ID: 1106350213

View in Genome Browser
Species Human (GRCh38)
Location 13:28922631-28922653
Sequence AGGGAGAGCGCAATGACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 1, 2: 27, 3: 64, 4: 277}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106350213_1106350225 27 Left 1106350213 13:28922631-28922653 CCCCCAGTCATTGCGCTCTCCCT 0: 1
1: 1
2: 27
3: 64
4: 277
Right 1106350225 13:28922681-28922703 AGGCGGCCACTGTCAAGAGATGG 0: 1
1: 0
2: 0
3: 14
4: 111
1106350213_1106350222 7 Left 1106350213 13:28922631-28922653 CCCCCAGTCATTGCGCTCTCCCT 0: 1
1: 1
2: 27
3: 64
4: 277
Right 1106350222 13:28922661-28922683 GTGCGTAGATTCTTCAAACCAGG 0: 1
1: 0
2: 0
3: 2
4: 38
1106350213_1106350223 10 Left 1106350213 13:28922631-28922653 CCCCCAGTCATTGCGCTCTCCCT 0: 1
1: 1
2: 27
3: 64
4: 277
Right 1106350223 13:28922664-28922686 CGTAGATTCTTCAAACCAGGCGG 0: 1
1: 0
2: 0
3: 4
4: 87
1106350213_1106350226 28 Left 1106350213 13:28922631-28922653 CCCCCAGTCATTGCGCTCTCCCT 0: 1
1: 1
2: 27
3: 64
4: 277
Right 1106350226 13:28922682-28922704 GGCGGCCACTGTCAAGAGATGGG 0: 1
1: 0
2: 1
3: 4
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106350213 Original CRISPR AGGGAGAGCGCAATGACTGG GGG (reversed) Intronic
906678120 1:47708071-47708093 AGGGGGAGCTCAGTGACTCGCGG - Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909848910 1:80434818-80434840 AGGGAGATCTCAGTGACTGGGGG - Intergenic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
911275545 1:95853729-95853751 AGGGAGAGCCTAAAGCCTGGGGG + Intergenic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912763253 1:112386849-112386871 AGGGAGGGCCCAAAGGCTGGAGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916420815 1:164636091-164636113 AGGGGGTGCCCACTGACTGGAGG - Intronic
916575208 1:166060581-166060603 AGGAAGTGAGCAATGGCTGGCGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
924625367 1:245693014-245693036 CGGGGGAGCGCGAGGACTGGGGG - Intronic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070401595 10:76057583-76057605 AGGGAGAAAGCAATGAAGGGTGG + Intronic
1071913055 10:90257570-90257592 AGGGAGGGCTTAAGGACTGGGGG + Intergenic
1071998317 10:91168585-91168607 AGGGAGAAGGCAATGACTTGAGG + Intronic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081633605 11:44705845-44705867 AGGGAGAAGGCAAGGAGTGGAGG - Intergenic
1081683898 11:45027901-45027923 AGGGAGAGAGCACTGAAGGGAGG - Intergenic
1082772547 11:57219629-57219651 TGGGAGAGGGGAATGACAGGAGG - Intergenic
1083464696 11:62837593-62837615 TGGGAGAGGCCAAGGACTGGAGG - Intronic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1087198014 11:95320105-95320127 AGGAAGAGAGAAATGACTTGAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1091171804 11:133526275-133526297 AGGGAGAGCACCAAGGCTGGGGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095820413 12:46472383-46472405 AGGGTGAGCTCAATGCTTGGTGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096368540 12:51048792-51048814 GGAGAGAGCGCAATGCCTGTGGG - Intronic
1096815118 12:54197004-54197026 AGGCAGAGGGCAATGACAGACGG + Intergenic
1097378130 12:58862005-58862027 AAGGAGAGGGGAATGACTGACGG - Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098982698 12:76974745-76974767 AGGGATAGAGCTGTGACTGGTGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101696530 12:107132491-107132513 AGGCAGAGCTCACTGACTGTGGG + Intergenic
1101973676 12:109336235-109336257 AGGGAAAGGTCTATGACTGGAGG - Intergenic
1102266514 12:111490810-111490832 AGAGAGAGAGAAATGACTGTGGG + Intronic
1103588869 12:121976373-121976395 AGGAAGAGCTCAGTGAATGGAGG + Intronic
1104568470 12:129904531-129904553 AGGGAGAGCGCAAGGATGGCTGG + Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1106379528 13:29223139-29223161 AGGGATAGCCCAAGGCCTGGGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114866158 14:26597806-26597828 TGGGAGAGCGCGAGGGCTGGCGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115990903 14:39148485-39148507 AGGGAGAACGAAATGGCTGATGG + Exonic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1120697322 14:87659044-87659066 AGGGAGAGCACGGTCACTGGAGG + Intergenic
1122252319 14:100448744-100448766 AAGAACAGGGCAATGACTGGAGG + Intronic
1123159021 14:106259350-106259372 AGTGAGAGAGAAATGACGGGAGG - Intergenic
1125409315 15:39388860-39388882 AGGGTGAACGCAATCTCTGGAGG + Intergenic
1127525935 15:59792115-59792137 AGGGAGGGCCTAATGGCTGGGGG - Intergenic
1128708255 15:69852970-69852992 AGGAAGGGCTCAAGGACTGGAGG + Intergenic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130564134 15:84980573-84980595 AGGGAGGGCGGGAAGACTGGCGG + Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133713068 16:8420095-8420117 AGAGAGAGAATAATGACTGGAGG + Intergenic
1136389299 16:29952303-29952325 AGAGAGAGCACATGGACTGGGGG - Intronic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137550333 16:49433211-49433233 AGGGTGAGCTAAATGATTGGTGG + Intergenic
1138561018 16:57801219-57801241 AGGGACATTGCAAAGACTGGGGG + Intronic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140306715 16:73809575-73809597 AGTGAAAGTGCATTGACTGGGGG + Intergenic
1140481640 16:75265668-75265690 GGGGAGAGCGCACCGGCTGGGGG - Intronic
1141429132 16:83961861-83961883 AGGGAGACCACAAGGACTGGGGG - Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1150587447 17:66531661-66531683 AGGGAGACAGCAGTGACAGGAGG - Intronic
1151573402 17:74938525-74938547 AGGGTGTGGGCAAAGACTGGGGG + Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1151745433 17:76009299-76009321 AGGGTGAGCGCGACGAGTGGAGG - Exonic
1151826932 17:76529030-76529052 GGGGGGGGCGCAATGACTGCAGG - Intronic
1152396106 17:80034810-80034832 AGGGTGGGCGCAAAGACTGGGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1153976856 18:10276307-10276329 AGGCATAGCTGAATGACTGGTGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156908839 18:42386850-42386872 AGAGAGATCACAATGACTTGGGG - Intergenic
1158512648 18:58105203-58105225 AAGGAGAGCGCTAGGACTGAAGG + Intronic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160327609 18:77965518-77965540 AGGAAGAGAGCACTCACTGGAGG - Intergenic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1161998525 19:7729471-7729493 AGGGAGAGCCCAATGACGCTTGG - Exonic
1163041821 19:14608376-14608398 AGGGAAATGGGAATGACTGGGGG - Intronic
1163586999 19:18169561-18169583 ATGGAGAGGGCAATGCCCGGAGG - Exonic
1164607900 19:29613169-29613191 AGGGACAGGGCAATGTGTGGAGG - Intronic
1164925072 19:32124159-32124181 AGGGAGAGAGAAAGGAATGGAGG + Intergenic
1165150333 19:33756569-33756591 AGGGTGAGGGAAATGTCTGGAGG - Intronic
1165471850 19:36008668-36008690 AGGGACAGGGCCATGGCTGGGGG + Exonic
1166935366 19:46329360-46329382 AGGGAGGGCTCAAGGGCTGGAGG - Exonic
925115313 2:1373744-1373766 AGGGAGAGCGGAGAGACTGTGGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
931716988 2:65037151-65037173 AGAGAAAGGGAAATGACTGGGGG + Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
933351545 2:81158734-81158756 ATGGAGAGAGCAGTGACTGCGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938930492 2:136082410-136082432 AGGGTGAGTGCAAGGACAGGAGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941274811 2:163478027-163478049 AGGGACATTTCAATGACTGGCGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
944096050 2:195968931-195968953 AGGGACAGCGTAGTGACTGGGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
948892671 2:240915016-240915038 AGGGAGGGCGCAGGGACTGTAGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169229064 20:3874930-3874952 AGGGTGAGCCCAATGGCTAGAGG + Exonic
1169933523 20:10858622-10858644 AGGCACAGCACAATCACTGGAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1174427357 20:50441589-50441611 AGGGAAAGTGCAAAGACTGTGGG - Intergenic
1174531621 20:51219112-51219134 AGGGAGACAGAAATGACTGCTGG + Intergenic
1175483249 20:59326546-59326568 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1175483314 20:59326811-59326833 AGGGAGAGGGCACTGATGGGTGG + Intergenic
1177969959 21:27777480-27777502 AGCGAGAGCACAGTGCCTGGGGG + Intergenic
1178758609 21:35378253-35378275 CAGGATAGTGCAATGACTGGAGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1183899473 22:40994105-40994127 AGGGAAGGTGAAATGACTGGGGG + Intergenic
1185058055 22:48591559-48591581 AGGGAGTGGGCACTGACCGGGGG + Intronic
949511873 3:4773261-4773283 AGGCAGAGGGCATTGCCTGGTGG + Intronic
950228886 3:11259001-11259023 AGGGAGTGAGCCATAACTGGTGG + Exonic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951255053 3:20439051-20439073 AAGGAGAGGACAATGACTGGGGG + Intergenic
951263291 3:20537459-20537481 GGGAAGAGTTCAATGACTGGGGG - Intergenic
953774560 3:45804123-45804145 AGGGAGAGAGGAATGACTGACGG - Intergenic
953899494 3:46831706-46831728 AGGGAGATTGCACTGCCTGGGGG - Intronic
954584244 3:51720166-51720188 AGGGAGAGCCAAAGGCCTGGGGG + Intergenic
955130163 3:56158005-56158027 AGGGAGAGGGCAGGGACTGCTGG + Intronic
957087239 3:75692392-75692414 ACGGAGAGCACAAGGACTGGAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
961569276 3:127786477-127786499 AGGGAGAAGGCAATGACTGTGGG + Intronic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962370590 3:134817883-134817905 GGGGAAAGCGCAATGACTGGCGG + Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964827941 3:160850492-160850514 AGGGAGAGGGGCAGGACTGGAGG - Intronic
965415299 3:168385161-168385183 AGGGAGAGCGCACTGAATGGGGG - Intergenic
965427849 3:168549695-168549717 AGAGACAGAGTAATGACTGGAGG - Intergenic
967585177 3:191204602-191204624 AAAGAGACCGCAATGGCTGGAGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968972655 4:3804010-3804032 AGGGTGACAGCAATCACTGGTGG - Intergenic
970442356 4:16092789-16092811 AGAGAGAGCACAGTGGCTGGGGG + Intergenic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972928330 4:44040054-44040076 AGGAAGAGCATAGTGACTGGGGG + Intergenic
973073925 4:45899551-45899573 AGGAAGAGCAAAATGACTGTGGG + Intergenic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
976947531 4:90788916-90788938 AGGGAAAGAGGAATGCCTGGGGG - Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
978976995 4:114889712-114889734 AGGGAGACAGCCTTGACTGGGGG + Intronic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
982899626 4:160981601-160981623 AGGCAGAGCACAGAGACTGGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984825916 4:183924473-183924495 AGAGAGAGGGCACTGCCTGGGGG - Intronic
984837090 4:184032344-184032366 AGAGAGAGAGAAAAGACTGGAGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989135819 5:38153675-38153697 AGGAAGAGAGAAATGACTGGTGG + Intergenic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993649974 5:90508409-90508431 ATGGAAAGGGAAATGACTGGAGG - Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994226050 5:97253171-97253193 AGGGAAAGTACAATTACTGGGGG + Intergenic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995047634 5:107669972-107669994 AGAGAGAGCGCACGGGCTGGGGG - Intronic
995195502 5:109362644-109362666 AGGAAGAGGTCACTGACTGGAGG + Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
997739086 5:136238021-136238043 AGGCAGAGTGCAATGAGTGAAGG - Intronic
997786352 5:136717546-136717568 AGGGAGAGAGGAAAGAATGGAGG - Intergenic
998182362 5:139954366-139954388 AGGAAGAATGAAATGACTGGAGG + Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999435385 5:151559454-151559476 AGGAAGAGCACAAGGACTAGGGG + Intronic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1003038023 6:2662040-2662062 TGGGAGAGAGGAATGACTGAAGG + Intergenic
1003092767 6:3118381-3118403 AGCGAGGGCGCTATGGCTGGCGG + Intronic
1003357342 6:5386119-5386141 AGGGAGAGCTCTATTCCTGGGGG + Intronic
1003410088 6:5854447-5854469 AGGGAGAGAGCAAAGAGGGGTGG + Intergenic
1004425334 6:15503241-15503263 AGGCAGAGTGCAATGAGTGGAGG - Intronic
1006165423 6:32061789-32061811 AGGGAGAAGGCTATGACTAGGGG + Intronic
1006582747 6:35086216-35086238 AGGGATGGCGCAGTTACTGGGGG - Intronic
1006670174 6:35725498-35725520 TGGGAGAGAGAAAGGACTGGGGG + Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010261663 6:73824228-73824250 AGAGGGAGGGCAATGGCTGGGGG - Exonic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1014785562 6:125614621-125614643 ATGGAGAGGGAAATGACTGTAGG - Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015937140 6:138415428-138415450 CAGGGGAACGCAATGACTGGTGG + Exonic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1019679461 7:2337627-2337649 AGACAGAGAGCAATGCCTGGAGG + Intronic
1019770811 7:2882764-2882786 AGGGGGAGCGTAATGATTTGTGG + Intergenic
1021836901 7:24686045-24686067 AGGGAGAGCATAATTTCTGGGGG - Intronic
1021922978 7:25505713-25505735 AGGGACAGCACAATGACTGTAGG + Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022702671 7:32776297-32776319 AGGCAGAGCGCACAGCCTGGAGG + Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022906901 7:34866424-34866446 AGGCAGAGCGCACAGCCTGGAGG + Intronic
1023789107 7:43737735-43737757 AGGGAGGGCCTAAAGACTGGGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024628447 7:51228329-51228351 AGGTAGCACTCAATGACTGGTGG + Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027138126 7:75638986-75639008 AGGGAGGGCGCCAGGGCTGGGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029187293 7:98748303-98748325 AGGGAGAGAGGAAGGAATGGGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031560825 7:123235927-123235949 AGGGAGACCACAATGACCAGGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034026271 7:147707991-147708013 GGGGAGAGAGCCAGGACTGGTGG + Intronic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035138980 7:156738175-156738197 AGGGAGAGCACAACAAATGGGGG + Intronic
1036457217 8:8920261-8920283 AGGGAGAGAGGGATGAATGGAGG + Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1041600441 8:59711387-59711409 AGGGAGAGCTCAAGATCTGGTGG - Intergenic
1042162520 8:65911820-65911842 AGGGAGTGCACAATGACTAGAGG + Intergenic
1042947571 8:74170484-74170506 AGGGATAGCGCAGTCTCTGGAGG + Intergenic
1043042958 8:75284823-75284845 AGGCAGAGTGAAATTACTGGGGG - Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043432033 8:80204581-80204603 AGGAAGAGCTCAAAGACTGAAGG + Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1050694029 9:8259636-8259658 AGGGAGAAAGCAATGATTTGTGG + Intergenic
1051047085 9:12888238-12888260 AGGGAGAGCATAATTACTGGGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053285730 9:36848498-36848520 AGGGAGAGCCCGATGACAGTGGG + Intronic
1053495596 9:38546079-38546101 AGAGAGAGCGCATTCAGTGGTGG - Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1055167393 9:73213406-73213428 AGAGAGAGAGAGATGACTGGTGG + Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059565492 9:115379884-115379906 AGGGAGGGCCCAAAGGCTGGGGG + Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1061993588 9:134173184-134173206 AGGGAGTGCGGAATGACTTTGGG + Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186725081 X:12349002-12349024 AGGGAGAGCTCCATAAATGGGGG + Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1188112792 X:26212034-26212056 GGAGAGAACGCAGTGACTGGAGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1188974775 X:36659978-36660000 AAGGAGAGCACAGAGACTGGGGG + Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1190245275 X:48686783-48686805 AGGGAGAGCGGACCCACTGGAGG - Exonic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194257614 X:91653493-91653515 AGAGAGAACACAATGACCGGAGG - Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195997105 X:110742218-110742240 AGGGAGGGCGCTATGTCTGATGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196532642 X:116806793-116806815 AGAGACAGCACAGTGACTGGGGG - Intergenic
1196688839 X:118536961-118536983 AAGGAGAGCCGAATGACTAGGGG + Intronic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198134810 X:133738313-133738335 AGGGAGAAAGCAATGACAGTGGG - Intronic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199277519 X:145963920-145963942 AGGGACAGCGTAGTGACTGAGGG + Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic
1201146312 Y:11067165-11067187 AGGGAGAGGGCAAGGAAGGGAGG + Intergenic
1201760901 Y:17537086-17537108 AGGAAGAGCACAATGACTGAAGG - Intergenic
1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG + Intergenic