ID: 1106352847

View in Genome Browser
Species Human (GRCh38)
Location 13:28950693-28950715
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1074
Summary {0: 18, 1: 64, 2: 156, 3: 308, 4: 528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106352842_1106352847 27 Left 1106352842 13:28950643-28950665 CCAGTCAGTGGAGCAGTCAGAAC 0: 53
1: 121
2: 221
3: 286
4: 411
Right 1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG 0: 18
1: 64
2: 156
3: 308
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
901991068 1:13114385-13114407 AATTAGATGGGCATGGTTGAAGG - Intergenic
902165433 1:14567314-14567336 TCTTATATTGTTGTGGTTCATGG + Intergenic
903561129 1:24228708-24228730 TATTATATGGGCCCGGTTCGTGG + Intergenic
903598033 1:24511568-24511590 TCTTATATGGGTGCAGTTCATGG + Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904580898 1:31543580-31543602 TCTTGTATGGGTGTGGTTTATGG + Intergenic
904665409 1:32116956-32116978 TCTTATATGACCATGGCTCATGG + Intronic
904777012 1:32915876-32915898 TCTGATATGTGCGTGGTTCATGG + Intergenic
904862958 1:33553373-33553395 TTTTATGTGTGCATGGTTCATGG - Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906269846 1:44468030-44468052 TCTTATATGAGTGTGGTTCATGG + Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
906665472 1:47618417-47618439 GCTTAGAGGGGCATGGCTCAGGG + Intergenic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
908221512 1:62011502-62011524 TTTTATATGGGCACAGTTTATGG + Intronic
908340786 1:63176714-63176736 TCTTATATGGGTGCTGTTCATGG + Intergenic
908473124 1:64463865-64463887 TATTATATGGGCATGGTGGCAGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909220357 1:72951435-72951457 TCTTATATGGCCACAGTTCATGG + Intergenic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909802129 1:79822676-79822698 TCTTATATGGGCACAGGACAGGG + Intergenic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
909964320 1:81888972-81888994 TCTGGAATGGGCATGATTCATGG - Intronic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910545735 1:88415331-88415353 TCTTACATGAGCACAGTTCATGG + Intergenic
910918322 1:92315305-92315327 TTTTATGTGGGCTTGGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912731483 1:112110441-112110463 TCTTCTATGGGTGTGGTTCATGG + Intergenic
913097576 1:115534173-115534195 TCTTATCTTGTCATGCTTCAAGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
914776284 1:150738748-150738770 TCTTATATGCACGTGGCTCATGG - Intronic
915032189 1:152890423-152890445 TCGTCTATGGGCACAGTTCATGG + Intergenic
915071381 1:153272107-153272129 TCTGAGATGGGCCTGGTGCATGG + Intergenic
915600005 1:156916387-156916409 TGTTATATGGGTGCGGTTCATGG - Exonic
916191597 1:162184241-162184263 TCTCATATGGGCACAGTTTAAGG + Intronic
916553147 1:165869127-165869149 TTTTATATGGGCGTGGTTGGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353522 1:174102855-174102877 TCTTATATGAGCGTGGTTGGTGG - Intergenic
918132659 1:181643381-181643403 TCCAATATGGGCAGGGCTCAGGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918632537 1:186735195-186735217 TCTTATATGGGAGTGGCTCATGG + Intergenic
918849552 1:189668737-189668759 TCTTATATGGGCAAATTACATGG - Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919217251 1:194574643-194574665 TTTTATATGGGTGTGATTCATGG - Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919487887 1:198166688-198166710 TTTTATTTGGACATGATTCATGG + Intronic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
921761546 1:218921034-218921056 TCTGATGTGGGCACAGTTCATGG + Intergenic
922279650 1:224111602-224111624 TCTTATATGGGTATGATTGGTGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923717821 1:236440769-236440791 TCTTATATGGGTGCAGTTCATGG - Intronic
923763147 1:236866341-236866363 TCTTCTATGGGTGTGGTTCATGG - Intronic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924499861 1:244627216-244627238 TCTTATATGGTCGCAGTTCATGG + Intronic
924661830 1:246026631-246026653 TCTCATATGGGCACTGTTCATGG - Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
924833367 1:247622318-247622340 TCTTATATGAGAACAGTTCATGG - Intergenic
1062890238 10:1054020-1054042 TCTTATATAGGGGTGGTTCATGG + Intronic
1063247054 10:4232069-4232091 TCTCATATGGGCACAGTTCATGG - Intergenic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064191920 10:13214089-13214111 ACTTATATGGGCACAGTTCCTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1064851426 10:19713315-19713337 TCTTATCTGGATATGGTTCCAGG - Intronic
1064868622 10:19911146-19911168 TATTATATGGTCTTGGATCAAGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1065413699 10:25460975-25460997 TCTTATGTGGGTGCGGTTCATGG - Intronic
1065699957 10:28415260-28415282 TCTTATATGGTATTGATTCATGG - Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1069283329 10:66682718-66682740 TGTTATATGGGTATATTTCATGG + Intronic
1069398184 10:68012580-68012602 TCTTATATAGGTAAGGTTCATGG + Intronic
1069480833 10:68780801-68780823 TCTTCTATGGGCACAATTCAAGG - Intronic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070420801 10:76235258-76235280 TCTTCTATGAGCATGATTCATGG + Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071222055 10:83478965-83478987 TCTTGTATGGGCACAATTCATGG - Intergenic
1071663014 10:87524819-87524841 TCTTATATGGGTGGGGTTCATGG + Intronic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074210692 10:111331458-111331480 TCTTATATGGGTGTAGTTCATGG - Intergenic
1074905275 10:117856916-117856938 TGTTATATGGGTATGGCTCATGG + Intergenic
1075144883 10:119873989-119874011 TCTTATATGGGCAAAACTCAAGG + Intronic
1075168234 10:120088645-120088667 TCTTCTATGGACAGGGTCCATGG - Intergenic
1075490729 10:122866682-122866704 TGTTATAGGGTCATGATTCATGG - Intronic
1075751302 10:124773673-124773695 TCTTACGTGGGCACAGTTCATGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076808202 10:132870159-132870181 TCTCATATGGGCGTGGCTGATGG - Intronic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079093057 11:17494177-17494199 CCTTATCTGGCCCTGGTTCAGGG + Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1079832449 11:25285333-25285355 TCTTATAAAGTCATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080656865 11:34265177-34265199 TCTTATATGCTCAGGCTTCAAGG - Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081186357 11:40047140-40047162 TCTTATATGGACACAGTTCATGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1082686703 11:56246721-56246743 TCCTATATGGGCACAGTTCATGG + Intergenic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1083487869 11:62994959-62994981 TCTGACGTGGGCATGGTCCAGGG + Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1084668161 11:70588045-70588067 TCTTATATGGGTACAGTTCATGG - Intronic
1085270447 11:75266971-75266993 TCCTAAATGGACATGTTTCATGG - Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085530084 11:77187103-77187125 TATTCTATGGGCACGATTCATGG + Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091515590 12:1177600-1177622 TCTCATACGGGCAGAGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093149911 12:15608294-15608316 TCTTGTCAGGGCATGGTTCTAGG - Intergenic
1093252536 12:16825071-16825093 TCTTACATGGGCACAGATCATGG - Intergenic
1093427530 12:19045300-19045322 TATTATATGGGCATAGCTCATGG - Intergenic
1093435161 12:19128450-19128472 TCTTACATGGGCTCAGTTCATGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093691166 12:22110818-22110840 TCTTACATGGGCACATTTCATGG + Intronic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1094442657 12:30496052-30496074 CCTTATGTGGGCATAGTGCAAGG + Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1096434864 12:51580997-51581019 CCTTGTATGGGTATGGTTCGTGG - Intergenic
1097206509 12:57326064-57326086 TCTTACATGGGCACAGTTCCTGG - Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1097758450 12:63433755-63433777 TGTTATAGGGGAATGGTTCATGG - Intergenic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098575803 12:72040842-72040864 TCTTATATAGGTGTGATTCATGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1098921784 12:76309258-76309280 TCTTCTACGGGCATGGATCATGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099218345 12:79880995-79881017 TCTTCTATGAATATGGTTCATGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100117506 12:91325252-91325274 TTTTATATGAGTGTGGTTCATGG + Intergenic
1100241918 12:92718265-92718287 CCTGATATGGGCATGGTGCAAGG + Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1100618720 12:96251240-96251262 TCTTATACAGGTGTGGTTCATGG - Intronic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1100791202 12:98132123-98132145 TCTCATATGAGCACAGTTCATGG + Intergenic
1101562150 12:105867048-105867070 TCTTCTACGGGCACAGTTCATGG - Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1103877979 12:124143616-124143638 TCATATATGAGGCTGGTTCACGG - Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104991949 12:132630078-132630100 TCTTCTATGCGCACGGTTCATGG + Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1105780048 13:23697639-23697661 TCTTATATGGGGTTAGTTCATGG - Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1107257893 13:38452449-38452471 ACTGATATGGGCATAGTTCATGG - Intergenic
1107260656 13:38486834-38486856 TCTGTTCTAGGCATGGTTCAGGG + Intergenic
1107898026 13:44985659-44985681 TCTTATATGGCCACGATTCATGG - Intronic
1107982978 13:45751105-45751127 TCTTCTAGGGCCATGTTTCAGGG + Intergenic
1108181398 13:47843376-47843398 CCATCTATGGGCATGGTTCATGG + Intergenic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1108938581 13:55919191-55919213 TCTTATAGGGGTACAGTTCATGG - Intergenic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1110746240 13:79056836-79056858 TCTTGTATGGGCACAATTCATGG - Intergenic
1111163555 13:84427246-84427268 TCTTATATAAGCATGGTTCCTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111365963 13:87245512-87245534 TCTTATATGGGCAGAATTTATGG - Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1111956793 13:94767806-94767828 TCTTATATAGGTATAGCTCATGG + Intergenic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112978902 13:105356679-105356701 TCTTCTAAGGTCATGGTTCATGG - Intergenic
1113045146 13:106147408-106147430 TCTTATATGGCCAGGGCACAAGG + Intergenic
1113057153 13:106281200-106281222 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114763929 14:25349139-25349161 TCTCATATTGGCAGGGTTCTTGG - Intergenic
1114950053 14:27739041-27739063 TCTCATATGGGCACTATTCATGG - Intergenic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115019000 14:28651973-28651995 TCTTTTATGGGTGTGGTTTATGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115486796 14:33918224-33918246 TCTTATATGGGCACAGTTTTTGG - Intergenic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115740789 14:36385713-36385735 TTTTATATGGGCACAGTTCATGG - Intergenic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1116476203 14:45342686-45342708 TCTTATATTGGAGTGGTTCTTGG + Intergenic
1116607184 14:47015157-47015179 TCTTTTATGGGTGTGGTTCATGG + Intronic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1117269569 14:54128401-54128423 TCTTATATGGGTATGATACATGG - Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118518062 14:66548505-66548527 TATTATATGGACACAGTTCATGG - Intronic
1119145151 14:72305598-72305620 TCTTATACAGGTGTGGTTCATGG - Intronic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121165568 14:91793649-91793671 TCTTATATAGGTGTGGTTCGTGG - Intronic
1121461458 14:94081747-94081769 TCTTATATGGGCACAGCTCATGG - Intronic
1121511851 14:94518543-94518565 CCTTTTATGTGCAAGGTTCAAGG - Intergenic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122522702 14:102356789-102356811 TTATATATGCACATGGTTCATGG - Intronic
1124397157 15:29312646-29312668 CCTTATATGGGCACAGTTCATGG - Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124639254 15:31385629-31385651 TCTTATATGGAAGTGGTTCATGG - Intronic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1124950328 15:34312929-34312951 TCTTCTGTGGGCACAGTTCATGG - Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1125870618 15:43098228-43098250 TCTTTTATGGATGTGGTTCATGG + Intronic
1125979427 15:43987006-43987028 TCTTCTATGTGTGTGGTTCATGG - Intronic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126391690 15:48162792-48162814 TTTTATTTGGGCACGGTTGATGG - Intronic
1126714271 15:51497644-51497666 TCTTTTATGCACATAGTTCAGGG - Intronic
1126939348 15:53749380-53749402 TCTTATATGGGCATAATTTATGG - Intronic
1127025441 15:54800156-54800178 TCTTATATAGGCAAGGTTCGTGG - Intergenic
1127081438 15:55384255-55384277 TCTTTCATAGGCACGGTTCATGG + Intronic
1127307592 15:57723329-57723351 TCTGATAGGGGAATGGTTCATGG - Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1127600383 15:60529979-60530001 TCTTAAATGGACAGGGTTCTAGG - Intronic
1127724884 15:61739913-61739935 ACCTATATGAGCATGGTTTATGG + Intergenic
1128189954 15:65682928-65682950 TCTTATATGGGAACAGTTCATGG + Intronic
1128344758 15:66846532-66846554 TATTATCTGGGCATGGTGCTGGG - Intergenic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129088035 15:73118078-73118100 TCTTATCTGGGCTTTATTCATGG + Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129289822 15:74556345-74556367 TCTTATATGGGTGTGATTCTAGG + Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1130781975 15:87049422-87049444 TCTTATGTGGGCATGAGTGATGG + Intergenic
1131169738 15:90169090-90169112 TCTTGTATGGGCCCGGTTCATGG + Intronic
1131404433 15:92152787-92152809 ACTTACCTGGGGATGGTTCATGG - Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132382940 15:101379214-101379236 TGGAATATGGCCATGGTTCAGGG - Intronic
1132420998 15:101668417-101668439 TTTTAAATGGGTATAGTTCATGG + Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1133512993 16:6478804-6478826 TCTTATATGGGCACAGTTTTTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1137234136 16:46599473-46599495 TCTTTTATGGATGTGGTTCATGG + Intronic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142908774 17:3069205-3069227 TCTTATGTGGGTGTGGTCCATGG + Intergenic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1142925792 17:3235040-3235062 TCTTATGTGGGTGTGGTCCATGG - Intergenic
1142953035 17:3499663-3499685 TCTCACATGGGCACGATTCATGG - Exonic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1144324461 17:14165447-14165469 TCTTTTATGGGCACGGCTTATGG - Intronic
1144514082 17:15903240-15903262 TTTTATTTGAGCATGGTCCAAGG - Intergenic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146115510 17:30134218-30134240 TTTTATCTGGGCATGGTACATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1148962528 17:51405418-51405440 TCTTTTATGAGCTTGGTTAATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149192085 17:54075082-54075104 TTTTATATGGGCAAGGGTCATGG - Intergenic
1149299404 17:55290511-55290533 TCTTATATGGGTGTGGCTCATGG - Intronic
1149378112 17:56065721-56065743 TCTCATATAGTGATGGTTCATGG + Intergenic
1149803093 17:59588991-59589013 TCTTATATGGGTCTGTTTCTGGG + Intronic
1149843394 17:59986489-59986511 TCTTATATGGGTCTGTTTCTGGG - Intergenic
1150468150 17:65412882-65412904 TCTTATATGGGTCCAGTTCATGG + Intergenic
1152194265 17:78907488-78907510 TCTCATGTGGGCACAGTTCATGG + Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153492887 18:5667801-5667823 TCTGTTATGGGCATGGCTCGTGG + Intergenic
1153566427 18:6422811-6422833 TTTTGTATGGGCTTGGTTCCTGG + Intergenic
1153569886 18:6459622-6459644 TTTTATAAGGGCACGGTTTATGG - Intergenic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154096649 18:11422864-11422886 TCTCATATGGGCACGGTTAATGG + Intergenic
1154220123 18:12445264-12445286 TCTTATATGGGCACAGGTCATGG + Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155511888 18:26586326-26586348 TCTTATATGGGTGCAGTTCATGG - Intronic
1155580226 18:27296751-27296773 TCTTATATGGGGACTGTTCATGG + Intergenic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156181784 18:34613184-34613206 TCTTATATGAGTGTAGTTCATGG - Intronic
1156579791 18:38361751-38361773 TTTCATATGGGGATGGTTCATGG + Intergenic
1156635070 18:39017876-39017898 TCTTTTATGGGAAGGGTTCCTGG + Intergenic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1158212076 18:55062764-55062786 TCTTATACAGGCCTGGTTCATGG + Intergenic
1158250638 18:55483584-55483606 TCTTATATGGTCATTGTAAAGGG + Intronic
1158816669 18:61106103-61106125 ACTTCTATGGGCACAGTTCATGG + Intergenic
1159180607 18:64897869-64897891 TTTTATATGGTCATGATTCATGG + Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159656856 18:71040210-71040232 TCTTATATGTGGGTAGTTCATGG - Intergenic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160520304 18:79504470-79504492 TCTTAGATGGGCACAGTTCGTGG + Intronic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1165695296 19:37896079-37896101 AGTTATATGGGCATGGCTCTTGG + Intronic
1166580183 19:43890268-43890290 TCTTATATGGGTGTGGCTCACGG + Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
1167626824 19:50595833-50595855 TCTGATATGGATGTGGTTCATGG - Intergenic
1168337441 19:55604643-55604665 TCTGAGGTGGGCGTGGTTCAGGG + Intergenic
1168337581 19:55605298-55605320 TGTGAGATGGGCGTGGTTCAGGG + Intergenic
925030716 2:648315-648337 CCTTATGTGGGCAGCGTTCACGG - Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925635182 2:5935652-5935674 TCTCATATGGGGATGGGGCAGGG - Intergenic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926449973 2:12991131-12991153 TTTTATATGGACATGCTTCCTGG - Intergenic
926608438 2:14921263-14921285 TCTTATATGAGTGTGGTTCATGG + Intergenic
926818585 2:16827118-16827140 TCTTGTATGGGCACAGTTCATGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927322550 2:21764284-21764306 TCTTATATGGATGTGGTTCATGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
929973668 2:46609787-46609809 TCTTATATGGGTATGAGCCATGG + Intronic
930471686 2:51823909-51823931 GCTCATATGGGCAAGGTTCATGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
930949574 2:57123098-57123120 TCTCAGAAGGGCATGGTTCGTGG + Intergenic
931327213 2:61239053-61239075 TCTTATATGGGTGTAGTTCGTGG - Intronic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931924857 2:67060971-67060993 TCTTATATGAGTGTGGTTCATGG + Intergenic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932286453 2:70537173-70537195 TCTTCTACGGGTGTGGTTCATGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
932951033 2:76293821-76293843 TCTTACACGGGCATGATTCTTGG + Intergenic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
933906250 2:86896465-86896487 TCTTATATGGGTACAGTTCGTGG - Intergenic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
935595611 2:104874860-104874882 CCTTTTATGTGCATAGTTCAGGG + Intergenic
935796917 2:106651498-106651520 TCTTATATGGCTGTGGTTCACGG + Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936365916 2:111855217-111855239 TCTTATATGGGTACAGTTCGTGG + Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936719782 2:115237318-115237340 TTTTATACTGACATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938022554 2:127917933-127917955 TCTTATATGGGCACAGTTGGTGG + Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938396349 2:130951536-130951558 TCTTCTATGGGCACAGTTCATGG + Intronic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938960617 2:136337322-136337344 TCTTATATGAGCACAGTTCATGG - Intergenic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939285462 2:140123386-140123408 TCATATATGGGTGTGGTTCATGG + Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939728381 2:145752024-145752046 TCTTATGTGGGCATGGAAGAGGG - Intergenic
939817377 2:146912376-146912398 ATTATTATGGGCATGGTTCATGG - Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940024007 2:149185895-149185917 CCTTATATGGGTATATTTCATGG - Intronic
940037474 2:149325967-149325989 TCTTATCTGGACACGGTCCATGG + Intergenic
940608429 2:155958692-155958714 TCTTATATGGATGTGGTTCATGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941727638 2:168880864-168880886 TCTTATATGGGTGTCATTCATGG + Intronic
941733020 2:168939947-168939969 TCTTATATTGGCGTGGTTCGTGG - Intronic
941801874 2:169668746-169668768 TCTTATATGGGTACAGTTCGTGG + Intronic
941974558 2:171388884-171388906 TTTTATATGGATATGGTTCATGG - Intronic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942258981 2:174138411-174138433 TCTTCTATGTGCATCGTTCATGG + Intronic
942747780 2:179255023-179255045 TCTTATATGGGTTTGATTCATGG - Intronic
942822388 2:180129959-180129981 TCTTATACAGGCATGATTCTTGG + Intergenic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
942921046 2:181374102-181374124 TTTTCTGTGGGCAAGGTTCAGGG - Intergenic
943169194 2:184374331-184374353 TCTTATATGAGGATGATTCATGG - Intergenic
943247004 2:185467459-185467481 TCTTAAAGGGGCATAGTTCATGG + Intergenic
943292817 2:186096942-186096964 TCTTATGCGGGTATGCTTCATGG - Intergenic
943531658 2:189089805-189089827 TCTTGTATGGGCATCATTCAAGG - Intronic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944529565 2:200653914-200653936 TCTTATATGGATGTGGTTCATGG - Intronic
944719990 2:202414258-202414280 TTTTATATGGGTGTGGTTCCTGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
946133109 2:217622842-217622864 TCTGATATGGGAATGGTTTTTGG - Intronic
946464628 2:219900890-219900912 TCTTGTATGAGCACAGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1170252246 20:14297079-14297101 TCTTATATGTGCTCAGTTCACGG - Intronic
1170642695 20:18169513-18169535 TCTCATATGGGTGTGGTTCATGG - Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1172236360 20:33378347-33378369 TCTTATGTGGGTGTGGCTCATGG + Intronic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173077421 20:39832820-39832842 TCTTAGGTGGGCATGTTCCATGG + Intergenic
1173707368 20:45121794-45121816 TCTTATGTGGGCACAGTTTATGG + Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174025772 20:47573047-47573069 TCTTATATGAGCACAGTGCATGG + Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175168030 20:57059944-57059966 TCTTATACGGGCACAGTTCGTGG + Intergenic
1175173651 20:57096508-57096530 TGTGACATGGGCATGGGTCATGG - Intergenic
1175458213 20:59131083-59131105 TCTTTTGTGGGCAAGGTTGAAGG + Intergenic
1175560815 20:59928092-59928114 TCCTATATTGGCTAGGTTCATGG - Intronic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1176702523 21:10072678-10072700 TCTTATATGGATGTGGTTCATGG + Intergenic
1176946041 21:14982923-14982945 TGTGATATGGGCACAGTTCATGG - Intronic
1176951183 21:15048092-15048114 GCTGATATGGGCACAGTTCATGG + Intronic
1177162525 21:17563483-17563505 TCTCTTATGGGCATCATTCATGG + Intronic
1177167627 21:17620404-17620426 TCTTGTATGGGTGTGGTTCATGG + Intergenic
1177286296 21:19055685-19055707 TCTTATATGAGCATATTTCATGG - Intergenic
1177298475 21:19208226-19208248 TCTTATATCGGAACAGTTCATGG + Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178382059 21:32118723-32118745 TCTCATATAAGAATGGTTCATGG + Intergenic
1178519443 21:33275871-33275893 TCTTATATAGGTGTGGTTCATGG + Intronic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1180887760 22:19259615-19259637 TCTTATATGTGTGTGGTTCATGG - Intronic
1180894561 22:19320349-19320371 TCTTTTATGGGCATAGATAAGGG - Intergenic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181418352 22:22777011-22777033 TATTATCTGGGGATGGTTAATGG - Intronic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
1185177995 22:49341185-49341207 TCTTATGTGGTCATAGTACATGG - Intergenic
949306565 3:2648526-2648548 TCTTATATGGGTGCGGTTCATGG - Intronic
949391726 3:3569827-3569849 TCTTATGTGAGCGTGATTCATGG - Intergenic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
949984663 3:9531106-9531128 TCTTACATGGGCGCAGTTCATGG + Intronic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
950976364 3:17249856-17249878 TCTTATATGGGTGCAGTTCATGG + Intronic
951333039 3:21388168-21388190 TCTTACATGGGCACAGTTAATGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951507002 3:23458315-23458337 TCTTCTATGGGTGTGGTTCATGG + Intronic
952469520 3:33631546-33631568 TATTAGCTGGGCATGGTGCAGGG + Intronic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953211881 3:40883107-40883129 TATTCTATGGGTGTGGTTCATGG + Intergenic
953367211 3:42355323-42355345 TCTTCTATGGGTGTGGTTCATGG - Intergenic
953436029 3:42878049-42878071 TCATATATGGGCCCAGTTCATGG - Intronic
954373220 3:50180667-50180689 TTTTATATGGGTGAGGTTCACGG + Intronic
954944591 3:54409319-54409341 TTTTATATGGGTGTGGTTCATGG - Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955448415 3:59038702-59038724 TCTTATATGGGGTTTGTTCATGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956706827 3:72006277-72006299 TGTTATATTGTCATGCTTCAAGG - Intergenic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957175409 3:76802016-76802038 TCTTATGTGAGCAGGGTCCATGG + Intronic
957627060 3:82666781-82666803 TCTTATATGGGCAAAGTTCCTGG + Intergenic
957679248 3:83410401-83410423 TCTTATATGGGTCAGGTTGATGG + Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959681460 3:109101268-109101290 TCTCACATGGGCCTGGTTAAGGG - Intronic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959773079 3:110123316-110123338 TCTTATATGAGCATAATTTATGG - Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960258873 3:115542114-115542136 TCTTATATGGGCGCTGTTCATGG + Intergenic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
960951840 3:123004219-123004241 TCTTATATGGGCTTGGAAAATGG - Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961473604 3:127133860-127133882 TTTTATCTGGACATGGTTGAAGG - Intergenic
961962213 3:130867069-130867091 TCTAATGCGGGCATGATTCAGGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962544147 3:136414990-136415012 TCTTATGTGGGTACAGTTCATGG + Intronic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963550005 3:146708002-146708024 TCTTATATAGGCACAGTTCATGG + Intergenic
963584507 3:147167557-147167579 TCTTATGTGGGCACAATTCATGG + Intergenic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963746719 3:149131523-149131545 TCTCACATGGGCACAGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964823288 3:160797287-160797309 TCTTCTATGGGTGTGATTCATGG - Intronic
964870389 3:161307453-161307475 TCTTATACGGTCACAGTTCATGG - Intergenic
964926451 3:161963888-161963910 TTTTATAGGTGCATGGTGCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
964942165 3:162171972-162171994 CCTTATATGGGCCTGATTCATGG - Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965352254 3:167628064-167628086 TCTTGTATGGGTGTGGTTCATGG - Intronic
965831267 3:172792106-172792128 TCTCATATGGGCATTGTTAGTGG + Intronic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966116288 3:176467230-176467252 TCTTGTATGGGTGTGGTCCATGG - Intergenic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
966538108 3:181056799-181056821 TTTTATATTGGCATTTTTCAGGG + Intergenic
966663676 3:182446208-182446230 TCTTATACAAGCATGGTTCGTGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968485841 4:861050-861072 TCTTCTATGGGCACAGTCCATGG - Intronic
970390413 4:15604401-15604423 TCTTATTAGGGCACAGTTCATGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970629793 4:17927720-17927742 TCTCATATGGGAGTGGTTCGTGG + Intronic
971044091 4:22785434-22785456 TATTATATGTGCTTGGTTCATGG + Intergenic
971086080 4:23276702-23276724 TCTTACAAGGGCACAGTTCATGG - Intergenic
971164191 4:24165722-24165744 TCTTATATGGTAATGGATCATGG - Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
972160739 4:36223743-36223765 GCTTATATGGGCTTTGTTCCTGG - Intronic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972952368 4:44343376-44343398 TCTTCTATGGGCACAGCTCATGG + Intronic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974448702 4:62021777-62021799 TCTTATATGGGTGAGGTTCATGG - Intronic
974641543 4:64638837-64638859 TATTATAGGAGCATGTTTCAAGG + Intergenic
974660185 4:64877665-64877687 TCTTATATGGGCTCAGTTCTTGG + Intergenic
974667346 4:64981550-64981572 TCCTAAATGGGTGTGGTTCATGG - Intergenic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975010748 4:69348488-69348510 TCTTATATGGGAAGAGCTCAAGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975818639 4:78246644-78246666 TATGATAAGTGCATGGTTCAAGG + Intronic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976465460 4:85363207-85363229 TCTTGTATGGGTATGGTTTCTGG + Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977103999 4:92857050-92857072 TATCATATGGGCGTGGTTAATGG - Intronic
977225826 4:94390425-94390447 TCTTATAAGGGCACAGTTCATGG + Intergenic
977314338 4:95426274-95426296 TCTTATATGAGTGTGGTTCATGG - Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977597073 4:98895068-98895090 TCTTATATCGCCAATGTTCATGG + Intronic
977715132 4:100173612-100173634 TCTCATATGGGTGTGGTTCGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978018724 4:103782036-103782058 TCTCATATGGGCATGACTCATGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
978307647 4:107349345-107349367 CCTTATATGGGCATAGATGATGG - Intergenic
978308728 4:107361966-107361988 TCTTATAAGGGCACAGTTCATGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979846252 4:125516295-125516317 TCTTATTTGGGTGTGGTGCATGG + Intergenic
980065397 4:128182481-128182503 TCTTATCCTGGCATGGTTCATGG - Intronic
980374697 4:131929097-131929119 TCTTATATAGATGTGGTTCATGG + Intergenic
980433685 4:132740133-132740155 TCTTATATGGGCATGATGTTTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
980759990 4:137220274-137220296 TCTTATATGGGTGCAGTTCATGG - Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981439359 4:144765533-144765555 TCCTACACAGGCATGGTTCATGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982148217 4:152421866-152421888 TCTTCTATGGGTGTGGTTCATGG + Intronic
982488173 4:155994234-155994256 TCTTATATGGGTAAAGTTCTAGG + Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983124686 4:163936145-163936167 TCTTATGTAGGCATGATTCCGGG + Intronic
983154767 4:164333530-164333552 TCTTATGTGGGCACAGTTCATGG - Intronic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983652889 4:170051231-170051253 TCTTACAGGGGCACAGTTCATGG + Intergenic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
984121362 4:175749127-175749149 TCTTATATGAGTATAGTTTATGG + Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984461079 4:180037612-180037634 TCTTATATGGTCACAGTTCTTGG - Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
984822947 4:183899125-183899147 TCTTATATGGGCACACTTCGTGG - Intronic
984899149 4:184569270-184569292 CCATATAGGGGCCTGGTTCATGG + Intergenic
985311108 4:188600505-188600527 TCTTATATGAGCACAATTCATGG + Intergenic
985345861 4:189003376-189003398 TCTTATACAGGCACAGTTCATGG - Intergenic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986607701 5:9538558-9538580 TGTTTTATGGGCATAGCTCAGGG - Intronic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987095943 5:14549983-14550005 TCCTATATAAGTATGGTTCATGG + Intergenic
987279923 5:16402569-16402591 TCTTATATGGGCACCATTTATGG + Intergenic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987750428 5:22031788-22031810 TCTAATATGGGCACAGTTTATGG + Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989001096 5:36761596-36761618 TCTTATACAGGTATGGTTCGTGG + Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990151713 5:52825491-52825513 TCTTATATAGGCACAGTTCCTGG - Intronic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990788756 5:59453170-59453192 TCTTATATAGGCATGGCTTATGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
992074548 5:73178957-73178979 TCTTATATGAGCAAGGTTGATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992835941 5:80641498-80641520 TCTTAAAAGGGCATGATTTATGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
992922219 5:81537718-81537740 TCTTGTATGGGTGTGGTTCACGG - Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994900741 5:105765406-105765428 TCTTATATGGTCGCGGTTCATGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995214400 5:109578580-109578602 TCTTATATGGATGTGGTTCATGG + Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995658633 5:114455374-114455396 TCTCTTATGGGCTTGATTCATGG - Intronic
995670094 5:114593426-114593448 TCTTATATGGGTGTGCTTCATGG + Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996269387 5:121584722-121584744 TCTGGTATGGGCATGCTTCCTGG + Intergenic
996482941 5:123996129-123996151 TTTTATATGGTCGTGGTACATGG + Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996660400 5:125996153-125996175 TGTTATAAGGACATGGTTTATGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
996847609 5:127917677-127917699 TCTTATATGGGTGCAGTTCATGG + Intergenic
997176201 5:131780684-131780706 TCTTATATGGGCACAGTTCCTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
998216304 5:140240694-140240716 TCTTCTAGGTGCAGGGTTCAGGG - Intronic
998510296 5:142707636-142707658 TCTTATATGAGCACAGTTTATGG - Intergenic
998836045 5:146203757-146203779 TCCTCTATGAGCATGGTGCAGGG - Exonic
999497310 5:152112060-152112082 TCTTATATGAGTGTGGTTCTTGG + Intergenic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003275070 6:4643442-4643464 TCTTCTATGGGCATAGTTCGTGG + Intergenic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003646689 6:7918399-7918421 TCTAATTTGGGCATTGTTCCTGG - Intronic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003783895 6:9461313-9461335 TTATATATTGGCATGGTTCCAGG + Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004972229 6:20923501-20923523 TCTCATATGGGCATAGTCCGTGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005402245 6:25446961-25446983 TCTTATATGGGTGTGATTCATGG + Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1006075075 6:31527217-31527239 TCTTATATGAGCATCGCTCATGG + Intergenic
1006959713 6:37916112-37916134 GCTTGTATGGGCATAGTTTATGG + Intronic
1007246805 6:40469088-40469110 TCTTATAAGGGCATTTGTCATGG - Intronic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008299105 6:49812391-49812413 TCTTATATGGGTGTGGTCCATGG + Intergenic
1008516301 6:52322607-52322629 TCTTGTATGAGCATGGCTCATGG + Intergenic
1008622500 6:53284879-53284901 TCTTATATAGGTGTGGTTCATGG - Intronic
1008975172 6:57417621-57417643 TCTTATAGGGGCATAGTTGATGG + Intronic
1009164057 6:60319140-60319162 TCTTATAGGGGCATAGTTGATGG + Intergenic
1009379991 6:63015996-63016018 TCTTATATGGGCACATTTCTTGG - Intergenic
1009525700 6:64742280-64742302 TCTTATATGGGTGTGGCTTATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010241418 6:73619160-73619182 TCTTATATGGGGAAGGATTATGG + Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1011069829 6:83368139-83368161 TCTTATATGGGAGCGGTTCATGG + Intronic
1011095953 6:83663077-83663099 TCATTTATGGGCACAGTTCATGG - Intronic
1011446659 6:87448696-87448718 ACTTATATGGGCATGATCTATGG + Intronic
1011644614 6:89445921-89445943 TCTTATTTGGGCACAATTCATGG - Intronic
1011868797 6:91866288-91866310 TATTATATGGGCATGGTGGTGGG + Intergenic
1011872075 6:91907923-91907945 CCTTAAATGGGTGTGGTTCATGG + Intergenic
1012092807 6:94920150-94920172 TCTAAAATGGGCATAATTCATGG - Intergenic
1012109083 6:95203399-95203421 TCTTATATTGGCCCAGTTCATGG + Intergenic
1012304525 6:97636443-97636465 TCTTCTATAGGCATGGTTCGTGG - Intergenic
1012695327 6:102374601-102374623 TTTCATATGAGCATGGCTCATGG - Intergenic
1012965077 6:105665347-105665369 TCTTCTATGTGCACGGTTCATGG + Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013381868 6:109581058-109581080 TCTTATATAGATGTGGTTCATGG - Intronic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013477565 6:110522954-110522976 TCTCATATGGCAATGTTTCATGG - Intergenic
1013712832 6:112921438-112921460 TCTTATACGGGCACAGTTCATGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013823751 6:114185994-114186016 CCTTATATCAGTATGGTTCATGG - Intronic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014294211 6:119598483-119598505 TCTAATATGGGTGTGGTTCATGG + Intergenic
1014319597 6:119910462-119910484 TCTCATATGGGTATAGTTCAAGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015144837 6:129973944-129973966 TCTTATACAGGGGTGGTTCATGG - Intergenic
1015570581 6:134617445-134617467 AATTATCTGGGCATGGTTGAGGG + Intergenic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015821812 6:137269287-137269309 TCTTATATGAACGTGGTTCATGG + Intergenic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016175674 6:141075289-141075311 ACTTTTATGGACATGGATCATGG - Intergenic
1016199424 6:141389561-141389583 TCTTATATGAGCACAGTTCATGG + Intergenic
1016571955 6:145523553-145523575 ATTTATATGGGTATGGTTCATGG - Intronic
1016579525 6:145614730-145614752 TCTTATACAGGCACAGTTCATGG + Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016890354 6:149000214-149000236 TCTTATAAGGGCATAGTTCCAGG - Intronic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017068820 6:150554045-150554067 TCTTATATGGGTGCAGTTCATGG - Intergenic
1017298289 6:152825653-152825675 TCTTACGTGGGCACAGTTCATGG + Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1017734663 6:157350405-157350427 TCTTATATGGGTGTGATTCCTGG - Intergenic
1018224142 6:161611558-161611580 TCTTATGTGGGCACATTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018271470 6:162082869-162082891 TCTCATATGGGTGTGGTTCATGG + Intronic
1018294747 6:162333547-162333569 TTTTATATAGGCATGGTTGGTGG - Intronic
1018691738 6:166350965-166350987 TCTTATATGAGCACAGTTCTTGG + Intergenic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1018881414 6:167885562-167885584 TCTTATATGGGTGCAGTTCATGG + Intronic
1019507408 7:1399246-1399268 TCTGATCTGGTCTTGGTTCATGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020459660 7:8414455-8414477 TCTTATACAGGCATGGGTCATGG - Intergenic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1021678111 7:23101500-23101522 TGTTTTATGGGCTCGGTTCATGG - Intergenic
1021829867 7:24594666-24594688 TCTTATATGGGGGTGATTCATGG + Intronic
1021898533 7:25260205-25260227 CATTATATGTGCATCGTTCAAGG + Intergenic
1021974794 7:26001211-26001233 TCTTATATGGGTGCAGTTCATGG + Intergenic
1022061955 7:26806056-26806078 TCCTATATGGGTGTGGCTCATGG - Intronic
1022197193 7:28080745-28080767 TCTTATATGGGTGCAGTTCATGG + Intronic
1022340628 7:29464069-29464091 TCTTATGTGTGCATTGTTCAGGG + Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022548899 7:31217730-31217752 TTTTATATGGGTGTGGTTCATGG + Intergenic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023026067 7:36050878-36050900 TCTTATATGGGTGCGGTTCATGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024257952 7:47552614-47552636 TCTTATATGGATTTGGTTCATGG - Intronic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1024786150 7:52910618-52910640 TCTTATATGGGCTTAGTTTTTGG + Intergenic
1024877291 7:54040309-54040331 TCTTATATGAGCACAGTTTATGG + Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026507719 7:70999977-70999999 TCTTATATGAGTATGGCTCATGG - Intergenic
1026954196 7:74366436-74366458 TGTCAAATGGGCATGGTACAGGG - Intronic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027596045 7:80175744-80175766 TCTTATGTGGGCAGAGTTTATGG - Intronic
1027623152 7:80517705-80517727 TCTTATATGGACACTGTTCATGG + Intronic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1027945011 7:84733413-84733435 TCTTATATTGGCGTGGTCCATGG + Intergenic
1028344842 7:89767042-89767064 TCTTATTTGGGCACAGCTCATGG - Intergenic
1028372370 7:90107703-90107725 TCTGATATGGGCATAGCTCATGG + Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1030151120 7:106406179-106406201 TTCCATATGGGCATGGTTCTTGG + Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031878366 7:127167655-127167677 TTTTATATGGGCACAGTTCGTGG - Intronic
1031954760 7:127931038-127931060 TCTTATATGACTGTGGTTCATGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032379050 7:131456730-131456752 TCATATATGGACATGATTCTTGG + Intronic
1032701597 7:134385099-134385121 TCTTACATGGGCACAGTCCATGG - Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032861749 7:135886372-135886394 TCTTAAGTGTGTATGGTTCATGG - Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033388417 7:140902289-140902311 CCTTATATGGGTGTGGTTCGTGG - Intronic
1033393845 7:140955384-140955406 TCTTATATGGGCGCAGTTCATGG - Intergenic
1033541068 7:142356662-142356684 TCTGATAAAGGCATTGTTCAAGG + Intergenic
1033795276 7:144838292-144838314 TCTTATAAGGGCATGGCTGGTGG - Intergenic
1034022168 7:147656597-147656619 TCTTCTATGGGCACAGTTAATGG + Intronic
1034028158 7:147730505-147730527 TCTTGTACGGGCAGAGTTCATGG - Intronic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1036618043 8:10403942-10403964 TCTTAAATGCTCATGGGTCACGG - Intronic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037218554 8:16488026-16488048 TCTTATATGGGTACAGTTCATGG + Intronic
1037263365 8:17032955-17032977 TCTTATATGGGTGCGGTTCATGG - Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037417133 8:18664003-18664025 TCTTATGTGGAGATGGTTAATGG - Intronic
1037435633 8:18860234-18860256 CGTTATATGGGCATGGTTTATGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039556169 8:38476758-38476780 TTTTATATGGGTATGATTCATGG - Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1039983842 8:42430879-42430901 TCTCATATGGGAACAGTTCATGG - Intronic
1040068118 8:43165281-43165303 TCTTATACAGGCAGGGTTCATGG - Intronic
1040076079 8:43232496-43232518 TCTTCTATGGGCACAGTTCATGG + Intergenic
1040441259 8:47445355-47445377 TCCTATATGGCCACGGTTCATGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041588019 8:59544533-59544555 TCTTTTCTGGGCATGTGTCATGG - Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042419432 8:68568111-68568133 TCTTATATGGACAGAGTTCATGG + Intronic
1042441028 8:68826853-68826875 TCTTATATGAGTGTGGTCCATGG + Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043275711 8:78389648-78389670 TCCCATATGGGCATGATTCATGG - Intergenic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043944771 8:86237604-86237626 TCTTATATGGGCACAGATCATGG + Intronic
1043985183 8:86686291-86686313 AATCATATGGGCATGGTTAATGG + Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1047034520 8:120922475-120922497 TTTTATATGGGAGTGGTTCATGG + Intergenic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047576963 8:126166714-126166736 TCTCATATGGGCATGGCTTATGG + Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1049227429 8:141463079-141463101 TCTTATATGAGTGTGGCTCATGG - Intergenic
1049629138 8:143642769-143642791 TCTTATATGGGTGCGGTTCATGG + Intronic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050336925 9:4598218-4598240 TATTTTATGGGCATGTTTCATGG - Intronic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1050699456 9:8322064-8322086 TGTCTTATGGTCATGGTTCATGG - Intronic
1050792575 9:9492930-9492952 TCTTATATGGGTTGGGTTCATGG - Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051298237 9:15619022-15619044 CCTTATGCAGGCATGGTTCATGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051330056 9:16014980-16015002 TCTTATATTGGAAGAGTTCAAGG - Intronic
1051454435 9:17238424-17238446 TCTTTTATGACCATGCTTCATGG - Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051613588 9:18985197-18985219 TCTTATACGGGCGTGGCTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052060474 9:23954450-23954472 TACTACATGGGAATGGTTCATGG - Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053172494 9:35899460-35899482 TATTATATGGGCGCAGTTCATGG + Intergenic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1053639724 9:40059395-40059417 TCTTATATGGATGTGGTTCATGG + Intergenic
1053766409 9:41406040-41406062 TCATATATGGATGTGGTTCATGG - Intergenic
1054320473 9:63655734-63655756 TCTTATATGGATGTGGTTCATGG + Intergenic
1054545026 9:66317220-66317242 TCTTATATGGATGTGGTTCATGG - Intergenic
1054795903 9:69301549-69301571 TCTTGTATAGGTGTGGTTCATGG + Intergenic
1055039533 9:71854369-71854391 TCTTATATGAGCGTGTTTCATGG + Intergenic
1055377230 9:75662309-75662331 TCTTATGTGGGTGTGGTTCATGG - Intergenic
1055807406 9:80111957-80111979 TCTTATCTGGGTGAGGTTCATGG + Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056979237 9:91293040-91293062 TCCTATGTGGGCGTGGTTCATGG - Intronic
1057504491 9:95621501-95621523 TCTTTTATTGGAATGGTTCATGG - Intergenic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058260871 9:102829716-102829738 TGTTATGTGGGCATGGCTCATGG - Intergenic
1058475906 9:105332757-105332779 TCTTATATGGGCATAAAACAGGG - Intronic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059558892 9:115311722-115311744 TCTTATATGAGCTTGATTCATGG - Intronic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1059936372 9:119315410-119315432 TCTTATATGGGTCCAGTTCATGG - Intronic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1202787542 9_KI270719v1_random:42770-42792 TCTTATATGGATGTGGTTCATGG + Intergenic
1185523260 X:757719-757741 ACTTATTTTGCCATGGTTCATGG + Intergenic
1186199350 X:7140960-7140982 ACTTATATGGGTGCGGTTCATGG - Intronic
1186304095 X:8235428-8235450 TCATATATGAACATGGTTCATGG + Intergenic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186367447 X:8910393-8910415 TCCTAGGTGGGCATTGTTCAGGG - Intergenic
1186942350 X:14523766-14523788 TCCTATACGGGTGTGGTTCATGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187380901 X:18801237-18801259 TCTGATGTGGGCCTGGTACAGGG + Intronic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187760115 X:22573864-22573886 TCTTATATGGGTGCAGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187814950 X:23221473-23221495 TCTTATATGGGCACTGCTCATGG + Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188432648 X:30122507-30122529 TCTTATGTAGGCATAGTTCATGG - Intergenic
1188456154 X:30368715-30368737 TCTTATATGGGTGAAGTTCATGG + Intergenic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189263715 X:39697294-39697316 TCTTATGTGGTCACAGTTCATGG + Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1190486600 X:50932417-50932439 TCTTATATGGGTACAGTTTATGG - Intergenic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193331524 X:80240187-80240209 TCTTATAAGAGTGTGGTTCATGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193652203 X:84150641-84150663 TCTTATGTGTGCGTGGTTCATGG + Intronic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194363292 X:92981930-92981952 GATAATATGGGCATGGTTAATGG + Intergenic
1194779156 X:98002004-98002026 TCTTATATGGTCTTGTTTTATGG - Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196034955 X:111134179-111134201 ACATAGCTGGGCATGGTTCAAGG - Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1196578043 X:117343969-117343991 TCTTATCTGGGTGTGGTTCGTGG + Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197146414 X:123177417-123177439 TCTTATATGTGGTTGCTTCAAGG - Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197557325 X:127971880-127971902 TCTTATGTCAGCATGATTCATGG + Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198281424 X:135146601-135146623 TCTGATATGGGTGTGGTTCTTGG + Intergenic
1198289535 X:135225915-135225937 TCTGATATGGGTGTGGTTCTTGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198542892 X:137659075-137659097 TCCTATATGGGCACCGTTTATGG - Intergenic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198676101 X:139132903-139132925 TCTTCTATGGCCATAGGTCAAGG + Intronic
1198690367 X:139276837-139276859 TTTTATATCGGCACAGTTCATGG + Intergenic
1198826663 X:140705377-140705399 TTTTATATGGGCACAGTTTATGG + Intergenic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199054371 X:143275364-143275386 TCTTATATTGGGACAGTTCATGG - Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1199409321 X:147502184-147502206 ACTTATATGGGCACAATTCATGG - Intergenic
1200514126 Y:4120666-4120688 TTTTATATGGGTGTGGTTCATGG + Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic
1200671533 Y:6098179-6098201 GATAATATGGGCATGGTTAATGG + Intergenic
1200897182 Y:8388141-8388163 TCTTAAATGGGCAGGATCCAGGG + Intergenic