ID: 1106351034

View in Genome Browser
Species Human (GRCh38)
Location 13:28930838-28930860
Sequence TGTTACGTATAGGATTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106351028_1106351034 -3 Left 1106351028 13:28930818-28930840 CCTATTAGTAACCCTAGAGCTGT 0: 1
1: 0
2: 0
3: 3
4: 100
Right 1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1106351025_1106351034 22 Left 1106351025 13:28930793-28930815 CCCAGCACACCAGAGGGAGGACA 0: 1
1: 0
2: 2
3: 19
4: 205
Right 1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1106351026_1106351034 21 Left 1106351026 13:28930794-28930816 CCAGCACACCAGAGGGAGGACAT 0: 1
1: 0
2: 0
3: 14
4: 200
Right 1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1106351024_1106351034 23 Left 1106351024 13:28930792-28930814 CCCCAGCACACCAGAGGGAGGAC 0: 1
1: 0
2: 1
3: 31
4: 245
Right 1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1106351027_1106351034 13 Left 1106351027 13:28930802-28930824 CCAGAGGGAGGACATTCCTATTA 0: 1
1: 0
2: 0
3: 10
4: 103
Right 1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106351034 Original CRISPR TGTTACGTATAGGATTTGTG GGG Intronic
902712268 1:18248703-18248725 TGTTAAGTAAAGGAATGGTGTGG - Intronic
907923008 1:58930631-58930653 TGTTACATATTGTATATGTGGGG - Intergenic
908367828 1:63444672-63444694 TATTACATATAGGATTTATAAGG + Intronic
908968089 1:69790852-69790874 TGTTACGAATAGTCTTTGTAAGG + Intronic
912462623 1:109846626-109846648 AGTTACGTATAAATTTTGTGGGG - Intergenic
915749221 1:158189199-158189221 TATTACCTGTGGGATTTGTGTGG + Intergenic
917261669 1:173176172-173176194 TTTTACGGATATGATTTGTTAGG - Intergenic
919965519 1:202519859-202519881 TGTTGCGTCTGGGACTTGTGTGG + Intronic
921820791 1:219614376-219614398 TGTTAACTCTAGGTTTTGTGTGG - Intergenic
922997142 1:229973189-229973211 TGTCACCTGGAGGATTTGTGGGG - Intergenic
1064645807 10:17458638-17458660 TGTAACGTTAAAGATTTGTGAGG + Intergenic
1067202330 10:44184310-44184332 TTTTATGTATAAGAATTGTGTGG - Intergenic
1067237352 10:44462240-44462262 TGTAAAGGAGAGGATTTGTGTGG - Intergenic
1070036174 10:72726839-72726861 TGTTAGTTATAGGATTTTTCTGG + Intronic
1083872963 11:65501879-65501901 TGTTACGGTTGGGATTGGTGGGG + Intergenic
1086362857 11:86077348-86077370 TATTACTTACAGGATTTGAGAGG - Intergenic
1086494827 11:87391793-87391815 TGTTTTGTTGAGGATTTGTGTGG - Intergenic
1090960821 11:131555216-131555238 TGTTATGTTTAGGATGTGTATGG - Intronic
1098829831 12:75348670-75348692 TGTTACGTACATAATTTGTTTGG - Intronic
1099560597 12:84169462-84169484 TGTGAGGCATAGGATTTGTTGGG - Intergenic
1102860400 12:116331247-116331269 TGCTTCCTATGGGATTTGTGAGG + Intergenic
1103841833 12:123871353-123871375 TGTTTTTTATGGGATTTGTGGGG + Intronic
1104160354 12:126173433-126173455 TGTTACTTTTAGCATTTGTTTGG + Intergenic
1106351034 13:28930838-28930860 TGTTACGTATAGGATTTGTGGGG + Intronic
1109342955 13:61085037-61085059 TTTTGTGTACAGGATTTGTGAGG + Intergenic
1109419664 13:62095036-62095058 TGTCATGTATAGGATTAATGCGG + Intergenic
1110281654 13:73700500-73700522 TATTATGCATAGGATTTTTGGGG - Intronic
1111513863 13:89301092-89301114 TCTTGCATATAGGATTTGAGGGG - Intergenic
1118894963 14:69938270-69938292 TGCTATGTTTAGAATTTGTGTGG + Intronic
1121868495 14:97385329-97385351 TGTTATGTAGAGTATATGTGTGG + Intergenic
1124946787 15:34275328-34275350 TGTTAGGTATAGTATTACTGTGG - Exonic
1128441085 15:67709181-67709203 TGCCACATATGGGATTTGTGTGG + Intronic
1128846716 15:70904788-70904810 TGTTATGTGTAGGATTAATGTGG + Intronic
1133457173 16:5952744-5952766 TGTTACAGAAATGATTTGTGTGG + Intergenic
1133490953 16:6267403-6267425 TGTTCCTTATAGGACTTGAGGGG + Intronic
1142064805 16:88055603-88055625 TTTTACGTGTAGGATTTTTTTGG + Intronic
1145400628 17:22529227-22529249 TGTTACGTACAGGATACGTAGGG - Intergenic
1147632451 17:41940865-41940887 TGTTAAGTTTAGGATTCCTGTGG - Intronic
1149535758 17:57432227-57432249 TGTGACGTAGAGGGTGTGTGAGG + Intronic
1151005313 17:70429392-70429414 TGTTAGCTATAGGATTTTTGTGG - Intergenic
1153826076 18:8876080-8876102 TGTTCCAGAAAGGATTTGTGGGG - Intergenic
925225619 2:2182018-2182040 TGTTACATATGGGAGTTGGGAGG - Intronic
926938388 2:18110066-18110088 TGTTTCGTGTAGGAAATGTGAGG - Intronic
936924967 2:117727342-117727364 TGTTAGGTGTAGGCTCTGTGGGG - Intergenic
941524453 2:166589303-166589325 TTTTAATTTTAGGATTTGTGGGG + Intergenic
942288158 2:174442537-174442559 TGTTAATTATATAATTTGTGAGG - Intronic
946839157 2:223802634-223802656 TGGTGCGTTTGGGATTTGTGCGG - Intronic
1169983536 20:11414958-11414980 TGCTAGGTATGGGATTTTTGTGG + Intergenic
1178759421 21:35386534-35386556 TGTTATGTAGATGGTTTGTGAGG + Intronic
1179395186 21:41033257-41033279 TGTTTAGTTTAGGATTTGTAGGG + Intergenic
1179504194 21:41829303-41829325 TGTTGAGTATATTATTTGTGTGG - Intronic
955029792 3:55205061-55205083 TTTGACTTATAGGATTAGTGAGG - Intergenic
955561320 3:60194129-60194151 TGTTCCGTTTAGGATTTCTTTGG - Intronic
956045860 3:65195166-65195188 TGTTACTTATGTGATTTTTGAGG - Intergenic
960342725 3:116494981-116495003 TGTTAGCTATAGGGTTTCTGAGG - Intronic
960757482 3:121031991-121032013 TGCTAAGTATAAGATTTTTGTGG + Intronic
964457861 3:156887499-156887521 TGTTATGTAGATGTTTTGTGTGG + Intronic
966048197 3:175578982-175579004 TGTCACTTATAGTATCTGTGTGG + Intronic
972318363 4:37948737-37948759 TGATACGTACAGGTTTTTTGGGG - Intronic
974157954 4:58099155-58099177 TGTTACGTATATATTTTGTGTGG - Intergenic
975338021 4:73203830-73203852 TGGAACGTATTGGATTTGTAAGG - Intronic
979158911 4:117433175-117433197 TGTTAGCTGTAGGTTTTGTGTGG + Intergenic
980747998 4:137046228-137046250 GGTAACGTAAAGGATTTTTGGGG + Intergenic
981777292 4:148384501-148384523 TGATATGCATAGTATTTGTGGGG - Intronic
993444973 5:88000649-88000671 TTATACGCATTGGATTTGTGAGG + Intergenic
997575639 5:134974845-134974867 TGTTAGGTATAGGACTTGGCAGG + Intronic
1010088837 6:71954322-71954344 TGTTATGTAGATGATTTGAGAGG - Intronic
1017509342 6:155099694-155099716 TGTTATATTTAGGATTTGTCTGG + Intronic
1018490706 6:164289854-164289876 TGTTATGTATGTTATTTGTGGGG - Intergenic
1028075124 7:86503080-86503102 TGTGACTTAGAGTATTTGTGGGG - Intergenic
1031827830 7:126588587-126588609 TGTGACACATAGGATTTATGGGG + Intronic
1032629691 7:133635313-133635335 TGTTATTTGTGGGATTTGTGGGG + Intronic
1032967142 7:137111291-137111313 TGTTACATCTAGGACTTGTGTGG - Intergenic
1038559470 8:28559110-28559132 TATTAAGTAGAGGATTTCTGAGG + Intronic
1043229327 8:77781008-77781030 TGTAAGATATAGCATTTGTGTGG + Intergenic
1047997693 8:130352398-130352420 TCTTACGCATAGGATTTCTGTGG - Intronic
1055681130 9:78716685-78716707 AGATGAGTATAGGATTTGTGAGG + Intergenic
1189418502 X:40834778-40834800 TTTTAAGTATGGGATTTGTAAGG + Intergenic
1189455451 X:41184103-41184125 TGTTAGATATAGCACTTGTGAGG - Exonic
1189551675 X:42099837-42099859 TGTCAGCTATATGATTTGTGGGG + Intergenic
1193555034 X:82943294-82943316 TTTTAGATATAGAATTTGTGGGG + Intergenic
1193679323 X:84498980-84499002 TGTGACGTATAGTAGCTGTGTGG + Intronic
1196033282 X:111114697-111114719 TATGACGTAGAGGATTTGTCAGG + Intronic
1196854777 X:119972553-119972575 TGTTAATTGCAGGATTTGTGGGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic