ID: 1106342216

View in Genome Browser
Species Human (GRCh38)
Location 13:28841372-28841394
Sequence GTGGCAGTCATGGTAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106342216 Original CRISPR GTGGCAGTCATGGTAGTTGG AGG Intronic
900716201 1:4146341-4146363 GTGGCAGGCCTGGTAGTGAGTGG - Intergenic
901112281 1:6808019-6808041 CGGGCAAACATGGTAGTTGGAGG + Intronic
905786089 1:40758811-40758833 GTAGCATTCATGTTTGTTGGGGG + Intronic
905891603 1:41521750-41521772 GAGGCAGGCAGGGTTGTTGGTGG - Intronic
906047838 1:42846504-42846526 GTGGCAGTCATGGTAGCCAATGG + Intergenic
907162983 1:52385127-52385149 GAGGCAGGCAGGGTAGTTTGGGG - Intronic
910288719 1:85580362-85580384 ATGGTGGTGATGGTAGTTGGAGG - Intergenic
910559980 1:88579665-88579687 GTAATAGTCATGGTAGCTGGGGG - Intergenic
913712751 1:121502358-121502380 GTGGCAGCAATGGAAGCTGGAGG + Intergenic
915611915 1:157000704-157000726 GTGGAAGTAATGGGAGTTGATGG + Intronic
918228364 1:182508260-182508282 GTGGTGGTGATGGTTGTTGGTGG + Intronic
918376858 1:183918086-183918108 GAGGCTGTCTGGGTAGTTGGTGG + Intronic
920014302 1:202893718-202893740 GTGGCAATAAAGGTAGATGGAGG + Intronic
922615675 1:226960062-226960084 GTGGTAGTGGTGGTACTTGGTGG + Intronic
922615681 1:226960087-226960109 GTGGTGGTGATGGTACTTGGTGG + Intronic
922615695 1:226960147-226960169 GTGGTAGTGGTGGTACTTGGTGG + Intronic
922615711 1:226960215-226960237 GTGGTGGTGATGGTACTTGGTGG + Intronic
922615753 1:226960386-226960408 GTGTCAGTGGTGGTACTTGGTGG + Intronic
1066337211 10:34490085-34490107 ATGGCAGTGATGGTAGATGTAGG - Intronic
1067063059 10:43088014-43088036 GTGGAAGTCATGATAGTGAGTGG + Intronic
1068341640 10:55711965-55711987 TTGGATGTCATGGGAGTTGGGGG + Intergenic
1068632086 10:59308559-59308581 GTGGTGGTGATGGTGGTTGGTGG - Intronic
1068823239 10:61402548-61402570 GTGGCAGTTATGTGTGTTGGGGG + Intergenic
1069613611 10:69792118-69792140 GTGGCAGTGATGGTGGGTGGTGG - Intergenic
1069713561 10:70506549-70506571 GTGTCACTCAGGTTAGTTGGGGG - Intronic
1070363426 10:75712811-75712833 GTGTCAGTGAATGTAGTTGGGGG - Intronic
1070479781 10:76870748-76870770 GTGGCTGCCATGGTGGATGGAGG - Intronic
1070724087 10:78776290-78776312 GTGGCTGTCATGTGAGCTGGGGG + Intergenic
1071600742 10:86957705-86957727 GGGCCAGCCAGGGTAGTTGGGGG - Exonic
1071666628 10:87564570-87564592 GTGGCAGCAATGGTAGCTGTGGG - Intergenic
1072530800 10:96316880-96316902 GTGGCGGTGATGGTAGTAGGAGG - Intronic
1075431209 10:122383190-122383212 GTGGCAGGGTTGGTAGTTGCTGG - Intronic
1076423546 10:130351327-130351349 GTGGCAGTCATGGCTGCAGGGGG + Intergenic
1077719151 11:4609553-4609575 CTGGCAATCAGGGTAGCTGGGGG + Intergenic
1078939732 11:15988938-15988960 GTGGCACTCATGGGATTTGCAGG + Intronic
1079182311 11:18204561-18204583 GTGGCAGTGGTGGCAGTGGGTGG - Intronic
1083335291 11:61918330-61918352 GTGGGAGCCATGGTACCTGGCGG - Intronic
1084395698 11:68908444-68908466 GTGGCCCTCATGGGAGTTGGTGG + Intronic
1084883745 11:72190028-72190050 GTGGGGGTCATGATTGTTGGTGG + Intronic
1087716537 11:101614802-101614824 GTGGCAATCATGGAAGATGGGGG + Intronic
1089836187 11:121372730-121372752 GTGGCAGACAAGGAAGTGGGGGG + Intergenic
1092253276 12:6913257-6913279 GTGGCAGGCAGAGGAGTTGGTGG + Intronic
1096579613 12:52576163-52576185 GTGGCAGGCATGGCAGCTGTGGG + Intergenic
1100354220 12:93813927-93813949 GTGGCACTCTCGGTAGCTGGGGG - Intronic
1101718533 12:107331853-107331875 GCGGCAGCCATGGTGGATGGAGG + Intronic
1102033688 12:109759146-109759168 GTGGCAGTCAGGAGACTTGGAGG - Intronic
1106342216 13:28841372-28841394 GTGGCAGTCATGGTAGTTGGAGG + Intronic
1107711443 13:43154070-43154092 GTGGCATTCATGACAGTTGAAGG - Intergenic
1107891015 13:44914453-44914475 GTGACAGCCATGGTAGATGGGGG - Intergenic
1108038355 13:46315862-46315884 GTGGCAGGTGTGGTAGGTGGTGG - Intergenic
1108095683 13:46898157-46898179 GTGGCAGGCATGGCAGTGAGGGG - Intergenic
1109225695 13:59692381-59692403 GTGTCAGTCAGGGAAGTAGGGGG - Intronic
1109688838 13:65859162-65859184 ATGGAAATGATGGTAGTTGGGGG - Intergenic
1110183539 13:72645707-72645729 GTGGCAGTCATGGGAGCTGAAGG - Intergenic
1113810933 13:113141927-113141949 GGGACAGTCATGGTAGCCGGGGG - Intronic
1113823459 13:113232049-113232071 GTGACAGTAATGGTGGTGGGCGG - Intronic
1113823466 13:113232078-113232100 GTGACAGTAATGGTGGTGGGCGG - Intronic
1113823473 13:113232107-113232129 GTGACAGTAATGGTGGTGGGCGG - Intronic
1115542519 14:34435463-34435485 GTGCCAGGCATGGTTGTTAGTGG - Intronic
1117548508 14:56811823-56811845 GTGGTGGTGATGGTAGTTGGTGG - Intergenic
1121018098 14:90560782-90560804 GTGGCAGTAAGGGTAGCTGGTGG + Intronic
1121208447 14:92188416-92188438 GTGGAAGACATGGGATTTGGTGG + Intergenic
1121459725 14:94065663-94065685 GGGGCACTCACGGTATTTGGGGG - Intronic
1121946268 14:98125472-98125494 GTGGCACTCAAAGGAGTTGGGGG + Intergenic
1122805910 14:104256887-104256909 GGGGCAGTGATGGGAGGTGGGGG + Intergenic
1127415668 15:58755023-58755045 GTGGCAGTAAAGGTAGGTAGAGG - Intergenic
1127990702 15:64113949-64113971 GTGGCAGTCAGTAAAGTTGGTGG + Intronic
1128625325 15:69196035-69196057 TTGGAAGGCATGGCAGTTGGAGG + Intronic
1129816329 15:78557642-78557664 GTGGCAGTCATGCAGGATGGAGG - Intergenic
1130267115 15:82416545-82416567 GTGGTAGTCATGGGAGTGGAAGG + Intergenic
1130504914 15:84530315-84530337 GTGGTAGTCATGGGAGTGGAAGG - Intergenic
1132538388 16:495284-495306 GTGGCAGTGACTGTAGCTGGGGG - Intronic
1133013213 16:2926051-2926073 GTGGCAGTCATGGTGTGGGGTGG - Intronic
1133013572 16:2928732-2928754 GTGGCAGTCATGGTGTGGGGTGG - Intronic
1134232112 16:12437453-12437475 GTGCCAGGCATGGGAGATGGTGG + Intronic
1134512159 16:14857115-14857137 GGAGCAGACATGGTAGGTGGTGG + Intronic
1134693085 16:16203780-16203802 GAGGCAATCATGGGAGTTGGGGG + Intronic
1134699794 16:16255621-16255643 GGAGCAGACATGGTAGGTGGTGG + Intronic
1134972031 16:18539044-18539066 GGAGCAGACATGGTAGGTGGTGG - Intronic
1134978763 16:18590915-18590937 GAGACAATCATGGGAGTTGGGGG - Intergenic
1135979719 16:27138539-27138561 GTGGCGGTGATGGTAGTGAGTGG + Intergenic
1139891904 16:70258508-70258530 GGGGCAGTGGTGGTGGTTGGTGG - Intronic
1140194517 16:72845517-72845539 GGGGCAGTGATGTGAGTTGGGGG - Intronic
1140640027 16:76960814-76960836 GGGGCCGTCATGGAATTTGGGGG - Intergenic
1140849064 16:78917554-78917576 GTGGCAGTGACAGTGGTTGGGGG - Intronic
1141705941 16:85664604-85664626 GTGGCAGTAATGGTAGGAGTGGG + Intronic
1142467551 17:144858-144880 AAGGAAGTCATGGTAGGTGGGGG + Intergenic
1143544248 17:7587174-7587196 GTGCCCGTTGTGGTAGTTGGTGG - Exonic
1144423193 17:15116453-15116475 GTGGCAGCCATGGGAGCTGCAGG + Intergenic
1144872736 17:18380887-18380909 GTGGCATTCTTGGTGGGTGGAGG - Exonic
1147035534 17:37677118-37677140 GAGTCAGGCATGGTAGTGGGTGG - Intergenic
1147185686 17:38712026-38712048 GTGGGAGTGATGGCAGGTGGGGG - Intronic
1148991102 17:51668062-51668084 GAGGGAGCCATGGTATTTGGGGG - Intronic
1151404980 17:73880308-73880330 GTGGCAGCCCTAGGAGTTGGAGG - Intergenic
1152804834 17:82350660-82350682 GGAGCAGTCATGCTAGTGGGGGG - Intergenic
1155345546 18:24853320-24853342 GTGACAGTGATGGCAGGTGGGGG + Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156509067 18:37620292-37620314 GTGTCATTCATGGGAGTTGTCGG + Intergenic
1157029459 18:43887735-43887757 TTAGAAGTCATGCTAGTTGGAGG + Intergenic
1157264785 18:46209055-46209077 GTGACATTCTTGGTAGTTGGAGG + Intronic
1157727615 18:49976994-49977016 TGGGCAGTCATGGTAGCTGCTGG - Intronic
1158272921 18:55736055-55736077 GAAGCTTTCATGGTAGTTGGAGG - Intergenic
1160668454 19:344555-344577 GTGGCAGCCGGGGGAGTTGGGGG + Intronic
1163050139 19:14676834-14676856 GTGGTAATCATGGTAGTGGCAGG + Intronic
1168403836 19:56100649-56100671 GTGACAGACATCGTAGGTGGGGG - Intronic
1168403858 19:56100741-56100763 GTGACAGACATCGTAGGTGGGGG - Intronic
1168403880 19:56100833-56100855 GTGACAGACATCGTAGGTGGGGG - Intronic
1168403965 19:56101187-56101209 GTGACAGACATCGTAGGTGGGGG - Intronic
926092270 2:10058658-10058680 CTGGCGGTCATGGTTGCTGGTGG - Exonic
926205066 2:10830028-10830050 GTGTCAGCCAAGGTAGTGGGGGG - Intronic
929778937 2:44944995-44945017 GTGGCCGTAGTGGTAGATGGTGG - Exonic
933154781 2:78961326-78961348 GTGGCAGTCAAGGTGGTAGCAGG + Intergenic
933658695 2:84909183-84909205 GTGGCAGTGGTGGTAGTGGTTGG - Intergenic
936824095 2:116559442-116559464 GTTGCATGCAAGGTAGTTGGAGG - Intergenic
937767757 2:125680825-125680847 GTGGCACTCACAGTATTTGGGGG + Intergenic
938313777 2:130312810-130312832 GTGGCAATGATGGTTGTTGTTGG + Intergenic
943657916 2:190528987-190529009 GGGGAAAACATGGTAGTTGGGGG - Intronic
944640004 2:201715141-201715163 GTGGCAGTAATGGTAGCAGCTGG - Intronic
946571601 2:221029784-221029806 GTGGCAGGCATGGTGTTTGGAGG + Intergenic
948709165 2:239814593-239814615 GTGCCAGTCAGGGTTGTTGAGGG + Intergenic
1170116338 20:12864426-12864448 GTCGCAGTCATGGTGGTGGTGGG + Intergenic
1170291815 20:14778573-14778595 GTGGAATTTATGGTAGTTTGGGG + Intronic
1170785533 20:19463890-19463912 GGGGCAGCCCTGGTAGTGGGTGG + Intronic
1173225821 20:41161909-41161931 TTGCCAGTCATTGTATTTGGTGG + Intronic
1173302647 20:41817615-41817637 GTGGCATGCATGGTAGTTGAGGG + Intergenic
1173986557 20:47266196-47266218 GTGGCATTCATGATATTGGGAGG - Intronic
1177886934 21:26758714-26758736 GTGGCAGTCATTATGGTGGGAGG - Intergenic
1177910925 21:27030833-27030855 ATGGCAGTCATAGTAGTGGTGGG + Intergenic
1178278161 21:31257855-31257877 GAGGTTGGCATGGTAGTTGGAGG - Intronic
1178341035 21:31785437-31785459 GTGGTGGTGGTGGTAGTTGGTGG - Intergenic
1179508029 21:41854759-41854781 GTTGCAGTCATCCTCGTTGGAGG + Exonic
1183413115 22:37666835-37666857 GTGCCAGTGATGGTGGGTGGGGG + Exonic
1185051163 22:48555042-48555064 GTGGCTGTCATGGCAGCAGGAGG + Intronic
949298611 3:2556836-2556858 GTGGCTGCTATGGTTGTTGGTGG + Intronic
951722931 3:25721210-25721232 TAGCCAGGCATGGTAGTTGGAGG - Intronic
952044171 3:29298054-29298076 AAGGCAATCATGGTAATTGGAGG - Intronic
952829695 3:37554394-37554416 GTGGCAGTGATGGTTGTGAGCGG + Intronic
955498927 3:59564784-59564806 GTGGCAGTGTTGGCAGGTGGGGG - Intergenic
956547102 3:70416991-70417013 ATGTCTGTCATGGAAGTTGGAGG - Intergenic
959334932 3:105052222-105052244 GTGGCAGTGATTATAGTTGGAGG - Intergenic
959490985 3:106988311-106988333 CTTGCAGTCCTGGTAGTTGGTGG - Intergenic
960061230 3:113323719-113323741 GGGTGAGTCATGGTAGTTTGTGG - Intronic
960306001 3:116061460-116061482 GTGAGAGGCATGGTAGGTGGTGG + Intronic
965643361 3:170855006-170855028 GTCGCAGTCATGGGAGATGATGG - Intronic
968188458 3:196649970-196649992 GTAGCAGTCAGGGGAGGTGGGGG + Intronic
969871713 4:10108850-10108872 GTGGGAGTCAGGGAAGGTGGGGG - Intronic
972110143 4:35547731-35547753 AGGGCATCCATGGTAGTTGGAGG + Intergenic
972966652 4:44518683-44518705 GAGGAAGTCATGCTAGTTGCTGG + Intergenic
975073335 4:70171534-70171556 ATGGCAGTCATGGTGGTGGTAGG + Intronic
975694390 4:76997434-76997456 TTGTCAGTTATGGAAGTTGGGGG + Intronic
981926465 4:150145619-150145641 GTGGCAGTCATTGCATTAGGTGG + Intronic
983090888 4:163500558-163500580 GGGGTGGTCATGGTGGTTGGTGG + Intronic
983709225 4:170693692-170693714 GTGGCAGTCTGGGCAGTTGTAGG + Intergenic
983933025 4:173473818-173473840 GTGGCAGTCATGGCAGATAATGG + Intergenic
984832365 4:183987533-183987555 GTGGGATTCATGGGATTTGGGGG - Intronic
985813121 5:2105147-2105169 CTGGGAGTCAGGGTACTTGGGGG + Intergenic
986187587 5:5459291-5459313 GTGGCAGTTAGGGGAGATGGAGG + Intronic
990008362 5:50967709-50967731 GTGGCAGTGGTGGGAGGTGGTGG + Intergenic
990813792 5:59759654-59759676 GTGGAAATCATGGGAGGTGGAGG - Intronic
991975608 5:72181238-72181260 GTAACAGTGATGGTGGTTGGTGG + Intronic
992704852 5:79380616-79380638 GTGCCAGCCATGGTAGGTAGGGG - Intronic
992751492 5:79866962-79866984 GTGGTTGTGATGGTATTTGGGGG + Intergenic
996831272 5:127743168-127743190 TAGGCAGTCTTGGTGGTTGGAGG - Intergenic
999413934 5:151378674-151378696 GTGGCAGTAATGGCAGATGGTGG - Intergenic
1000440674 5:161259549-161259571 GTGTCAGCCATGGTTGGTGGGGG - Intergenic
1001590156 5:172859375-172859397 GAGGCGGCCATGGGAGTTGGGGG - Intronic
1003863195 6:10340617-10340639 GTGGCCGTGATGGGAGTTTGCGG - Intergenic
1004131916 6:12928672-12928694 GTGGCAGGCATCGTGGTAGGGGG + Intronic
1004898301 6:20170222-20170244 TTGGAAGGCATGGTATTTGGAGG - Intronic
1014783636 6:125592970-125592992 GTGGCAGTCTTGAAAGGTGGGGG + Intergenic
1015002140 6:128230831-128230853 CTGGCAGTCATGGAAGTTCAAGG - Intronic
1017720205 6:157238484-157238506 GTGGCAGTGATGGTGGTGGTGGG + Intergenic
1019332656 7:468200-468222 GTGGTGGTCATGGGAGTCGGTGG - Intergenic
1019332660 7:468216-468238 GTGACAGTCATGAGAGGTGGTGG - Intergenic
1019332668 7:468281-468303 GTGACAGTCATGGAAGGTGATGG - Intergenic
1019332674 7:468331-468353 GTGACAGTCATGGAAGGTGATGG - Intergenic
1020282365 7:6656085-6656107 GTAGGAGGCACGGTAGTTGGTGG + Exonic
1021334231 7:19378543-19378565 ATGGCAGTCTTTGTAGTTTGTGG - Intergenic
1022192628 7:28031720-28031742 GGGCCAGTCATGGGGGTTGGGGG + Intronic
1026296399 7:69056688-69056710 ATTGCACTCATTGTAGTTGGAGG - Intergenic
1027496982 7:78900134-78900156 GTGGCAGCAATGGAACTTGGTGG - Intronic
1029196910 7:98811517-98811539 GTGGTGGTGATGGTAGTGGGTGG + Intergenic
1033512745 7:142076545-142076567 GAGGCATTCATGGCAGTGGGGGG + Intronic
1036086673 8:5620016-5620038 GTGGTAGTCATGGTATTTTCAGG + Intergenic
1039352062 8:36773710-36773732 GTGGAAGTGATGGAAGTTGTGGG + Intergenic
1040794868 8:51278618-51278640 GTAGCAGTGATAGTAGTTAGTGG + Intergenic
1042791192 8:72608206-72608228 GTGGCAGATATGGCAGATGGGGG + Intronic
1042860091 8:73304150-73304172 GGCGCAGTCAAGGTAGTTGAAGG - Intronic
1044267532 8:90200961-90200983 GTGCCAGTCATTGTAGCTGAGGG + Intergenic
1044923896 8:97193434-97193456 GTGGCAGTATTGGGAGGTGGGGG + Intergenic
1045957754 8:107928877-107928899 GTGGTGGTGATGGTAGTTGGTGG + Intronic
1045962539 8:107984706-107984728 GTGGAAGTAATGCTAGTTGGTGG + Intronic
1046830501 8:118740570-118740592 CTAGCAGTCATGGGGGTTGGTGG + Intergenic
1047032175 8:120894179-120894201 GTTCCAGTCAGGGTAATTGGGGG - Intergenic
1048889820 8:138937029-138937051 GTGGCAGTCGTGGTGGGTGGTGG - Intergenic
1050413106 9:5386714-5386736 GTAGCAGTGATGGGAGGTGGGGG - Intronic
1052737349 9:32355803-32355825 GTGGCTGTCTTGGTAATTGGGGG - Intergenic
1056145598 9:83725794-83725816 GTGGCAGTGTTGGGAGGTGGGGG - Intergenic
1056591234 9:87967531-87967553 GTGGAAGTCATGGATGTGGGGGG + Exonic
1057606704 9:96503412-96503434 ATGGCAATCATTGTAGTTGCTGG - Exonic
1058195267 9:101966537-101966559 GTGGCAGGAATGGAAGCTGGGGG + Intergenic
1060700418 9:125746374-125746396 TTGGCAGTCATGGGAGCGGGGGG - Intergenic
1062339362 9:136087150-136087172 GTGGCAGCCTTGGGAGCTGGAGG + Intronic
1188003369 X:25002150-25002172 GTGGTAGGAATGGTAGTTGGCGG + Intergenic
1189195838 X:39151739-39151761 GTGACATGGATGGTAGTTGGAGG + Intergenic
1189917178 X:45866943-45866965 ATGGCAGTCATGGTGGTGGTGGG - Intergenic
1196807897 X:119605394-119605416 GAGGTGGTCATTGTAGTTGGTGG - Intronic
1198567152 X:137916379-137916401 GTGGCAGGCAGGGCAGTGGGGGG + Intergenic
1198614540 X:138441765-138441787 GAGCCAGACATGGTAGTTTGGGG + Intergenic
1202365032 Y:24154297-24154319 GTGGTAGTCATGGGAGTGGAAGG + Intergenic
1202505749 Y:25515825-25515847 GTGGTAGTCATGGGAGTGGAAGG - Intergenic