ID: 1106343340

View in Genome Browser
Species Human (GRCh38)
Location 13:28852275-28852297
Sequence CTGGAGAGACAGATGAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 405}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106343340_1106343346 -1 Left 1106343340 13:28852275-28852297 CCTTTGTTCATCTGTCTCTCCAG 0: 1
1: 0
2: 1
3: 43
4: 405
Right 1106343346 13:28852297-28852319 GTTGGATTGGAAGCTCTGGGAGG 0: 1
1: 0
2: 3
3: 19
4: 206
1106343340_1106343347 11 Left 1106343340 13:28852275-28852297 CCTTTGTTCATCTGTCTCTCCAG 0: 1
1: 0
2: 1
3: 43
4: 405
Right 1106343347 13:28852309-28852331 GCTCTGGGAGGATGACTGTATGG 0: 1
1: 0
2: 1
3: 17
4: 182
1106343340_1106343343 -5 Left 1106343340 13:28852275-28852297 CCTTTGTTCATCTGTCTCTCCAG 0: 1
1: 0
2: 1
3: 43
4: 405
Right 1106343343 13:28852293-28852315 TCCAGTTGGATTGGAAGCTCTGG 0: 1
1: 0
2: 2
3: 12
4: 138
1106343340_1106343345 -4 Left 1106343340 13:28852275-28852297 CCTTTGTTCATCTGTCTCTCCAG 0: 1
1: 0
2: 1
3: 43
4: 405
Right 1106343345 13:28852294-28852316 CCAGTTGGATTGGAAGCTCTGGG 0: 1
1: 0
2: 4
3: 17
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106343340 Original CRISPR CTGGAGAGACAGATGAACAA AGG (reversed) Intronic
900485659 1:2921440-2921462 CTGGATGGACAGATGGACACAGG - Intergenic
900485667 1:2921482-2921504 CTGGATGGACAGATGGACAGAGG - Intergenic
900485683 1:2921566-2921588 CTGGATGGACAGATGGACACAGG - Intergenic
900485691 1:2921608-2921630 CTGGATGGACAGATGGACACAGG - Intergenic
900485699 1:2921650-2921672 CTGGATGGACAGATGGACACAGG - Intergenic
900485753 1:2921902-2921924 CTGGATGGACAGATGGACAGAGG - Intergenic
900485761 1:2921944-2921966 CTGGATGGACAGATGGACAGAGG - Intergenic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900786009 1:4651046-4651068 CTTGGGAGAAAAATGAACAATGG + Intergenic
900898788 1:5503083-5503105 CAGGAGAGACAAAGGACCAAGGG + Intergenic
903597713 1:24508485-24508507 CAGGAGAGAAAGATGAAAAAAGG + Intronic
904934701 1:34122024-34122046 CTGGAAAGAGAGATGAAAAGTGG - Intronic
905299603 1:36977622-36977644 CTGGAGAGACTGAGGACCCAAGG + Intronic
905307406 1:37029217-37029239 CTGGGAAGACAGATGCACTAAGG - Intronic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
911052031 1:93680002-93680024 CTGGAGAGTCAGATGGAGAGAGG + Intronic
912484040 1:110010054-110010076 CTGGAGTGACAGATAAAAAGTGG + Intronic
912542942 1:110430707-110430729 CTTGAGGGACTGAGGAACAAAGG + Intergenic
913392004 1:118324499-118324521 CAGGAGAGAAACAGGAACAAAGG - Intergenic
913530174 1:119728377-119728399 CTGGAAGGACAGATGGACAATGG - Intronic
913581358 1:120230492-120230514 CTGGAGGGACAGAGGACAAAAGG + Intergenic
913626818 1:120667899-120667921 CTGGAGGGACAGAGGACAAAAGG - Intergenic
914334671 1:146703575-146703597 CTGGTGAGGCAGAGGAAAAAAGG - Intergenic
914563290 1:148841935-148841957 CTGGAGGGACAGAGGACAAAAGG + Intronic
914609537 1:149288288-149288310 CTGGAGGGACAGAGGACAAAAGG - Intergenic
915477081 1:156159479-156159501 GTGGAGAGACAGAGGCACGAGGG + Intronic
915933429 1:160075141-160075163 CTGGAGAGAAAGGTGAAGGATGG - Intergenic
916824383 1:168430042-168430064 CAGGTGAGACAGATGGAAAAGGG + Intergenic
917209472 1:172616686-172616708 CTGGATGGACAGGTGAACAGTGG + Intergenic
917455674 1:175183638-175183660 CTGGGGAGCCAGCCGAACAAGGG + Intronic
917605171 1:176620688-176620710 CTGGTGAGACAGATTAACATAGG - Intronic
917707266 1:177647238-177647260 CAGGACAAACAGATGAAGAAAGG - Intergenic
919541778 1:198855926-198855948 CTAAAGAGACAAATGAACAGTGG - Intergenic
919617010 1:199820430-199820452 AGGGAGAGACAGAAGGACAATGG + Intergenic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920664376 1:207950611-207950633 TTGGAGAGACACATGAAAATGGG + Intergenic
920834509 1:209496882-209496904 ATGGAGAGGGAGATGAAAAAAGG - Intergenic
921418879 1:214923103-214923125 CTTGAGAGCCAGATAAAGAATGG + Intergenic
921898885 1:220429424-220429446 TTGGAGAGGCAGAATAACAATGG + Intergenic
922034531 1:221835525-221835547 CAGGAGAGACAATGGAACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922916479 1:229262107-229262129 ATGGAGACACAGATGAGAAAGGG - Intergenic
922995011 1:229949662-229949684 AAGGATAGACATATGAACAATGG + Intergenic
924563684 1:245178393-245178415 CTGAAGAGACAGCTCAAGAATGG - Intronic
1062995620 10:1863583-1863605 CTGAAGAGACAGAGGAAGACGGG - Intergenic
1063447647 10:6129637-6129659 CTGGAGAGTCACTTGAACCAGGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064624460 10:17248136-17248158 CTGGAGAAACACTTGAACCAAGG + Intergenic
1065216585 10:23455054-23455076 TTAGAGAGACAGTTTAACAATGG - Intergenic
1066444491 10:35469608-35469630 GTGGAGAGACAGATAGACAGGGG + Intronic
1066444566 10:35470052-35470074 ATGGAGAGACAGATGAGATAGGG + Intronic
1066489702 10:35882857-35882879 CTGGAGGGACAGATGCAGACAGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1066556486 10:36620242-36620264 CTTGAGAGACAGAGCAACACAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1069894028 10:71669422-71669444 ATGGGGAGACAGATCACCAAGGG - Intronic
1070721199 10:78758370-78758392 CTGGAGAGACAGGAGTGCAAGGG - Intergenic
1071365924 10:84900592-84900614 CTGGAGTAACATATGACCAATGG - Intergenic
1071880510 10:89892010-89892032 CTTGAGAAAAAAATGAACAATGG + Intergenic
1072539777 10:96389621-96389643 TGGGAGAGACAGATAGACAAAGG + Intronic
1072715477 10:97749647-97749669 CTGTAGAGACAGAAGAACTGGGG - Intronic
1073107119 10:101038618-101038640 GTGGAGAGACAGAAAGACAATGG - Intronic
1073462106 10:103671733-103671755 TTGGAGAGACAGAGGGACAGGGG + Intronic
1073599620 10:104834083-104834105 CTGGGGAGACAGGTGAAGAGGGG - Intronic
1074678029 10:115874743-115874765 GTGGAGAGTCACATGAGCAAAGG + Intronic
1075422356 10:122310975-122310997 CTGCTGAGACAGATGAGGAAAGG - Intronic
1077280559 11:1743165-1743187 ATGGATGGACAGATGAAGAATGG + Intronic
1077280564 11:1743203-1743225 ATGGATGGACAGATGAAGAATGG + Intronic
1077280579 11:1743297-1743319 ATGGATGGACAGATGAAGAATGG + Intronic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077801682 11:5545306-5545328 ATGGAGAGAAAGAAGAACATGGG + Exonic
1078006766 11:7537978-7538000 TTGGAGAGAGAGGGGAACAAAGG + Intronic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1080037916 11:27728773-27728795 AAGGAGAGACTGAAGAACAATGG + Intergenic
1080155687 11:29108021-29108043 CTGGTGAGAGAGATGAAGACAGG + Intergenic
1081641625 11:44759582-44759604 ATGGAGAGATGGATGAACACAGG - Intronic
1082674894 11:56085134-56085156 CTGGAATGATAGATGAACATAGG - Intergenic
1082819802 11:57537310-57537332 CTGGGGAGAAAGATGACCACAGG + Intergenic
1084375384 11:68773280-68773302 CTGGAGGGCCAGCTGCACAAAGG + Exonic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1085853607 11:80150618-80150640 ATGTAGAGACACATGACCAAAGG + Intergenic
1086900091 11:92357543-92357565 CTGGAGAGCCATATAAACAATGG - Intronic
1087632569 11:100667939-100667961 TTAGAAAGACTGATGAACAAAGG + Intergenic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088036945 11:105328780-105328802 CTGGAAGGACAGATGACCAGAGG + Intergenic
1088617603 11:111646574-111646596 CAGGAGGGAAAGATGAAAAAGGG - Intronic
1089901717 11:121993499-121993521 ATTCAGAGACAGAAGAACAATGG + Intergenic
1090005406 11:122998091-122998113 CTGGAAAGAAAGTTGAACAAGGG + Intergenic
1091700383 12:2655063-2655085 CTGAAGAGACCATTGAACAATGG + Intronic
1091877795 12:3950838-3950860 CAGGAGAGACAACTGAACAGAGG + Intergenic
1092106841 12:5927363-5927385 CTACAGAGGCAGATGAAGAAGGG + Intronic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1092884553 12:12913763-12913785 CGGGAGAGACACATGAAGAAGGG - Exonic
1093473597 12:19531450-19531472 AAGGAGAGACAGAAGAACAAAGG - Intronic
1093886455 12:24467044-24467066 CTGAGGAGACAGATAAAGAAAGG - Intergenic
1095284603 12:40393387-40393409 CTGGAGAGACAAGTCTACAAGGG - Exonic
1095382004 12:41606173-41606195 CTGCAGAGAGAGATGCTCAATGG + Intergenic
1096021335 12:48328191-48328213 CAGAAGAGGTAGATGAACAAGGG - Intergenic
1097141236 12:56903816-56903838 CTGGAAAGAGAGAGGAACAAAGG + Intergenic
1097842117 12:64331862-64331884 CTGGAAAGACAGAATAACAGCGG - Intronic
1098991235 12:77066111-77066133 CTGGTGTGACACATGAACCATGG + Intergenic
1101680823 12:106963283-106963305 CTGGACTGAAAGAAGAACAAAGG + Intronic
1103509039 12:121461617-121461639 CTTGAGCAACAGAAGAACAAGGG + Intronic
1103753874 12:123187331-123187353 CTCGAGAAAAAAATGAACAAAGG + Intronic
1104829172 12:131736840-131736862 CTTGAGTGACAGCTGAAAAATGG - Intronic
1105424950 13:20285871-20285893 CTGGGAAGAAAGAGGAACAAAGG + Intergenic
1105546555 13:21355077-21355099 CTGGAGAGTCAAAGCAACAAAGG + Intergenic
1105600852 13:21885794-21885816 CTGGAGGGAGAGATTAAGAAGGG + Intergenic
1106272733 13:28169952-28169974 CTGGAGAGTCACATGAACCTGGG + Intronic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1110030095 13:70600119-70600141 ATGGAGAGTAAGATGAAGAATGG + Intergenic
1111031141 13:82600893-82600915 CTGGAGAGCAAAAGGAACAAAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1112635401 13:101212091-101212113 ATGGAGGGACATATGACCAAAGG - Intronic
1113006330 13:105706737-105706759 GGGGAGAGCCAGATGAACAAGGG + Intergenic
1113213452 13:108009830-108009852 CTACAGAGACAGATCAATAAGGG - Intergenic
1114550386 14:23529456-23529478 CTTGAGGGAAAGATGAATAAAGG - Intronic
1117207669 14:53460824-53460846 CAGGAGTGACAGTTCAACAAAGG + Intergenic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1119920989 14:78445860-78445882 TTGCAGAGATAGATGAACATTGG + Intronic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120385972 14:83846356-83846378 CAGGAAAGACAGGTGAATAAAGG + Intergenic
1120397014 14:83980812-83980834 CTGGAGAGACAGACAAAATAAGG - Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1120929663 14:89836022-89836044 CAGGAGTGACGGATAAACAAGGG + Intronic
1121061899 14:90918814-90918836 CAGGATAGACAAATGATCAATGG - Intronic
1121607442 14:95251770-95251792 CAAAAGAGACAGTTGAACAATGG - Intronic
1122042148 14:98996397-98996419 CTAAGGAGAGAGATGAACAAGGG + Intergenic
1124067353 15:26356779-26356801 CTGGAGATATAGAAGAACACAGG - Intergenic
1124941942 15:34226373-34226395 CTGGTGAGCCTGATGAAGAAAGG - Intronic
1125073365 15:35582959-35582981 TTAGATAGACAAATGAACAAAGG + Intergenic
1125702131 15:41696052-41696074 CTGGAGAGAGAGAGGAGAAAGGG - Intronic
1125959696 15:43819237-43819259 ATAGATAGATAGATGAACAATGG + Intronic
1126458753 15:48893213-48893235 CTAGACAGACAGAAGAACATAGG + Intronic
1129377382 15:75142525-75142547 CTGGAAAGAGAAAGGAACAAAGG - Intergenic
1130384962 15:83403162-83403184 CTAGGGAGACAGTTGAACATTGG + Intergenic
1130630594 15:85564690-85564712 CTGAAGAGACAGATAATCTAAGG - Intronic
1130741967 15:86610533-86610555 AGGGAGAAACAGATAAACAAAGG + Intronic
1132437834 15:101824806-101824828 CTGGAGAGACAAATGGAAACTGG - Intergenic
1133026230 16:2990064-2990086 CTGGAGAGACAGATGAGGTGAGG - Intergenic
1133456641 16:5948046-5948068 CAGGAGAGGCAGGTGCACAAGGG + Intergenic
1133485594 16:6215381-6215403 CAGGAGAGACAGAAGAAAACAGG + Intronic
1134779251 16:16880701-16880723 CTGGGGTGACTGATGAATAAAGG - Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1136402667 16:30027065-30027087 CTGCAGAGAGAGAGGAACATGGG - Intronic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137564630 16:49525316-49525338 CAGGGGAGAGAGATGAACACAGG - Intronic
1139998950 16:71007657-71007679 CTGGTGAGGCAGAGGAAAAAAGG + Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140829145 16:78735330-78735352 CTGGAGAACCTGATGACCAATGG - Intronic
1141679872 16:85537735-85537757 CTGGCGAGAAAGATGAATGAAGG + Intergenic
1141699098 16:85634324-85634346 CAGGAGAGACAGAAGCACAGAGG - Intronic
1142253168 16:89002118-89002140 CTGGGGAGACAGAGGAACTGGGG + Intergenic
1145063617 17:19747576-19747598 CCCGAGAGACAGGTTAACAAAGG + Intronic
1145812196 17:27771123-27771145 TGGGAGAGACAGATGAGCACAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1146842226 17:36164012-36164034 TGGGAGAGACAGATGCACACAGG - Intergenic
1146854536 17:36251971-36251993 TGGGAGAGACAGATGCACACAGG - Intronic
1146866083 17:36336405-36336427 TGGGAGAGACAGATGCACACAGG + Intronic
1146870437 17:36375863-36375885 TGGGAGAGACAGATGCACACAGG - Intronic
1146877794 17:36426944-36426966 TGGGAGAGACAGATGCACACAGG - Intronic
1146991242 17:37274872-37274894 CTGGAGAGCCAGAGTAACAAGGG + Intronic
1147068953 17:37937017-37937039 TGGGAGAGACAGATGCACACAGG + Intergenic
1147073320 17:37976487-37976509 TGGGAGAGACAGATGCACACAGG - Intergenic
1147080477 17:38016554-38016576 TGGGAGAGACAGATGCACACAGG + Intronic
1147084841 17:38056025-38056047 TGGGAGAGACAGATGCACACAGG - Intronic
1147096424 17:38140514-38140536 TGGGAGAGACAGATGCACACAGG + Intergenic
1147100789 17:38179991-38180013 TGGGAGAGACAGATGCACACAGG - Intergenic
1148389627 17:47262044-47262066 CTGTAGAAACACTTGAACAAAGG - Intronic
1149845376 17:60006455-60006477 TGGGAGAGACAGATGAGCACAGG - Intergenic
1150578347 17:66450201-66450223 CTGGAGAGAGAGATGCTCATCGG + Intronic
1151828056 17:76534729-76534751 CTGGAGAGACAGCTGTGCCAGGG + Intronic
1151920226 17:77149044-77149066 CTGGAGAGACAGATGGGGAATGG - Intronic
1153221926 18:2869397-2869419 CTGGAGGGAGAGATTAGCAAGGG - Intronic
1153374075 18:4356052-4356074 CTGGAGTGACAGATGTGCAATGG - Intronic
1153379985 18:4427621-4427643 TAGGAGAGACAAATCAACAAAGG + Intronic
1153428445 18:4990611-4990633 CTGGAAAGAAAAATGAACAAAGG - Intergenic
1155206484 18:23562538-23562560 CTGGAAAGACAGGTTAACTAGGG + Intronic
1155595802 18:27484906-27484928 ATGGAGAGACAGATAACCACAGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155801947 18:30116600-30116622 CTGGAGAGACTGAAGGACATTGG + Intergenic
1156203445 18:34859591-34859613 ATGGTGAGGCAGATGAATAATGG - Intronic
1156739760 18:40309990-40310012 GTGTAGAGACACATGAACAGTGG + Intergenic
1156845750 18:41663574-41663596 CTGGAGAGCAAGATGAACCCTGG - Intergenic
1157359221 18:46963230-46963252 CTCGAGAGACAGATGAATTATGG - Exonic
1157360215 18:46969157-46969179 CTCGAGAGACAGATGAATTATGG - Exonic
1157360816 18:47022749-47022771 CTCGAGAGACAGATGAATTATGG - Exonic
1157361805 18:47028664-47028686 CTCGAGAGACAGATGAATTATGG - Exonic
1157498501 18:48172871-48172893 CTGCAGAGACAGAGGAGCACAGG + Intronic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158263509 18:55635080-55635102 TTGGAGAGAAAGAGGAACCATGG + Intronic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159085723 18:63789273-63789295 ATGGAGAGAGAGATGAGCAGTGG - Intronic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159343718 18:67170912-67170934 TTGCAGAGACACTTGAACAATGG + Intergenic
1162446290 19:10724904-10724926 CTGGAGGGACACATCACCAAAGG - Intronic
1164425976 19:28142317-28142339 ATGGAGAGAGAGAGGAAGAAAGG + Intergenic
1164943842 19:32273349-32273371 CTGGAGATACAGATTAACGTTGG - Intergenic
1166305626 19:41935572-41935594 ATGGAGAGACAGACGGACATCGG + Intergenic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167640744 19:50679988-50680010 ATGGAGAGACAGAGAGACAATGG + Intronic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
925069693 2:956482-956504 CAGGAGAGGCAGCTGAGCAAAGG - Intronic
925207346 2:2018377-2018399 ATGGAGAGACAGAGGAGCAGAGG + Intronic
925246914 2:2391796-2391818 CTTGAAAGACAGATGAATTAGGG - Intergenic
925909845 2:8566440-8566462 TGGGAGAGACAGATGGACATAGG - Intergenic
926404624 2:12538563-12538585 CTGGAGAGACTGATTAACTAAGG + Intergenic
926816290 2:16801003-16801025 CTGGAGACACAGAAACACAAAGG + Intergenic
926899985 2:17740245-17740267 TAGGAGAAACAGATGGACAAGGG - Intronic
926911796 2:17858341-17858363 CTGGAGTGACAGCTGACTAAGGG - Intergenic
927679376 2:25129952-25129974 CTGGGGAGACAGAGGCACATGGG - Intronic
928145347 2:28769602-28769624 CTGCAGAAAGAAATGAACAATGG + Intronic
928428263 2:31197238-31197260 CTGGAGTGACAGGTGAACTTTGG - Exonic
929524489 2:42687868-42687890 CTGGAGTCAGAGATGAAGAAGGG - Intronic
931400251 2:61925001-61925023 ATGGAGAGACAGACGGTCAAGGG + Intronic
931437177 2:62257742-62257764 CTGTGGAAACAGAAGAACAAAGG + Intergenic
932716602 2:74104804-74104826 CTGCAGAAACTGATGAACCAAGG - Exonic
933180243 2:79218233-79218255 GTGGAGAGACAGAAGCACAGGGG + Intronic
933206939 2:79517124-79517146 GTGGAGAGACAGATGCTCACTGG + Intronic
933989723 2:87625500-87625522 CTGGAAAGGCAGATCAACAAAGG + Intergenic
934232024 2:90192702-90192724 CTGGCGAGACAGGAGAACACAGG - Intergenic
934613902 2:95759651-95759673 ATGGATAGACAGATGAAAGATGG + Intergenic
934670355 2:96208565-96208587 CTGCAGAGACAGATGAGCGGCGG - Exonic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936304121 2:111325326-111325348 CTGGAAAGGCAGATCAACAAAGG - Intergenic
936469150 2:112782719-112782741 ATTCAGAGACAGATGATCAATGG + Exonic
936668317 2:114624870-114624892 GTGGAGCAACAGATGAACCAAGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938959531 2:136328817-136328839 CAGGAAAGACAGAGGAAGAAAGG + Intergenic
939951603 2:148481693-148481715 CTGGTGATCCAGATGCACAAGGG - Intronic
940249496 2:151659027-151659049 CTGGAGAGAAAGATGACAACAGG + Intronic
940424317 2:153513578-153513600 CTCTAGAGAAAGATGACCAATGG - Intergenic
941573821 2:167205036-167205058 CTAGAGAGAAAGATGCAGAAAGG - Intronic
941704587 2:168644399-168644421 CAAGTGAGGCAGATGAACAAAGG + Intronic
942513557 2:176728187-176728209 CTGGTCAGACAAGTGAACAAAGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
944207430 2:197171355-197171377 GTAGAGGGACAGATGATCAAAGG + Intronic
944496672 2:200314093-200314115 CTGGAGATGCAGATTTACAATGG - Intronic
945772643 2:214063480-214063502 CAGGAGAAACAGGTCAACAATGG + Intronic
945876161 2:215280084-215280106 GTGGAGTAACAGATGAACAAAGG - Intergenic
946552849 2:220822564-220822586 CTGGAGGGACAGATGAGGAAGGG - Intergenic
947040939 2:225918753-225918775 CAGGAGAGACAGAGAAGCAATGG - Intergenic
947381050 2:229545639-229545661 TTTGGGAGTCAGATGAACAAAGG - Intronic
947585773 2:231355775-231355797 CTGGAGAAAAACATGAAAAACGG - Intronic
947864908 2:233389826-233389848 CTGGAGAGAAAGATGCTCCAGGG - Intronic
1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG + Intergenic
1169152687 20:3302784-3302806 GTGGAGGGAAAGATGAAAAAGGG + Intronic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1169905691 20:10600977-10600999 ATGGACAGACAGATGAGAAAAGG + Intronic
1169967495 20:11234271-11234293 CTAGACAGACAGAGGAAAAAGGG - Intergenic
1171194577 20:23187190-23187212 CTGGAGAGAGACAGGCACAAGGG - Intergenic
1172937928 20:38633873-38633895 CCGGTGAGGCAGAGGAACAAAGG + Intronic
1174503996 20:51004996-51005018 CTGGAGAGAGAGATGAGGAGCGG - Intronic
1175601709 20:60279619-60279641 CAGGAGAGACAGGAGACCAAGGG + Intergenic
1175666361 20:60863653-60863675 ATGGACAGACAGATAAATAAAGG + Intergenic
1175928644 20:62482886-62482908 CAGGAGAGAAAGAGGAACATGGG - Intergenic
1176415002 21:6468969-6468991 CGGGAGAGAAAGATGATAAACGG + Intergenic
1177193683 21:17880122-17880144 CTGGAGTGACAGAAGAGCAGTGG + Intergenic
1177298093 21:19203055-19203077 GGGGAGAGACAGATAACCAAAGG + Intergenic
1178309153 21:31515226-31515248 CTAGAGAGACAAAAGAAGAAGGG - Intronic
1178396623 21:32248934-32248956 CTGGGGAGAAAAATGAAGAAAGG + Intergenic
1179180780 21:39043069-39043091 CTGGAGACCCAGGAGAACAAAGG - Intergenic
1179199426 21:39202546-39202568 CTGGCCAAACATATGAACAAAGG + Intronic
1179621559 21:42619808-42619830 CTGGAGAGCCAGCTGAGGAAAGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179690502 21:43077301-43077323 CGGGAGAGAAAGATGATAAACGG + Intergenic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1180243226 21:46526236-46526258 ATGGAGGGACAGATGTCCAAGGG - Intronic
1181329115 22:22075330-22075352 CTGCAGACACAGATGCACATGGG - Intergenic
1181499145 22:23305908-23305930 TTGGAAAAACAGATGACCAAGGG - Intronic
1182114557 22:27748199-27748221 CTGAAGAGACTGATGTAAAAAGG + Intergenic
1183147486 22:36007653-36007675 ATTGAGAGACAGAGGAATAAGGG - Intronic
1183268444 22:36845734-36845756 GTAGAGAGTCAGATGAACATAGG - Intergenic
1185212921 22:49581940-49581962 ATGGATGGACAGATGAATAATGG - Intronic
1185293841 22:50043103-50043125 ATGGATAGACAGATAAACAGTGG + Intronic
949324791 3:2851305-2851327 CTGGAGAGGCATATGATCAGAGG - Intronic
949385704 3:3500037-3500059 ATGTGGAGACAGATGAGCAAAGG + Intergenic
949682191 3:6526969-6526991 GTGGAGAGAAAGAGGAAGAAGGG + Intergenic
951293582 3:20904348-20904370 TTGGTGAGACAGAAGAACAATGG + Intergenic
951623943 3:24639445-24639467 CTGGAGAGACAGGTGAATCTAGG - Intergenic
951748110 3:26001979-26002001 ATGGAGAAATAGAGGAACAAAGG + Intergenic
951787819 3:26442413-26442435 CTGGTGAAAAAGATGGACAAGGG - Intergenic
952916931 3:38253503-38253525 CTGGAGAGAGCAATGAAGAAGGG - Exonic
953173658 3:40529883-40529905 CTGGATGGACAAAGGAACAAAGG - Intronic
953225705 3:41017560-41017582 ATGGAGGGACAGAGGAGCAAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
958428960 3:94015174-94015196 CTACAGAAACAGAGGAACAAGGG - Exonic
958551052 3:95613226-95613248 GTGGAAAAACAGATGAATAAAGG + Intergenic
958619881 3:96544407-96544429 CTGAAGTGGCAGATGAATAAAGG + Intergenic
958755824 3:98248211-98248233 GAGGAGAGACAGATGAGCAGCGG - Intergenic
958883489 3:99699488-99699510 TTGGACAGACAGATGATCAAAGG + Intronic
959000928 3:100963651-100963673 CTGGAGAGAAAGAGAAACAGGGG - Intronic
959050229 3:101517541-101517563 CTGGAGAGAAGAAAGAACAAAGG - Intergenic
960236067 3:115283662-115283684 CTGGTGAGAAAGATGAGCAATGG - Intergenic
960871483 3:122254171-122254193 CTGGAGAGACGGCAGAACCATGG + Exonic
960980089 3:123215811-123215833 ATGGAGAGAGAAATGAACCAGGG + Intronic
962847996 3:139287839-139287861 CTGGACAGACAGGTAAACGATGG + Intronic
963113715 3:141707980-141708002 CTGGGGTGACAGCTAAACAATGG + Intergenic
964107122 3:153051219-153051241 CTAGAGAGAAATGTGAACAATGG + Intergenic
964346966 3:155763684-155763706 CTGGAGAGAAATATGGAAAAAGG - Exonic
967050585 3:185780214-185780236 CTGGAAAGACAGATAATGAAAGG + Intronic
967570337 3:191020625-191020647 CTGGAGAGACTCATGTACACTGG - Intergenic
967782217 3:193452057-193452079 CTGTGGAGACACATGAGCAATGG - Intronic
968547039 4:1204596-1204618 CTGGAACAAAAGATGAACAAGGG - Intronic
969500685 4:7550857-7550879 CGGGTGAGACAGATGGAAAAAGG - Intronic
969694916 4:8729108-8729130 CTAGACAGACAGATGGACACTGG + Intergenic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
971229653 4:24790787-24790809 TTGGAGAGACATATGTGCAAGGG - Intronic
971760607 4:30760104-30760126 CTTGAGAAGCAGAGGAACAATGG - Intronic
971954867 4:33403557-33403579 CTGGAGAAAGAGAGGAAGAAAGG - Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
973587119 4:52404565-52404587 ATGGGGAGACAGATGTTCAAGGG - Intergenic
973925330 4:55731133-55731155 CTGGAGAGACACACCAAGAAAGG + Intergenic
976922316 4:90455540-90455562 CTGGAAAGAGAAAGGAACAAAGG - Intronic
977450207 4:97186293-97186315 CTGTAGAGTCACATGAACAATGG - Intronic
978435740 4:108682376-108682398 AAGAAGAGACAGATGAACTAAGG + Intergenic
978508522 4:109488304-109488326 CTGTAGAGACAGAGGATTAATGG - Intronic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
982286505 4:153741556-153741578 CTAGAGAGACAGATGAATGCAGG - Intronic
982338441 4:154267622-154267644 ATGGAGGGACAGATGAACTCTGG - Intronic
983317483 4:166150498-166150520 CAGGAGAGAAAGAAGAACAGTGG + Intergenic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
987736214 5:21846938-21846960 CGGGACTGGCAGATGAACAATGG + Intronic
989493992 5:42090188-42090210 CTGGAGTGACTGAGGAAGAATGG - Intergenic
990448406 5:55914160-55914182 TTGGAGAGACAGCTCAACCAGGG - Intronic
992720108 5:79552119-79552141 GAGGAGAAAAAGATGAACAAAGG + Intergenic
993964019 5:94337922-94337944 CTGGGTAGACAGAAGAACAGAGG + Intronic
994244703 5:97466702-97466724 CTGAAGAGAGAGAGGAACAAAGG - Intergenic
994567014 5:101462133-101462155 CTGGAGAGAGAGAGAAAAAAAGG + Intergenic
995687325 5:114784958-114784980 CTGGTGCTACAGATGAACCAAGG - Intergenic
996167763 5:120246422-120246444 CTAGAGTGGCAGATGAACACTGG + Intergenic
996922628 5:128786792-128786814 CTGGAGAGAAAGATGATGTAAGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997282449 5:132657233-132657255 CTGCAGAGACTGGTGAGCAAAGG + Intronic
997689732 5:135819554-135819576 CTGGAGTGACAGCAGATCAATGG + Intergenic
998376908 5:141697081-141697103 ATGGTCAGACAGGTGAACAAGGG - Intergenic
999302518 5:150500040-150500062 CGGGACAGACAGTTGGACAAGGG - Intronic
999639750 5:153660639-153660661 ATGGTGAGACAGATGTCCAATGG - Intronic
1000108717 5:158086412-158086434 CAGCAGGGATAGATGAACAAAGG - Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1000976456 5:167770142-167770164 GTGGAAAGAATGATGAACAAAGG + Intronic
1001651675 5:173320334-173320356 CTGGAGAGAGAGAGGGCCAAGGG - Intronic
1002101196 5:176858524-176858546 CATGGGAGCCAGATGAACAATGG + Intronic
1002755527 6:156129-156151 CTTGAGGGACAGATGTGCAAAGG + Intergenic
1002909580 6:1479178-1479200 CTGGAGAGAAAGAAGATAAATGG + Intergenic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1006443050 6:34063838-34063860 CTGGGGAGACAGATGGACAGAGG + Intronic
1006888012 6:37398402-37398424 CTGGAGGGAAAGATGACCATGGG + Intergenic
1006902194 6:37510469-37510491 CTGGAGAGACAGATGTGCCTGGG + Intergenic
1007078511 6:39082963-39082985 CTGGAGAGGCAGCTGAGCCAGGG - Intronic
1007821539 6:44563969-44563991 CTGGAGAGCCTGATAAACACAGG + Intergenic
1009573946 6:65428092-65428114 CTGGTGAGAGTGATGTACAATGG + Intronic
1009590141 6:65657970-65657992 CTGGAGAGTCAGATGATCACTGG + Intronic
1009753211 6:67899715-67899737 CTGTACAGACTCATGAACAAAGG - Intergenic
1009890869 6:69680030-69680052 CTGTAGAGACAGAAAAATAATGG - Intronic
1010451659 6:76010835-76010857 CAGTAGAGACAGATGAAAAAAGG - Intronic
1012629703 6:101449670-101449692 CTGGAGACACAGAGACACAAAGG - Intronic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1016727281 6:147387906-147387928 CTGGGGAGACAGCTGAGGAAAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017658487 6:156651946-156651968 CTGGAGAAACACTTGAACACAGG + Intergenic
1018080435 6:160255078-160255100 CAGGAGAGACACATTAACAAGGG - Intronic
1018199859 6:161384637-161384659 CTGGAGACACAGGGGAACAGAGG + Intronic
1018533240 6:164790315-164790337 CTGGGGAGCCTGAGGAACAAAGG - Intergenic
1020831123 7:13096738-13096760 CTTGAGAGGCAGAAGAAGAAAGG + Intergenic
1020906006 7:14065550-14065572 CCGGCGGGATAGATGAACAAAGG - Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021225403 7:18020610-18020632 TTGGAGAGACAGAGACACAAGGG - Intergenic
1022215539 7:28257147-28257169 CTGGTGAGAGAGATGAGAAAAGG - Intergenic
1022615012 7:31920354-31920376 CTGGAGAGACAGGAGCAGAATGG - Intronic
1024466098 7:49712510-49712532 CTGGAGGGACAGATGCACCTGGG - Intergenic
1024467210 7:49723862-49723884 CTGGAATTACAGATCAACAAGGG - Intergenic
1024962624 7:54993727-54993749 CTGGAGAGACAGAAGAATGTGGG - Intergenic
1025120088 7:56294529-56294551 ATGGAGAGACAGATGGATAAAGG + Intergenic
1026406876 7:70075065-70075087 CTTGGGAGAGAGATGAGCAAGGG - Intronic
1026864881 7:73817400-73817422 CTGGAGAGAAAAATTAAGAAGGG - Intronic
1027164600 7:75825461-75825483 CAGGAGAGCCAGGTGAACAGTGG + Intergenic
1030414860 7:109230317-109230339 TTAGAGATACAGTTGAACAACGG + Intergenic
1030782679 7:113620952-113620974 CGGGAGAGAAAGGTGAAAAACGG + Intergenic
1033137442 7:138797111-138797133 GTAGAGGGACAGATGAGCAAAGG - Intronic
1034076536 7:148237050-148237072 CTTGAAAGACAGAGGAAGAATGG - Intronic
1034450418 7:151134365-151134387 TGGGAGAGACAGATGAAGACTGG - Intronic
1034663986 7:152799548-152799570 CTGGAGAGACAGTTAAAGATGGG + Intronic
1035421219 7:158730205-158730227 ATGGACAGACAGATGGACAAAGG + Intergenic
1036044084 8:5120198-5120220 CTGGAGAGACAGAGAAGGAATGG + Intergenic
1036091159 8:5667238-5667260 CAGGAGTGACAGATGAACTGTGG - Intergenic
1037986877 8:23295720-23295742 CTGTAGAGACAGAGAAACAAGGG + Intronic
1040738971 8:50548311-50548333 CTGGATAGATATATGAACTAGGG + Intronic
1040800001 8:51329937-51329959 CTGGAGAGCCAGAGGACAAATGG + Intronic
1040937468 8:52796257-52796279 CTGGAAAGCCAGGTGAAGAAAGG - Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1041884905 8:62797496-62797518 CAGGAGACACAGGTAAACAATGG - Intronic
1042917325 8:73888525-73888547 TTAGAGAGACAGTTTAACAATGG - Intergenic
1043677654 8:82978763-82978785 CTGGAGAAGCAGATGAAAATAGG - Intergenic
1044431675 8:92114831-92114853 AGGGAGAGACAGGTGAAGAAAGG - Intergenic
1044799852 8:95942896-95942918 CAGGAGAGTCACTTGAACAAGGG + Intergenic
1044890440 8:96829368-96829390 GTTGAGAGAAAGAGGAACAAGGG - Intronic
1045761278 8:105610805-105610827 CTGGAGAGACAGATTTCCTAAGG + Intronic
1045868092 8:106892413-106892435 CTAGTGAGACTGATGGACAAGGG + Intergenic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047995527 8:130331352-130331374 CTGGAGAGAGAAAGGAACACTGG + Intronic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048825834 8:138424993-138425015 CTGAAGTGACAGATAATCAATGG - Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048915667 8:139180685-139180707 CTCAAGAGACAAATGACCAAAGG - Intergenic
1049930055 9:447644-447666 ATGGAGAAACTGATGAACCATGG - Intronic
1050903920 9:10979703-10979725 CTGGATAGAAAGATTAATAAAGG - Intergenic
1051154765 9:14129220-14129242 CTTTAGAGACAGGTGAAGAACGG + Intronic
1051943457 9:22536924-22536946 CTAGAAAGACAAATGAACACAGG - Intergenic
1052044583 9:23779307-23779329 GTGGGCAGACAGAGGAACAAAGG + Intronic
1053077117 9:35142392-35142414 CTGGGAAGAGAGAGGAACAAAGG + Intergenic
1056117697 9:83457332-83457354 CTGGTGAAAAAGATGAAGAAAGG + Intronic
1056333188 9:85538859-85538881 CCAGAAAGACAGATGAAGAAAGG + Intergenic
1056797818 9:89670654-89670676 CTGGAGAGACAGAGGCACCTAGG + Intergenic
1057706536 9:97398995-97399017 CTGGAGGGGGAGATGGACAAAGG - Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1057868691 9:98701724-98701746 CGGGAGACACACATGAATAAAGG + Intronic
1058703421 9:107619749-107619771 CTGGGCAGACAGAGGAACCAGGG + Intergenic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1060104819 9:120866966-120866988 CTGGAGAGACAGAGGAGCCAAGG + Intronic
1060351021 9:122860132-122860154 CTGGAGAGAAAATTTAACAAAGG + Intronic
1061429728 9:130523536-130523558 CAGGAGAGAGAGAAGAATAAGGG + Intergenic
1061995088 9:134179140-134179162 CTGGAAAGACAGAGGAACACGGG - Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1186042360 X:5494968-5494990 CTGGAGAAACACATGATCACTGG + Intergenic
1187107822 X:16262215-16262237 CTGGGGAGACAGAAAAAAAAAGG - Intergenic
1187653918 X:21447719-21447741 CTGGAGACACAGAAGAGCATGGG - Intronic
1188170917 X:26925039-26925061 CTGTGGAGACAGATAAGCAAAGG + Intergenic
1190375121 X:49781812-49781834 ATGGAGAGACAAATGAACTCTGG - Intergenic
1190643407 X:52502699-52502721 CTAGGGAGACGGATGAAGAATGG + Intergenic
1190774750 X:53543798-53543820 GTGGAGAGACAAATGAATGAGGG + Intronic
1195837350 X:109131939-109131961 CTGGTTAGATAGATGAACAAAGG + Intergenic
1197043310 X:121966655-121966677 CTGAAGAGACAGAGGTAGAAAGG + Intergenic
1198009331 X:132534819-132534841 TTGCAGAGACAAAAGAACAAAGG - Intergenic
1198021286 X:132660699-132660721 ATGGAGAGATAGTTGAACAATGG - Intronic
1198455320 X:136811898-136811920 CTGAAGAGACTTTTGAACAAGGG - Intergenic
1202266369 Y:23022869-23022891 CTGGAGAGCCAGATTATCTAAGG + Intergenic
1202419362 Y:24656612-24656634 CTGGAGAGCCAGATTATCTAAGG + Intergenic
1202451424 Y:25013472-25013494 CTGGAGAGCCAGATTATCTAAGG - Intergenic