ID: 1106347366

View in Genome Browser
Species Human (GRCh38)
Location 13:28892140-28892162
Sequence CCTCAAGGAGTCCAGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106347366 Original CRISPR CCTCAAGGAGTCCAGGAATA TGG (reversed) Intronic
903478070 1:23634156-23634178 CCTTAAGGAAACCAGGAAAAGGG + Intronic
903870941 1:26434395-26434417 TCTCAAGCAGTCCAGGAAATGGG + Intronic
904094242 1:27965398-27965420 CCTCGAGGAGCCCAGAGATAAGG + Intronic
904379169 1:30099836-30099858 CCTCCAGGAGTCCTGGAAAAAGG - Intergenic
909961171 1:81844675-81844697 ACAAAAGGAGTTCAGGAATAGGG - Intronic
909987649 1:82182566-82182588 TATGAAGGAGTCCAGGAACACGG + Intergenic
910194721 1:84628807-84628829 CCTCATGGTGTCCATGAACATGG + Exonic
911484936 1:98493560-98493582 CCTCAAGGAGTTCTGGGATGAGG + Intergenic
912953652 1:114137462-114137484 CCTCAAGAAGCCAAGGAACAGGG + Intronic
914677407 1:149915659-149915681 CCTCCAGGAGTCAAGGAAGAAGG + Intronic
915529430 1:156494790-156494812 CCTCAAGGTCACCAGAAATAAGG + Intronic
917880639 1:179332412-179332434 CCTCTAAGATTCCAAGAATAGGG - Intronic
918181667 1:182089807-182089829 GCTCAAGGAGTCAGGGAGTAGGG + Intergenic
919704558 1:200664154-200664176 TCACAAGGATTCCAGGAACATGG + Intronic
920262273 1:204697015-204697037 CCCCAAGGAGTCCAGGGCTAGGG + Intergenic
920379403 1:205526980-205527002 CATCAACGAGTCCAGGAACTGGG + Intronic
920790675 1:209087198-209087220 ACAAAAGCAGTCCAGGAATAAGG + Intergenic
923248531 1:232157558-232157580 CCTCAAACAGTCAAGGACTAAGG - Intergenic
923909149 1:238420204-238420226 CCTCATGGAGACCAAAAATATGG - Intergenic
923985216 1:239374292-239374314 GCTCAGGGAGTCCAGAGATAAGG + Intergenic
1062996072 10:1868858-1868880 TCTGATGGAGTCCAGGAATCTGG - Intergenic
1064266592 10:13830343-13830365 CCAGAAGGAGTCAAGGAATTGGG + Intronic
1064463682 10:15558692-15558714 CCTAAAGGAGTGCAGGAACGTGG - Intronic
1066081256 10:31932882-31932904 ACTCAAAGAGTCCAGGAGTGGGG + Intergenic
1067004853 10:42651005-42651027 CCTCAAGGAATTCAGGAAACAGG + Intergenic
1069617105 10:69813308-69813330 CCGCAAGGAGTCAAGGAACCGGG - Intronic
1073192912 10:101664650-101664672 CCAGAAGGAGCCCAGGAAAAGGG + Intronic
1074337012 10:112587838-112587860 CTTCAAACAGTCCAGGAATTTGG - Intronic
1075095443 10:119468043-119468065 CCCCAAGGAGCCCAGGACGATGG - Intergenic
1075125078 10:119693018-119693040 CCTCATGGAAACCTGGAATAGGG + Intergenic
1076093089 10:127705795-127705817 CTTCAGAGAGTACAGGAATAAGG + Intergenic
1080615317 11:33940523-33940545 ACTCAAGGGTTCCAGTAATAGGG + Intergenic
1080639292 11:34149438-34149460 CCTCAAGGGCTCCAGTAAGAGGG + Intergenic
1085448165 11:76615050-76615072 CCACAAGGAGTCCTGAAATATGG - Intergenic
1088423125 11:109670279-109670301 TCTCATGGAATCCAAGAATATGG - Intergenic
1089177322 11:116558177-116558199 GCTAAAGGAGGCCAGGAAGAAGG - Intergenic
1089353149 11:117832734-117832756 CCTCAAGGAGGCCAGGGACTTGG - Intronic
1093768877 12:22997107-22997129 TCTCAAGGAAACCAGGAAAAAGG - Intergenic
1096518251 12:52170235-52170257 CCTCCAGCAGGCCAGGAAGAAGG - Exonic
1098205141 12:68101135-68101157 CCTCAGGGAGGGCAGGAAAATGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102079846 12:110089154-110089176 CTTCCTGGAGTCCAGGACTAGGG - Intergenic
1102979159 12:117227704-117227726 CCTGAGGGGGTCCAGGAAGAAGG + Intronic
1103462990 12:121119907-121119929 CCTCCTGGAGTCCAGGACTAGGG + Intergenic
1104140628 12:125983541-125983563 CCCCTAGGAGTCCAGGAAACGGG - Intergenic
1104708571 12:130968135-130968157 CCACAATGAGTTCAGGTATAGGG - Intronic
1105517064 13:21100353-21100375 CATCAAGGTGTCCAGGAAGCTGG - Intergenic
1106347366 13:28892140-28892162 CCTCAAGGAGTCCAGGAATATGG - Intronic
1107429826 13:40330324-40330346 CCTCAAGGAGTTCTGGGCTAGGG - Intergenic
1110325507 13:74210213-74210235 TCTCTAGGAATCCAGAAATATGG + Intergenic
1112513579 13:100032195-100032217 ATTCAAGGTGTCCAGCAATAGGG + Intergenic
1113413293 13:110108964-110108986 CCTCAAGAGGCCCAGGAATGAGG + Intergenic
1114215884 14:20657607-20657629 CCTCAAGCATTCCAGGGATGTGG - Intergenic
1117299987 14:54415484-54415506 TCTAAAGGAGTCCAGAGATAGGG - Intronic
1117910177 14:60629667-60629689 CCTCAAGGGGTCTAGGACTTGGG - Intergenic
1119774565 14:77240342-77240364 CCTCAAGGAGCCCAGGACCCTGG - Intronic
1120492628 14:85195967-85195989 CCCCAGGGATTCCTGGAATAAGG + Intergenic
1121358824 14:93236350-93236372 CCTCCCGGAGTCTGGGAATATGG - Intergenic
1122138504 14:99648185-99648207 CCTCAAGGAGTGTAGGAACAAGG + Intronic
1124946157 15:34268724-34268746 CCTAAAAGAGCCCTGGAATATGG - Intronic
1125641427 15:41233764-41233786 CCTCATGGAGGACAGGAATTGGG + Intronic
1126594870 15:50375228-50375250 CCTCAAGGAGGCTAGTAAGAGGG - Intergenic
1129953461 15:79612148-79612170 CCTCAAGGAGACCAGCCATTTGG + Intergenic
1131375449 15:91919280-91919302 CATCCAGGAATCCAGGAATCTGG - Intronic
1131863561 15:96681144-96681166 TCTCAAGGACACCAGGAATAGGG - Intergenic
1132934318 16:2473272-2473294 CCTCAGTGGGTCCAGGGATAGGG - Exonic
1135423807 16:22322510-22322532 CCTCAAGGAGCCCAGGACTCTGG - Intronic
1137491723 16:48938587-48938609 CCTCAAATAGTTCAAGAATATGG + Intergenic
1139393595 16:66622093-66622115 CCGCACGGAGTCCAGGGATGTGG - Exonic
1139751709 16:69112930-69112952 CCTCTATGAGACCAGTAATAAGG - Intronic
1140668264 16:77248008-77248030 CCTCAAGCAGTCCATGAAGAAGG - Intronic
1141386057 16:83623433-83623455 CCTCAAGGAGCCCCAGAAGAGGG - Intronic
1144575245 17:16425798-16425820 CCTCAAGGACCCCAGGGCTAGGG + Intronic
1146561647 17:33875075-33875097 CCAAAGGGAGTCCAGGAATGCGG + Intronic
1151396003 17:73823467-73823489 CATCAAGGAGTCCAGGTGTCTGG + Intergenic
1151484055 17:74387545-74387567 CCCCAGGGAGGCCAGGATTAAGG + Intergenic
1151636078 17:75349056-75349078 CTTCAAATAGTCTAGGAATAGGG + Intronic
1156395957 18:36700197-36700219 CCTCAGGGATTCAAGGCATATGG - Intronic
1165472650 19:36012180-36012202 CCTCAGAGAGCCCAGGAATCAGG - Intronic
1166581454 19:43903638-43903660 CCACATGGAGTGCAGTAATAAGG + Intergenic
926395321 2:12435322-12435344 CCTCAAGGAGTCCAGACTCATGG - Intergenic
926727150 2:16007539-16007561 CCTCAAGGAGCCCAGAATTTAGG + Intergenic
926778452 2:16445413-16445435 TCTCAAGGAGCCCTGGACTAAGG + Intergenic
926922135 2:17949574-17949596 CCCCAAGAAGTCCAAGAACATGG - Intronic
926967944 2:18436734-18436756 CCTCAGGGAGTCCAAGAAATGGG + Intergenic
929158813 2:38811504-38811526 CTTCAAGGAAGCCAGGAAGAAGG - Intronic
931621958 2:64219424-64219446 CCTCAAGGATTCCAGGTATCTGG + Intergenic
934779381 2:96960212-96960234 CCTCCTGGAGTCCAGGGATAAGG - Intronic
936687725 2:114848047-114848069 CCCTAAGGGGTCAAGGAATATGG + Intronic
938754744 2:134369257-134369279 CCCCAGGGAGACCAGGAAGAGGG + Intronic
940058452 2:149538216-149538238 CCCAAAGAAGTCCAGGAATGCGG - Intergenic
940331331 2:152478120-152478142 CCCCAGGGAGCCCAGGAACAAGG - Intronic
942133795 2:172905855-172905877 GCTCTAGGAATCCAGGAACAAGG + Intronic
942444664 2:176070158-176070180 CCTCAAGGTGTCCAGGCTCAAGG - Intergenic
944389694 2:199204741-199204763 CCTTAAGAAGTGCAGGAATTTGG - Intergenic
947301146 2:228689683-228689705 CTACAAGTAGTCCAGGAAGAGGG + Intergenic
1168921188 20:1537556-1537578 CATCCAGGAGCCCAGGAACAGGG + Intronic
1169803139 20:9532133-9532155 GCTCAGGGTGTCCAGGAAGACGG + Intergenic
1169871189 20:10250060-10250082 GCTAAAGGAGTCTAGGAATGTGG - Intronic
1173463648 20:43263872-43263894 TCTCAGGGAGTCCAGGTTTAAGG + Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1179575155 21:42303373-42303395 TCTCCAGGAGTCCACGGATATGG - Intergenic
1182411384 22:30189860-30189882 CCTCAGGGAGTCCTGGGAGATGG - Intergenic
951006843 3:17627052-17627074 TCTAAAGTATTCCAGGAATAAGG + Intronic
951317242 3:21203058-21203080 CCTCTAGGAGTGCATGAAGATGG + Intergenic
952530452 3:34257276-34257298 TCTCTAGGCTTCCAGGAATAAGG + Intergenic
955473194 3:59308473-59308495 CCTCAGGGAGGCCAGGTACAAGG + Intergenic
956436094 3:69235897-69235919 CCTCCAGGATTCTAGGAAGAGGG + Intronic
956852131 3:73238826-73238848 CATCAATGAATCCACGAATAGGG + Intergenic
958415348 3:93867428-93867450 CCCCAAAGAGGTCAGGAATAAGG + Intergenic
959195510 3:103175607-103175629 CCCCAAGGAGTCTGGGACTAGGG + Intergenic
959650173 3:108743874-108743896 CCTCAAGGTGTCAAGGCATCAGG - Intronic
960951054 3:122998681-122998703 CCTAAAGGAGGCCAGGAGTCAGG - Intronic
962037322 3:131666062-131666084 CCTTAAGAAGGCAAGGAATACGG + Intronic
964095585 3:152927530-152927552 CATCAAGAGTTCCAGGAATAGGG - Intergenic
964496707 3:157298817-157298839 CCTTAGGGATTCCATGAATATGG - Intronic
968064123 3:195748817-195748839 CTGCAAGGGGTCCAGGAATTAGG - Intronic
971428469 4:26539024-26539046 CCTGAAGGAGCCAAGGAAAATGG + Intergenic
974169655 4:58250218-58250240 TCTCAAGGAGTCCAGGACTAGGG + Intergenic
974296512 4:60006620-60006642 CCTGGAGGAATCCTGGAATAAGG - Intergenic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
979433191 4:120657161-120657183 CCTCATGGAGCTCAGGAATATGG + Intergenic
979531452 4:121772972-121772994 CCTCAAGGAGTCTGGGGCTAGGG - Intergenic
985470963 5:45561-45583 CCTCAAGGATTCCAGATATGAGG + Intergenic
985472332 5:53806-53828 CCTCGCGGAGTCCAGGACTGGGG - Intergenic
985608151 5:870117-870139 CCTCCAGGCGTCCAGCAATGAGG + Intronic
986647486 5:9931801-9931823 CCTGAAGGATTGCATGAATAAGG + Intergenic
992326725 5:75667105-75667127 CTTCAAGGGGCCCAGGAATAGGG + Intronic
992861878 5:80919584-80919606 ACTCAAGGAGGCTAGGAATGGGG - Intergenic
993736532 5:91483267-91483289 CCATAAGTAGTCCAGGACTATGG - Intergenic
997319301 5:132964089-132964111 CCTCAAGAGGTCCAGCAAAAAGG + Intergenic
998097019 5:139401779-139401801 CCTTCAGGAGTCCAGCAAGAAGG - Exonic
998498315 5:142610360-142610382 CCTCTAGGAGTCCAGTAGGAGGG + Intronic
1003009230 6:2410517-2410539 CATCAAGGAGTCCTGAAATTGGG - Intergenic
1004902450 6:20206666-20206688 CCCTAAGGTGTCCAGGAATATGG - Intronic
1006764494 6:36492929-36492951 CCTCAAGGAGTCCAGAAGGGAGG - Intergenic
1011229262 6:85141614-85141636 CCCCAAGGAGTTTAGGGATAGGG - Intergenic
1018427340 6:163695188-163695210 CCTCATGGAGCCCTAGAATAAGG - Intergenic
1020675225 7:11175574-11175596 CCTCAAGGACTCCAGGCACTGGG - Intergenic
1021805904 7:24354647-24354669 CCTCAAGGAGCCCAGCACTAGGG + Intergenic
1023119968 7:36899313-36899335 CCTCAACTAGAGCAGGAATAAGG - Intronic
1024533443 7:50411179-50411201 CCTCAGGGAGTCCAGGGCTCTGG - Intergenic
1026226314 7:68445128-68445150 CCTCATGGAGACAAGGAATTTGG - Intergenic
1026929726 7:74217129-74217151 CCTCCAGAAGTCCAGGCATCTGG + Intronic
1031002145 7:116428288-116428310 CCTCCAGGTGTCCAGAAAGATGG + Intronic
1034325850 7:150231516-150231538 CCTGAAGGGCTCCAGGAAAATGG + Intergenic
1034429862 7:151035859-151035881 CTGCAAGGAGTCCAGGAAACAGG - Intronic
1034767361 7:153737741-153737763 CCTGAAGGGCTCCAGGAAAATGG - Intergenic
1035356965 7:158281725-158281747 CCCCAAGGAGTCCAGGAGCCAGG + Intronic
1039038713 8:33386399-33386421 CCTCAATGAGTCCAGAGAGAAGG + Intronic
1040795478 8:51286217-51286239 GCTAAAGGATTCCAGGAATGGGG + Intergenic
1041033596 8:53763930-53763952 CCCCAAGGAGTCCAGTCTTATGG + Intronic
1045135743 8:99215755-99215777 CTTCTAGGAGTCCAGGATTTTGG - Intronic
1046545695 8:115647824-115647846 TATTAATGAGTCCAGGAATAAGG - Intronic
1050115578 9:2259862-2259884 CCTGGAGGAGCCCAGGAATCAGG + Intergenic
1053109063 9:35441176-35441198 CCTGAAGGAGTTCAGGATTGAGG + Intergenic
1053560081 9:39183270-39183292 CCTCAACCAGACCAGGAATCAGG + Intronic
1053824192 9:42003505-42003527 CCTCAACCAGACCAGGAATCAGG + Intronic
1054137035 9:61435685-61435707 CCTCAACCAGACCAGGAATCAGG - Intergenic
1054606381 9:67183858-67183880 CCTCAACCAGACCAGGAATCAGG - Intergenic
1057826854 9:98378221-98378243 CCTCTAGGAGGGCAGGAAGAGGG + Intronic
1059236486 9:112764649-112764671 CGGCAAGGAGTCCAAGAAGAAGG + Intronic
1059969776 9:119653807-119653829 TCTGAAGGAATACAGGAATATGG - Intergenic
1060282707 9:122225132-122225154 CCTCTGGGAGTCAGGGAATATGG - Intronic
1060730017 9:126031189-126031211 ACGCATGGAGTCCAGGAAAAGGG - Intergenic
1186916311 X:14225924-14225946 CCTCAAAGCTTCCAGTAATATGG + Intergenic
1188607720 X:32053423-32053445 CCTCAAGAAGTATATGAATAAGG + Intronic
1192037157 X:67576196-67576218 CCTCACGGAGAGCTGGAATATGG + Intronic
1192972873 X:76252353-76252375 CATCAAGCCCTCCAGGAATATGG - Intergenic
1193020166 X:76783050-76783072 TCTCAAGGTCTCCAGGAATATGG - Intergenic
1195880749 X:109590334-109590356 CCTCAGGGCAGCCAGGAATAGGG + Intergenic
1197259550 X:124303614-124303636 CCTGAGGGAATCCAGGAAAATGG - Intronic
1200829934 Y:7679862-7679884 CCTCAGGGAGACCAGGAGAAGGG + Intergenic
1201018139 Y:9625191-9625213 CCTCAGGGAGACCAGGAGAAGGG + Intergenic