ID: 1106355711

View in Genome Browser
Species Human (GRCh38)
Location 13:28981244-28981266
Sequence TTGTTTGAGATTAATCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106355711_1106355712 -1 Left 1106355711 13:28981244-28981266 CCACATGGATTAATCTCAAACAA 0: 1
1: 0
2: 3
3: 46
4: 230
Right 1106355712 13:28981266-28981288 AATTAGATAAAATGAGAAAAAGG 0: 1
1: 1
2: 13
3: 158
4: 1373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106355711 Original CRISPR TTGTTTGAGATTAATCCATG TGG (reversed) Intronic
901519721 1:9774267-9774289 GTGTTTAAGAATAATCCATCCGG + Intronic
902059054 1:13626347-13626369 TTGTTTTAGATTTATCCTTGTGG + Intergenic
902420314 1:16273959-16273981 GTTTTTGAGATTCATCTATGTGG - Intronic
905261210 1:36720761-36720783 TTGTTTAAGATAAATTCAAGGGG + Intergenic
906787508 1:48628836-48628858 CTGAAAGAGATTAATCCATGTGG - Intronic
908205528 1:61844418-61844440 TTGTTAGCTATTAAACCATGTGG - Intronic
908407062 1:63825374-63825396 GTTTTTGAGGTTTATCCATGTGG - Intronic
908534169 1:65063501-65063523 ACTTTTGAAATTAATCCATGGGG + Intergenic
909230116 1:73077968-73077990 GCTTTTGAGATTAATCCATGTGG - Intergenic
909817993 1:80020908-80020930 TTGTTTCAGCTTTATCCATTGGG + Intergenic
913451223 1:118993952-118993974 TTCTTGAAGCTTAATCCATGTGG + Intergenic
914946554 1:152071982-152072004 TTGTTTGTGATTAAAACATATGG + Intergenic
918161689 1:181906938-181906960 TATTTTGAGATCCATCCATGTGG + Intergenic
920782329 1:209006055-209006077 TTGTATCAGATTAATTCCTGTGG - Intergenic
921047300 1:211486546-211486568 ATGTTAGAAAATAATCCATGGGG + Intronic
923197734 1:231684500-231684522 TTGTTTGAGAATAATACAGTAGG + Intronic
923201297 1:231714860-231714882 TTGTTTCAAATGAATCCATGTGG - Intronic
923810103 1:237305321-237305343 ATTTTTGAGATTAATCCATGTGG - Intronic
923948401 1:238918691-238918713 ATTTTTGAGATTCATCCATGTGG - Intergenic
1063494756 10:6496530-6496552 TTATATGAGAATAATCCTTGTGG - Intronic
1064061164 10:12138659-12138681 CTTTTTGAGATTAATTCATATGG + Intronic
1064579154 10:16775994-16776016 TTGTATGAAATTAAACCATGAGG - Intronic
1064774684 10:18763248-18763270 TTGTTTGTCATTAAATCATGAGG + Intergenic
1065099250 10:22317355-22317377 TTTTTTGAGATTAACCCAGGTGG - Intronic
1065287214 10:24197773-24197795 GTGTTTGAGATAAATCTGTGTGG - Intronic
1065749420 10:28872049-28872071 TTGTTAAAGGTTAATCTATGGGG - Intronic
1067252861 10:44602429-44602451 TTTTTTAAGATTAATAAATGTGG + Intergenic
1067283870 10:44893490-44893512 TTATTTGAGGTTAATGTATGTGG - Intergenic
1067399137 10:45955078-45955100 GTTTTCAAGATTAATCCATGTGG + Intergenic
1067867458 10:49924294-49924316 GTTTTCAAGATTAATCCATGTGG + Intronic
1067938153 10:50628656-50628678 TATTTTGAGATCCATCCATGTGG - Intergenic
1068054024 10:51988264-51988286 ATTTTTGAGATTTATCCATGTGG + Intronic
1068816977 10:61327506-61327528 GTCTTTGAGATTAATCCATGTGG - Intergenic
1068976037 10:63010670-63010692 GTCTTTAAGATTCATCCATGTGG - Intergenic
1069446585 10:68478482-68478504 TAGTTTGGGAATAATCCTTGGGG + Exonic
1070346619 10:75549109-75549131 GCTTTTGAGATTCATCCATGTGG + Intronic
1071112375 10:82174900-82174922 TAAATTGAAATTAATCCATGGGG - Intronic
1073205710 10:101768274-101768296 TTGTTTGAGAGCAATTCCTGGGG - Intergenic
1074486611 10:113889827-113889849 GTTTTTGAGATTCATCCCTGTGG + Intronic
1075359944 10:121822235-121822257 CTTTGTGAGATTTATCCATGTGG - Intronic
1076923784 10:133470825-133470847 TTACTTGCGATTCATCCATGTGG + Intergenic
1079268402 11:18958114-18958136 TTGTGTGAGAGGAGTCCATGAGG + Intergenic
1079708186 11:23647991-23648013 TTGTTTGTTTTTAATCCAAGAGG + Intergenic
1080657911 11:34272361-34272383 TTGTGTGAGATTTAACCATCTGG - Intronic
1085577561 11:77620624-77620646 TTGTTAGAGATTTCGCCATGGGG - Intronic
1086104799 11:83135664-83135686 TTGATTGAGATTAATCTGAGAGG + Intergenic
1087180705 11:95139576-95139598 TTTTTTGAGATTTACCCATGTGG - Intergenic
1088034124 11:105291091-105291113 TATTTTGAGATTCATCCATGTGG - Intergenic
1088697552 11:112381249-112381271 GCATTTGAGATTAATTCATGTGG + Intergenic
1089266425 11:117266004-117266026 ATTTTTGAGATTCATCCATGAGG + Intronic
1090156582 11:124444397-124444419 TTATTTGAGATTACTCCTTCTGG - Intergenic
1090693703 11:129214677-129214699 TTGTTTCAAATTGATACATGAGG + Intronic
1092954796 12:13540009-13540031 TTGTTTCAGAATAATACATGAGG + Exonic
1093395335 12:18674219-18674241 TTGTTTGAATTTAATATATGTGG - Intergenic
1095399015 12:41793138-41793160 TCATTTGAGATTTATTCATGTGG - Intergenic
1095553983 12:43477963-43477985 TTATTTAATATTAAGCCATGGGG - Intronic
1096638526 12:52976288-52976310 TTGTTTGAGATTAGTTCAGGTGG - Intergenic
1096915502 12:55027526-55027548 TTGTTTGATATATATCCATAGGG - Exonic
1097739911 12:63229293-63229315 TATTTTGAGATTCATCCATTAGG - Intergenic
1098159790 12:67639126-67639148 TTGTAAGAGCTTTATCCATGTGG - Intergenic
1099079328 12:78156889-78156911 GGTTTTGAGATTCATCCATGTGG - Intronic
1102015484 12:109645340-109645362 TTGTTTGATATGAATGCATTAGG - Intergenic
1102842850 12:116144539-116144561 ATGTTTGTGGTTAATCAATGTGG + Intronic
1103589543 12:121981530-121981552 TTGCTTCAGAATAACCCATGGGG - Intronic
1104212029 12:126698299-126698321 TTGATTGATATTAACCCGTGGGG - Intergenic
1106355711 13:28981244-28981266 TTGTTTGAGATTAATCCATGTGG - Intronic
1106736821 13:32596327-32596349 TATTTTGAGATTCATCCATGGGG + Intronic
1107471842 13:40698287-40698309 TTGTTTCAAAATAATCCAGGAGG - Intergenic
1107713129 13:43170221-43170243 TTGCATGAGTTTAATCCCTGAGG - Intergenic
1108373214 13:49791869-49791891 TTGTTTGAGGGTGATCGATGGGG - Intronic
1108481283 13:50874714-50874736 AGTTTTGAGATTCATCCATGTGG + Intergenic
1108676921 13:52745057-52745079 TTGTTTGTGCTTGATACATGAGG - Intergenic
1109320057 13:60799789-60799811 GTATTTGAGATTAATCACTGTGG - Intergenic
1111149183 13:84226219-84226241 TTGTTTGAAATTTCTCCAAGTGG + Intergenic
1111625748 13:90784138-90784160 TTTTTTGAAATTATTACATGTGG + Intergenic
1112292597 13:98158098-98158120 TTGCATGAGATTAATCCAAGTGG + Intronic
1114250755 14:20958464-20958486 CTGTTTTAGGTTAATGCATGAGG + Intergenic
1115202897 14:30873330-30873352 GTTTTTGAGGTTCATCCATGAGG - Intergenic
1115523994 14:34261119-34261141 TATTTTTAGATCAATCCATGTGG + Intronic
1115729467 14:36252876-36252898 GTTTTTGAGATTTATCCATTTGG - Intergenic
1117053999 14:51891705-51891727 TGTTTTGAGATTCATCCAGGTGG + Intronic
1117225686 14:53656275-53656297 GTGTTTTAGTTTTATCCATGTGG + Intergenic
1118116036 14:62777968-62777990 TTGTTTGATATTAATCCCTCTGG + Intronic
1121906248 14:97749063-97749085 CTGTTTGAAGTTCATCCATGGGG + Intergenic
1122611650 14:102987590-102987612 TTGTGTGAGATTGATTCATGTGG - Intronic
1124229398 15:27930340-27930362 TATTATGAGATTCATCCATGTGG - Intronic
1124391863 15:29266586-29266608 GTATTTGAGATTCAGCCATGTGG - Intronic
1127141488 15:55982455-55982477 TTTTTTGAGAGTCATCCATGGGG - Intronic
1128681754 15:69657550-69657572 GTGTTTGAGATTAATCCATCTGG - Intergenic
1131030464 15:89182116-89182138 TTTTTTGAGAATAATCCATAAGG - Intronic
1131297275 15:91161008-91161030 TGTTTTGAGGTTAATCCGTGGGG - Intronic
1138865701 16:60816807-60816829 TTGTTTGTGACTAATCAAGGGGG - Intergenic
1139198259 16:64946411-64946433 TTATGAGAGATGAATCCATGAGG - Exonic
1141988651 16:87596564-87596586 ATGCTTGAGATTCACCCATGTGG - Intergenic
1203143657 16_KI270728v1_random:1785375-1785397 TTTTTTAAGATTATTCCCTGGGG + Intergenic
1144569761 17:16389581-16389603 GTCTTTAAGATTCATCCATGTGG - Intergenic
1144591690 17:16529454-16529476 CTTTTTCAGATTTATCCATGTGG - Intergenic
1144744053 17:17601331-17601353 TTGTTTAGGATTAATCCCTCAGG + Intergenic
1145361969 17:22219684-22219706 GTCTTTAAGATTCATCCATGTGG - Intergenic
1146523345 17:33544175-33544197 GGTTTTGAGATTCATCCATGTGG + Intronic
1147576458 17:41602821-41602843 TTGTTTTAGATAATTGCATGAGG - Intergenic
1149098746 17:52877092-52877114 TGTTTTGAGAGTCATCCATGCGG - Intronic
1149147982 17:53520822-53520844 TTGTTTGGGGTTAATCCAGCCGG - Intergenic
1149366333 17:55948860-55948882 GTTTTTGAGCTTAATCAATGGGG + Intergenic
1149643804 17:58224157-58224179 GATTTTGAGATTCATCCATGTGG - Intronic
1149731414 17:58950406-58950428 TTGTTTGGGTTGAATCTATGTGG + Intronic
1151430594 17:74059953-74059975 TGGATGGAGATTAATGCATGGGG - Intergenic
1154272208 18:12930039-12930061 GTTTTTGAGATTCACCCATGTGG - Intergenic
1155545135 18:26906923-26906945 CTGTTGGAGATTAAGCCAGGAGG + Exonic
1155785951 18:29899692-29899714 TTGTTTTATATTAATGCATGTGG + Intergenic
1157664167 18:49471465-49471487 CTTTTTGAGATTCACCCATGTGG + Intergenic
1157968349 18:52236248-52236270 ACATTTGAGATTAATCCATGAGG - Intergenic
1158700771 18:59743918-59743940 TTGGTGGTGATTATTCCATGAGG + Intergenic
1159401210 18:67937521-67937543 TTGTTTTATATTAATTCCTGTGG + Intergenic
1159709994 18:71746328-71746350 TTGTTTGAGGTTAATGTATGTGG + Intronic
1166245934 19:41525639-41525661 ATTTTTGAGAATGATCCATGTGG - Intergenic
926310689 2:11673841-11673863 TTGTTTAACATTCATCCATATGG - Intergenic
926379949 2:12277049-12277071 TTGTTTGAAATTAACCCACTTGG + Intergenic
926439547 2:12873863-12873885 TTGTTTAAAATAAATCCTTGGGG - Intergenic
928876786 2:36049281-36049303 TAGATTTAGATTAATCCATGGGG + Intergenic
929154698 2:38778963-38778985 TTGTTTCAGATTTAGCCAGGTGG + Exonic
929480282 2:42300001-42300023 GTTTTTAAGATTCATCCATGTGG + Intronic
930574831 2:53133658-53133680 TATTTTGAGATTCATCCATGTGG - Intergenic
931455364 2:62405923-62405945 GTTTTTGAGATTGATCCAAGTGG - Intergenic
931917626 2:66975484-66975506 GTTTTTGAGATTTATCTATGTGG - Intergenic
932214243 2:69956141-69956163 TTGTTTTAGATTTGGCCATGGGG - Intergenic
932813940 2:74846573-74846595 TATTTTGAGATTCATCTATGTGG + Intronic
934159043 2:89230685-89230707 TTGTTTGGTATTAATACTTGGGG - Intergenic
934208231 2:89951740-89951762 TTGTTTGGTATTAATACTTGGGG + Intergenic
935322565 2:101903064-101903086 TTGTTTCAAACTAAGCCATGAGG - Intergenic
935374777 2:102384537-102384559 TTTTTTGTGATTTATCCATTTGG + Intronic
935948532 2:108308005-108308027 TGTTTTGAGATTCCTCCATGTGG + Intronic
936013937 2:108943733-108943755 TTGGGGGAGATGAATCCATGGGG + Intronic
937049642 2:118877915-118877937 TTCTGTAAGATTCATCCATGTGG + Intergenic
938377402 2:130817541-130817563 GTGTTTGAGATTCATTCAGGTGG - Intergenic
938553341 2:132400733-132400755 TAGTTTGAAATTAATCATTGTGG - Intergenic
941033189 2:160536400-160536422 TGGCTGGAGTTTAATCCATGGGG + Intergenic
941458617 2:165739348-165739370 TTTTTTGATATGAATCCATGAGG - Intergenic
942138466 2:172953711-172953733 TTGTTGGAGCTGAATCCCTGAGG + Intronic
943625173 2:190190340-190190362 ATGTCTGAGATTCATCCATGTGG + Intronic
943757389 2:191570661-191570683 TATTTTGAGATTCATGCATGTGG + Intergenic
946564781 2:220952338-220952360 TTGTTGGAAATTAATAAATGGGG - Intergenic
947270602 2:228329829-228329851 TAGTCTGATAATAATCCATGGGG + Intergenic
947368330 2:229419246-229419268 TTCTTTGAGATTCATTCATGAGG + Intronic
947459600 2:230292420-230292442 TTCTTTGACCTTCATCCATGAGG - Intronic
948094013 2:235319331-235319353 GTGCTTGGGATTAATCTATGGGG + Intergenic
948416828 2:237813254-237813276 GTTTTTGATATTAACCCATGAGG + Intronic
1168815162 20:731628-731650 TGTTTTGAGATTCATCCATGTGG - Intergenic
1169457147 20:5761906-5761928 TTATATGAAATTAATACATGAGG - Intronic
1169948590 20:11016038-11016060 TTGTTTGGGATAAATACCTGAGG - Intergenic
1173112553 20:40205872-40205894 TTGTTTGACATTATTCCAGAAGG - Intergenic
1174440209 20:50545501-50545523 CTTTTTCAGACTAATCCATGAGG - Intronic
1175349073 20:58305664-58305686 ATTTATGAGATTGATCCATGTGG + Intergenic
1177126689 21:17202920-17202942 ATGTTTGAGATAAATTCCTGTGG - Intergenic
1178033065 21:28550108-28550130 TTTTTTGAGATTAAAACATAAGG - Intergenic
1178679044 21:34656566-34656588 TTGGTTGAGTTCAATCCAGGTGG - Intergenic
1182396661 22:30041128-30041150 TTCTGTGAGATTTGTCCATGTGG - Intergenic
950385479 3:12655773-12655795 ATTTTTGAGGTTTATCCATGTGG - Intronic
952212047 3:31237783-31237805 TTGTTTGAGTTTGATCTCTGTGG - Intergenic
952698081 3:36293877-36293899 TTGTTTGACTTTAATGCCTGTGG + Intergenic
953604071 3:44397427-44397449 CATTTTGAGATTCATCCATGTGG + Intronic
955257777 3:57351605-57351627 ACTTTTGAGATTCATCCATGTGG - Intronic
955401779 3:58596987-58597009 GTGTTTGAGATTCATCAGTGTGG + Intronic
956049552 3:65233034-65233056 ATCTCTGAGATTTATCCATGTGG + Intergenic
956565261 3:70629672-70629694 CTGTTAGAAATTAATCCCTGGGG - Intergenic
956800081 3:72749428-72749450 TATTTTGAGATTCATCCATGTGG - Exonic
957234552 3:77568948-77568970 GTTTTTGAGGTTCATCCATGTGG + Intronic
957657234 3:83096142-83096164 TTGCTTGAGATTCATCCAAAGGG + Intergenic
957945759 3:87060371-87060393 AAATTTGAGATTAAGCCATGAGG + Intergenic
958469733 3:94502270-94502292 TATTTTGAGAATCATCCATGTGG + Intergenic
962043094 3:131727891-131727913 TATTTTGAGATTTATTCATGTGG + Intronic
962577273 3:136766480-136766502 TATTTTGAGATTCATCCATGTGG + Intergenic
962632018 3:137286931-137286953 TATTTTGAGATTCATTCATGTGG + Intergenic
964491725 3:157243301-157243323 GTTTTTGAGATTCATCCATGTGG - Intergenic
964806645 3:160617512-160617534 TTGCTTTAAAATAATCCATGAGG - Intergenic
964824176 3:160807156-160807178 TGGTTTGAGATTAAAACATTTGG + Intronic
964922089 3:161909400-161909422 TTGTTAGAGAATACTCCACGTGG + Intergenic
966356685 3:179087604-179087626 GTTTTTGCGATTTATCCATGTGG - Intergenic
966460625 3:180172310-180172332 TTTTTTAGGATCAATCCATGAGG + Intergenic
968683749 4:1941411-1941433 TTGATTTAGAGTAATGCATGAGG + Intronic
970141585 4:12988381-12988403 TTCTTAGAGATTAAACCATTAGG - Intergenic
970434181 4:16017353-16017375 TTGTTTGAGATAGATCCTTTTGG - Intronic
970654525 4:18216577-18216599 ATTTTTGAGATTAATCAATGTGG - Intergenic
970705247 4:18793821-18793843 TTGAATGAAATTATTCCATGTGG - Intergenic
972667207 4:41178159-41178181 TTGTTTAATATTGATACATGTGG - Intronic
972844921 4:42975765-42975787 TTCTTTGAGATTAAGACTTGAGG - Intronic
972978055 4:44661773-44661795 GTGTTGCAGATAAATCCATGTGG + Intronic
973069454 4:45838812-45838834 ATGTATAAGAATAATCCATGTGG + Intergenic
973148945 4:46864153-46864175 TTGGTTGAAATTCATCCTTGGGG - Intronic
975107680 4:70586831-70586853 ATTTTGGAGATTAATTCATGTGG + Intergenic
978979522 4:114925396-114925418 TTGTTTCAGGTTATTTCATGTGG + Intronic
979687436 4:123526334-123526356 TTGTGTAAGATTCATCCATTTGG + Intergenic
979911388 4:126370967-126370989 TTTTTTGAGGTTCATTCATGTGG + Intergenic
981125658 4:141103266-141103288 TTTTCTGACATAAATCCATGAGG - Intronic
982989560 4:162254823-162254845 ATTTTTGAGATTGATCCATGTGG - Intergenic
984872050 4:184334307-184334329 TTATTTGAGAATAAGACATGGGG + Intergenic
986803644 5:11287023-11287045 GTTATTGAGATTTATCCATGTGG - Intronic
987665978 5:20940393-20940415 ATGCTTGAGATCAATCCATAAGG + Intergenic
987735914 5:21843112-21843134 TCATTTGAGAATAATCCAGGAGG - Intronic
988756709 5:34261785-34261807 ATGCTTGAGATCAATCCATAAGG - Intergenic
991068419 5:62449432-62449454 CTGTGTGAGATTATTCTATGGGG - Intronic
991551405 5:67840796-67840818 TTGTTTCAGATTTGTCCATTGGG + Intergenic
993293518 5:86105419-86105441 TTGTTCTAGATTTATCCATAAGG - Intergenic
993598319 5:89887885-89887907 TTGTATGGGAATAAGCCATGTGG + Intergenic
995010210 5:107248788-107248810 TTGTTTGAGTTTAATGGTTGAGG - Intergenic
995954560 5:117760274-117760296 TTTTTTGAGATTACCTCATGGGG + Intergenic
996676994 5:126187763-126187785 TATTTTGAGATTTATCCATGTGG - Intergenic
996946435 5:129075324-129075346 TTTATTGTGATTAATACATGTGG - Intergenic
996979580 5:129474194-129474216 GTTTTTGAGGTTCATCCATGTGG + Intronic
997481134 5:134185395-134185417 TGGTTAGAGATTAATGAATGGGG + Intronic
1003037032 6:2650701-2650723 TATTTTGAGATTCATCCATGTGG - Intergenic
1004768988 6:18760028-18760050 TTCTTTGACATTCATCTATGTGG + Intergenic
1004811704 6:19270053-19270075 CTGTTTGGGTTGAATCCATGTGG - Intergenic
1005359930 6:25022365-25022387 GCATTTGAGAATAATCCATGTGG + Intronic
1007049120 6:38808088-38808110 GTTTTTGAGATTCATCCATGGGG + Intronic
1008695800 6:54035127-54035149 TTGTGTAAGTTTACTCCATGAGG + Intronic
1008895492 6:56549273-56549295 TAGTTTGACATTAATCTATCTGG - Intronic
1008962042 6:57276003-57276025 ATTTTGGAGATTTATCCATGTGG - Intergenic
1009798918 6:68507858-68507880 GTTTTTGAGATTCATCTATGTGG - Intergenic
1010079837 6:71847899-71847921 TCTTTTGAGAGTAATTCATGAGG - Intergenic
1010134523 6:72535085-72535107 TTGTTTGAGATTGAGCCATATGG - Intergenic
1010864519 6:80958378-80958400 ATTTTTGAGAATCATCCATGTGG - Intergenic
1012697241 6:102402195-102402217 AGATTTGAGATTATTCCATGTGG - Intergenic
1013036001 6:106383870-106383892 GTTTTTGAGATTAGTACATGGGG + Intergenic
1013276363 6:108588869-108588891 TTGCTTGAGAACAAACCATGTGG - Intronic
1013706419 6:112840345-112840367 TTGTATGACATTGATCCTTGAGG - Intergenic
1013864903 6:114684160-114684182 GGCTTTGAGATTAAACCATGTGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014940625 6:127434259-127434281 TCTTTTTAGATTAATCCATAAGG + Intergenic
1017280462 6:152618631-152618653 TTGTTTGTTTTTAATCCAAGAGG + Intronic
1017403195 6:154088161-154088183 TATTTTGAGATTCATCTATGTGG - Intronic
1018437960 6:163780411-163780433 TTGTTTAATATTCATGCATGTGG - Intergenic
1019912460 7:4108968-4108990 TGTTTTGAGATTTGTCCATGTGG + Intronic
1021441293 7:20680106-20680128 GTTTTTGAGATTCATCCATTTGG - Intronic
1023357168 7:39378919-39378941 TTGTTTGAGATTTTCCCTTGTGG + Intronic
1025082014 7:55992106-55992128 TTATTTGTGGATAATCCATGGGG + Intronic
1026236035 7:68528182-68528204 GTCTTGGGGATTAATCCATGGGG - Intergenic
1027667004 7:81052227-81052249 TTGTTTTAGATTAGTCCCTCAGG - Intergenic
1027840421 7:83303989-83304011 TGCTTTCAGAATAATCCATGGGG - Intergenic
1028761879 7:94506511-94506533 TTGTTTTAGAGTAATACATAGGG + Intergenic
1030718326 7:112837493-112837515 TTTTTTGACACAAATCCATGTGG + Intronic
1031761887 7:125723628-125723650 TTATTAGAAATTATTCCATGTGG - Intergenic
1032261396 7:130340195-130340217 TTTTTTGAGGTTCAACCATGTGG + Intergenic
1032914909 7:136478842-136478864 TTCTTTGAGATAACTTCATGTGG - Intergenic
1033545521 7:142396015-142396037 TTGTCTGACATTCATCTATGGGG - Intergenic
1036961760 8:13251784-13251806 CTGTTTGAAAGTATTCCATGAGG + Intronic
1040065183 8:43139739-43139761 TGTTTTGAGATTTATCCATGTGG + Intergenic
1040388678 8:46931952-46931974 TGATTGGAGATTAATCCAGGTGG - Intergenic
1041233304 8:55774388-55774410 TTGTTAGAGTTAAATCCTTGTGG + Intronic
1042268107 8:66929111-66929133 TATTTTGAGATTCATCCATGTGG + Intergenic
1042655643 8:71092317-71092339 TTGTTTTAGAAGAGTCCATGTGG - Intergenic
1050866701 9:10509408-10509430 TTGTTTCAGCTTCATCCATTAGG + Intronic
1053592243 9:39526219-39526241 GTGTTTGCCATTAATCAATGTGG + Intergenic
1053850094 9:42281560-42281582 GTGTTTGCCATTAATCAATGTGG + Intergenic
1054574060 9:66839066-66839088 GTGTTTGCCATTAATCAATGTGG - Intergenic
1055530985 9:77183516-77183538 TATTTTGAGATTCATCCATGTGG + Intronic
1056891577 9:90499002-90499024 TTGGTTGAGTTGAATCCATGAGG + Intergenic
1057118398 9:92547511-92547533 GTTTTTGAGGTTCATCCATGTGG - Intronic
1057606129 9:96498985-96499007 TTGTTTGAGATGAAACCACGAGG - Intronic
1058640238 9:107076740-107076762 ATGTTTGTGATAAATCCTTGTGG + Intergenic
1059503002 9:114771731-114771753 GTTTTTGAGATTCATACATGTGG + Intergenic
1060061302 9:120462602-120462624 GTTTTTGAGATTCATCCATGTGG - Intronic
1060100651 9:120837954-120837976 TATTTTGAGATTTATCTATGTGG - Intronic
1060253806 9:122007524-122007546 TTATTTGAGATTTGGCCATGGGG - Intronic
1061683582 9:132257203-132257225 TGTTTTAAGATTTATCCATGAGG - Intergenic
1186018933 X:5232144-5232166 TTGTTTAATAATAATGCATGTGG + Intergenic
1186447734 X:9645952-9645974 TTGTTTGACATTAAACGCTGTGG - Intronic
1187284938 X:17896227-17896249 TTGTGTAAGAATAATCTATGGGG + Intergenic
1187551927 X:20314640-20314662 TTCTGTGATATTCATCCATGTGG - Intergenic
1187988068 X:24836171-24836193 GTTTGTGAGATTCATCCATGTGG + Intronic
1188188164 X:27142684-27142706 TTGTTTTAGATTATTAAATGTGG - Intergenic
1191027916 X:55935637-55935659 GTTTTTGAGATTTATCCATGTGG - Intergenic
1192354537 X:70388182-70388204 TATTTTGAGATTCATCCATGTGG + Intronic
1193302763 X:79911352-79911374 TTGTTTGAGATCACTTTATGTGG + Intergenic
1193892806 X:87071745-87071767 TTGTATGAGAAGAATCAATGTGG + Intergenic
1195097951 X:101524251-101524273 TTCTTTGAGATTATTCCATTTGG - Intronic
1195697626 X:107678524-107678546 TTGTCTGAGAAGGATCCATGAGG + Intergenic
1199825380 X:151493554-151493576 TATTTTGAGATTAATTCATGTGG + Intergenic
1200017257 X:153176584-153176606 GAGTTTGAAATTAATACATGAGG + Intergenic
1200891842 Y:8332318-8332340 TTATTTCATAATAATCCATGTGG - Intergenic