTTGACCCAAGGGCAGCTGG - Intergenic
1113870530 13:113556924-113556946 CCACCTGGGGAGAGAGCAGCTGG + Intergenic
1114531354 14:23398576-23398598 TCACCTCACCACAGTCCAGCTGG - Intronic
1118842069 14:69520929-69520951 CCACATGGCCACAGTGCACCTGG - Intronic
1119494902 14:75069912-75069934 CCACCTGACCTGACCGCGGCCGG - Intronic
1122346987 14:101066912-101066934 CCCCCAGAACAGAGTGGAGCTGG - Intergenic
1124048946 15:26177221-26177243 CGTCATGGCCAGAGTGCAGCCGG + Intergenic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1126450140 15:48798472-48798494 TCACCTGGCCAGAGTGCATCTGG - Intronic
1126694595 15:51315226-51315248 CCTTCTGACCGGACTGCAGCAGG - Intronic
1128558785 15:68650911-68650933 TCATCTGACCAGAGGGCAGCAGG - Intronic
1129415061 15:75371833-75371855 CCACCTGACCTGTGTGTGGCTGG - Exonic
1129422137 15:75437211-75437233 CCACCAGGCTGGAGTGCAGCAGG + Intronic
1132950749 16:2560905-2560927 CCACCTGCCCGGGATGCAGCAGG - Intronic
1132963601 16:2639265-2639287 CCACCTGCCCGGGATGCAGCAGG + Intergenic
1139003581 16:62543763-62543785 CCAGATGACCAGAGTGAGGCTGG - Intergenic
1139962283 16:70724909-70724931 CCACCTACCCAGAATGCAGATGG - Intronic
1141026883 16:80557018-80557040 GCACCTGCCCAGAGTCCAGGTGG - Intergenic
1141749295 16:85947546-85947568 CCACCTCACCAGGTTGCAGAGGG - Intergenic
1141879456 16:86848100-86848122 TCTTCTCACCAGAGTGCAGCTGG + Intergenic
1142806079 17:2372001-2372023 CCACCTGGACAGAGTGCTGTGGG - Intronic
1143891662 17:10106985-10107007 CCACCTTACCACAGTCCAGTGGG - Intronic
1143891855 17:10108050-10108072 CCACCTTACCATAGTCCAGAGGG + Intronic
1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG + Intergenic
1148821384 17:50361727-50361749 CCACCAGGCCAGGCTGCAGCAGG + Intronic
1149954927 17:61038036-61038058 CTACCTAACCAGAGTCCAGCTGG - Exonic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151328402 17:73392707-73392729 GAACCGGACCAGAGTGCAGAAGG - Intronic
1151362448 17:73596733-73596755 CCACAAGATCAGAGTGGAGCTGG - Intronic
1152196919 17:78923875-78923897 TCACCTGCCCAGAGTGGAGGTGG - Intronic
1152876937 17:82791849-82791871 CCACCTGGCCTGGGAGCAGCAGG - Intronic
1155234134 18:23802691-23802713 CCACCAGAGCAGAAGGCAGCTGG + Intronic
1155926166 18:31657893-31657915 CCACATGATTTGAGTGCAGCAGG - Intronic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1160168409 18:76532512-76532534 CCACCTGCCCAGAATCCACCTGG - Intergenic
1160185655 18:76674590-76674612 CCACCTGACCAGGGTGTAAACGG + Intergenic
1161496047 19:4586408-4586430 CCACCTCCCCAGTATGCAGCAGG + Intergenic
1161606899 19:5220097-5220119 CCAGCTGACGCGAGTGCCGCAGG + Exonic
1162915197 19:13870952-13870974 TCACCTGACCCCAGTGCAGCTGG - Intronic
1165106060 19:33470237-33470259 CCACCTGCCCTGATAGCAGCTGG + Intronic
1167286847 19:48603303-48603325 CCACCTGCCCAAAATGCAGCAGG + Intronic
1167456699 19:49599935-49599957 CCACCTGCCCAGAGCTCACCGGG - Exonic
927178679 2:20428322-20428344 CCACCAAATCAGAGTGCAGCAGG + Intergenic
927213628 2:20653493-20653515 CCACCTGTCAAGAATGCAACTGG + Intergenic
927437989 2:23086915-23086937 CCAGCTGACCAGATTCAAGCAGG - Intergenic
928682004 2:33712463-33712485 CAACCAGTCCAGACTGCAGCAGG - Intergenic
931791971 2:65671808-65671830 CCACCTGAACAGAGGTCACCAGG + Intergenic
931984047 2:67724422-67724444 CCACCTGCCCAAAGCGCAGAAGG + Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
934751496 2:96797019-96797041 CCACCTGGCCATCGTGCAGAAGG + Exonic
934755969 2:96825065-96825087 CCACCTGGCCATCGTGCAGAAGG + Exonic
934940693 2:98499894-98499916 CTAACTGACCAGCCTGCAGCTGG + Intronic
935328788 2:101961419-101961441 CCCACTAACCAGAGTCCAGCTGG - Intergenic
935732024 2:106072421-106072443 CCACCTGATCTGATTACAGCAGG - Intronic
936018150 2:108975093-108975115 CCACCTGGGGCGAGTGCAGCAGG + Intronic
939247421 2:139644401-139644423 CCTCCTGACCAAAGTGCATAGGG - Intergenic
940241545 2:151568336-151568358 CCTCCTGGGCAGTGTGCAGCAGG + Exonic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
944490561 2:200254144-200254166 CCATATGACAAGAGTGGAGCAGG - Intergenic
947141616 2:227024145-227024167 CCACCTCATCAGACTGCATCAGG + Intronic
948703856 2:239777572-239777594 CCACCTCTCCCGAGTGCAGGCGG - Intronic
1170745965 20:19099168-19099190 CCACCTGCCCCGAAGGCAGCAGG - Intergenic
1171180019 20:23085169-23085191 CCAGCTGACTCGAGTCCAGCTGG + Exonic
1172278687 20:33695254-33695276 CCACCTGACCACATAGCAGCGGG - Intergenic
1175367919 20:58467987-58468009 CCAGGTGCCCAGAGTCCAGCGGG - Intronic
1178918576 21:36723449-36723471 CCTCCTGGGCACAGTGCAGCTGG + Intronic
1179879859 21:44288922-44288944 CCATCTGACCAGGGCACAGCAGG + Intronic
1179925264 21:44530720-44530742 CCAGCTGGCCTGAGAGCAGCAGG + Intronic
1180920933 22:19521273-19521295 TCACCAGACTAGAGTGCAGTTGG + Intergenic
1181170083 22:21003114-21003136 AGACCTGGCCAAAGTGCAGCGGG - Intergenic
1182519229 22:30876067-30876089 CCAGCTGACCACAGCCCAGCGGG + Intronic
1184759189 22:46535355-46535377 CCACCAGGCGATAGTGCAGCCGG + Exonic
1185113697 22:48919303-48919325 CCTCCTGACGAGGGTGCAGCGGG + Intergenic
950014713 3:9747492-9747514 CCTCCTGCCCTAAGTGCAGCTGG + Exonic
950712199 3:14820517-14820539 CCACCTTCCCAGAGTGGGGCCGG - Exonic
955046142 3:55361887-55361909 CTAGCTGAGCAGATTGCAGCTGG + Intergenic
957777728 3:84775550-84775572 CCCCCAGGCTAGAGTGCAGCGGG - Intergenic
961265543 3:125639037-125639059 CTCCCAGGCCAGAGTGCAGCGGG - Intergenic
961447803 3:126989067-126989089 CTACCTGTCCAGCGTGCAGGAGG + Exonic
962257468 3:133882374-133882396 CCTCCTCCCCAGAGTGCAGATGG - Intronic
965420257 3:168449061-168449083 TGACCTGACCAGAATGCAGATGG - Intergenic
968006690 3:195247826-195247848 ACATCTCACCATAGTGCAGCAGG + Intronic
968438972 4:612040-612062 CCACCTCATCAGAGTGAGGCAGG - Intergenic
968926457 4:3551050-3551072 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
969112277 4:4851540-4851562 CTACCGGGCCAGAGTGCTGCAGG + Intergenic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
976173666 4:82330719-82330741 CAACCAAACCAGACTGCAGCAGG + Intergenic
977230408 4:94445580-94445602 CCACCAGACTGGAGTGCAGTGGG - Intergenic
985768446 5:1794427-1794449 CCACCAGCCCAGCCTGCAGCGGG - Intergenic
985909704 5:2869292-2869314 CCACCAGACCACAGTGCAGCAGG + Intergenic
986284895 5:6351840-6351862 CCACCAGACCAGAGTTCACTGGG + Intergenic
990201028 5:53374800-53374822 CCACCTCACCAGAGTCCTCCTGG + Intergenic
991640671 5:68748598-68748620 CCAACTAACCACTGTGCAGCTGG - Intergenic
995632510 5:114149369-114149391 CCAGCAGCCCACAGTGCAGCGGG + Intergenic
997697911 5:135875808-135875830 TGCCCTGACCAGATTGCAGCTGG + Intronic
1000479299 5:161751685-161751707 CCACCTGTCCATACTGCAGGAGG - Intergenic
1001392174 5:171388082-171388104 CCACCAGACCCGGTTGCAGCCGG - Intronic
1003154984 6:3585707-3585729 TCCCCTGACCAGAGTGCTGATGG + Intergenic
1006558583 6:34889581-34889603 CCACCTGAGCAGACTGGAGAGGG - Exonic
1007597913 6:43062937-43062959 CCACCTGAGCACAGTGGAGTCGG + Exonic
1007607050 6:43124712-43124734 CCATCTGCCCAGCTTGCAGCGGG - Intronic
1008481729 6:51993125-51993147 ACATCTGACCAGGGTGCAGAAGG + Intronic
1013382069 6:109583608-109583630 TCACCTGCCCAGATTGAAGCAGG - Intronic
1015218789 6:130780828-130780850 CCACCTTGCCAGATTCCAGCAGG + Intergenic
1015635066 6:135266913-135266935 CCACCTGCCCTACGTGCAGCAGG + Intergenic
1018143206 6:160860306-160860328 CCAACATACCAAAGTGCAGCAGG + Intergenic
1018813357 6:167313694-167313716 CGACCTGCCCAGGGTGTAGCCGG + Intronic
1021401878 7:20219126-20219148 ACACCAGACCAGACTGCAGGGGG - Intergenic
1021938635 7:25656433-25656455 CCACCTGTACAGAATGCACCAGG + Intergenic
1022383346 7:29881095-29881117 CCACCTGAGCAGAGACCTGCAGG - Intronic
1022410736 7:30136468-30136490 CCACCTGAGGAGCGTGCACCAGG - Intronic
1023871983 7:44268276-44268298 CCACCAGCTCAGAGAGCAGCAGG - Intronic
1024232255 7:47371489-47371511 CCACCTGCCCAGAGAGCACCAGG + Intronic
1025639272 7:63352041-63352063 CCATCTGACCACAATGCAGTTGG + Intergenic
1025643427 7:63396051-63396073 CCATCTGACCACAATGCAGTTGG - Intergenic
1029804819 7:102985220-102985242 CCACCTGGCCAGCATGCATCTGG + Intronic
1031085473 7:117298042-117298064 CCACCTGCCCTGACTGCAGCAGG + Intronic
1031125937 7:117773438-117773460 CCACCTGATCAGAGGACAGTGGG + Intronic
1034677369 7:152901593-152901615 CCACCCCACCAGAGTACTGCCGG - Intergenic
1034998710 7:155594593-155594615 GCAGCTGACCTGGGTGCAGCTGG - Intergenic
1035524348 8:300683-300705 CCACCTGACCTGAGAGTGGCGGG + Intergenic
1035775476 8:2184220-2184242 CCACCTGAGCAGAGTCCAGTGGG + Intergenic
1038552552 8:28482521-28482543 GCACCTTCCCAGAGTGCAGGTGG + Intronic
1041005411 8:53493023-53493045 CCTGCTGGCCTGAGTGCAGCTGG + Intergenic
1042058566 8:64792335-64792357 CCACCTATCCAGATTGCAGAAGG + Intronic
1045064246 8:98431503-98431525 CCACCTGCCTTCAGTGCAGCTGG - Exonic
1045980519 8:108181713-108181735 CACCCTGGCCAGAGTGCAGTGGG + Intergenic
1048180981 8:132193915-132193937 CCAGCTGAACTGAGAGCAGCAGG - Intronic
1053801382 9:41766432-41766454 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
1054143818 9:61548391-61548413 CCCCCTGGGCAGAGTGCACCGGG + Intergenic
1054189813 9:61978586-61978608 CCCCCTGGGCAGAGTGCACCGGG - Intergenic
1054648701 9:67610006-67610028 CCCCCTGGGCAGAGTGCACCGGG + Intergenic
1056034374 9:82587762-82587784 CCACAGGACCAGAGTAGAGCTGG + Intergenic
1056180346 9:84076615-84076637 CCTCCTGACCAAAGAGCAACTGG + Intergenic
1059899488 9:118907414-118907436 ACTCCTTACCAGATTGCAGCTGG - Intergenic
1060968926 9:127727038-127727060 CCACCTGGCCAGGCTGCAGCTGG + Exonic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061422570 9:130480204-130480226 CCACCTGTCCAGTGGGCACCTGG + Intronic
1061959626 9:133981446-133981468 GCATCAGAGCAGAGTGCAGCGGG - Intronic
1062140830 9:134957934-134957956 GCACCTTGCCAGTGTGCAGCAGG - Intergenic
1062443439 9:136583647-136583669 CCACCCGTGCAGAGTGGAGCAGG + Intergenic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1193534313 X:82694098-82694120 CCACTTGACTTGAGTACAGCTGG + Intergenic
1199610010 X:149605042-149605064 CCCCCAGTCCAGGGTGCAGCGGG - Intronic