ID: 1106356708

View in Genome Browser
Species Human (GRCh38)
Location 13:28990194-28990216
Sequence ACAGCTCCTTCCGAAGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106356708_1106356710 10 Left 1106356708 13:28990194-28990216 CCTGGGACTTCGGAAGGAGCTGT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1106356710 13:28990227-28990249 TGACTCTTTTCTATGCAATTAGG 0: 1
1: 0
2: 0
3: 32
4: 415
1106356708_1106356712 30 Left 1106356708 13:28990194-28990216 CCTGGGACTTCGGAAGGAGCTGT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1106356712 13:28990247-28990269 AGGGACAGAGTCTATGTGAGAGG 0: 1
1: 0
2: 3
3: 23
4: 205
1106356708_1106356711 11 Left 1106356708 13:28990194-28990216 CCTGGGACTTCGGAAGGAGCTGT 0: 1
1: 0
2: 1
3: 11
4: 143
Right 1106356711 13:28990228-28990250 GACTCTTTTCTATGCAATTAGGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106356708 Original CRISPR ACAGCTCCTTCCGAAGTCCC AGG (reversed) Intronic
900488364 1:2934284-2934306 ACAGCTGCTCCCGAAGACCGTGG - Intergenic
901448253 1:9320965-9320987 AAATCTCCTTCCCGAGTCCCTGG + Intronic
901662014 1:10804490-10804512 ATAGCCACTTCCGGAGTCCCAGG - Intergenic
902387827 1:16085830-16085852 ACTGCTCCTCCCCATGTCCCTGG + Intergenic
904809096 1:33151637-33151659 AGAGCTCATTTCTAAGTCCCGGG + Intronic
905494170 1:38371532-38371554 AAAGTTCCTCCTGAAGTCCCTGG + Intergenic
905649730 1:39648076-39648098 ACAGCTGCTTCCCAAGCCCTGGG - Intergenic
906294559 1:44641465-44641487 ACAGCTCCTTTCCAAGTCTCTGG - Intronic
910741991 1:90529540-90529562 ACAACTGCTTCCAAATTCCCTGG - Intergenic
910742094 1:90530540-90530562 ACAGCTGCTTCCGAATTCCCTGG - Intergenic
911964851 1:104353733-104353755 ACACCTCATTCTGAAGTTCCAGG + Intergenic
915737105 1:158091888-158091910 ACAGCTCTTTCTGCAGCCCCTGG - Intronic
919939843 1:202278644-202278666 ACAGCTCATCCTGTAGTCCCTGG - Intronic
920496462 1:206458512-206458534 CCCTCTCCTTCCGAAGTCCCTGG + Intronic
1068639191 10:59382970-59382992 ACAGCTTCATCCAAAGTCACAGG + Intergenic
1072107749 10:92290749-92290771 GAAACTCCTTCCGAAGCCCCCGG - Intronic
1073469476 10:103713928-103713950 TGAGCTACTTCTGAAGTCCCGGG + Intronic
1074049194 10:109867128-109867150 AAAGCCCCTTGCTAAGTCCCTGG + Intronic
1077072186 11:680303-680325 TCAGCTCCTTCCTGAGGCCCTGG - Intronic
1077328520 11:1973913-1973935 ACAGCTCCCTCCCAAGGCCAGGG + Intronic
1077644238 11:3909368-3909390 ATATCTCCCTCCTAAGTCCCAGG + Intronic
1078445793 11:11404030-11404052 ACAGCTCCCTCAGAAGAGCCAGG - Intronic
1078858374 11:15225057-15225079 AGAGCTCCTTCCGGACTCACAGG + Intronic
1079011082 11:16828828-16828850 GCAGCTCCAACCCAAGTCCCAGG - Intronic
1079686487 11:23365276-23365298 CCAGCTTATTCTGAAGTCCCAGG + Intergenic
1080391052 11:31847076-31847098 GCAGCTCCTTCCCAAATCCCAGG - Intronic
1082027265 11:47581949-47581971 ACAACTACTTCCAAAGGCCCAGG - Intronic
1083148037 11:60773189-60773211 AGACCTCCTCCCGAGGTCCCAGG + Intronic
1084519998 11:69657211-69657233 TCAGCTCCGTCCAAGGTCCCTGG + Intronic
1087067716 11:94043339-94043361 AGAGATCCTTCACAAGTCCCTGG + Intronic
1087473089 11:98601562-98601584 AATGCTCCTTCCATAGTCCCTGG + Intergenic
1088602848 11:111498032-111498054 TCATCTCCTTCGGAAGTCCCAGG + Exonic
1202811498 11_KI270721v1_random:29092-29114 ACAGCTCCCTCCCAAGGCCAGGG + Intergenic
1092186148 12:6479994-6480016 ACAGCGCCTTCCGAATACCGGGG + Intergenic
1092206563 12:6618152-6618174 ACAGCTCCTTCAGTAATGCCAGG + Intergenic
1093057028 12:14566167-14566189 ACAGCTCATTCAGAGGTACCTGG - Intronic
1093182521 12:15983296-15983318 AAAGGTCCTTCCTAAGACCCTGG + Intronic
1096909074 12:54963784-54963806 CCAGCTCTTCCTGAAGTCCCAGG - Exonic
1097891378 12:64780838-64780860 CCAGCTCCGTCCGGAGCCCCGGG - Intergenic
1097891640 12:64782448-64782470 ACAGCTACAGCCAAAGTCCCAGG - Intronic
1097980053 12:65729197-65729219 ACTCCTCCTTCCTCAGTCCCCGG + Intergenic
1099153962 12:79151255-79151277 CCAGGTTGTTCCGAAGTCCCAGG - Intronic
1100936732 12:99678300-99678322 CCTTCTCCTTCCTAAGTCCCTGG + Intronic
1102887878 12:116535120-116535142 GGACCTCTTTCCGAAGTCCCGGG - Intergenic
1104780775 12:131418692-131418714 ACATCCCCTTCCCCAGTCCCAGG - Intergenic
1106356708 13:28990194-28990216 ACAGCTCCTTCCGAAGTCCCAGG - Intronic
1106423896 13:29607361-29607383 AAAGCTCCTTAAGAAGTGCCTGG + Intergenic
1107885630 13:44872315-44872337 AGAGCTGCTTCCGAATTCCTGGG + Intergenic
1111497525 13:89071442-89071464 ACAGCTCCTCCCTGATTCCCTGG - Intergenic
1112151333 13:96767911-96767933 TTAGCTCCTTCCAAAGACCCAGG - Intronic
1112918963 13:104586457-104586479 AAAGCTCCTTTCTAAGACCCTGG - Intergenic
1114374837 14:22133042-22133064 TCAGCTCCTCCTGCAGTCCCAGG - Intergenic
1117211346 14:53503698-53503720 ATAGCTCCTTCCAAAGTCTGTGG + Intergenic
1118758655 14:68864225-68864247 GCAGCTCCTTCCCAAGCCCTTGG + Intergenic
1119141910 14:72274782-72274804 TGAGGTCCTTCTGAAGTCCCTGG - Intronic
1119258133 14:73217601-73217623 ACAGATCCTTCCTTAGTCCCTGG + Intronic
1120136767 14:80878687-80878709 ACAGCTGCTTCCCAACCCCCTGG + Intronic
1122088110 14:99320853-99320875 GCAGCTCCTTCCAAGGACCCGGG + Intergenic
1131703965 15:94972547-94972569 ACAGCTCATTCTGACCTCCCTGG + Intergenic
1132026169 15:98406048-98406070 CCTGCTCCTTCCCAAGGCCCAGG - Intergenic
1132122208 15:99185797-99185819 ACGGCTCTTTCAGCAGTCCCTGG + Intronic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1134786814 16:16952225-16952247 ACAGGTCCTTGTGCAGTCCCAGG + Intergenic
1135752485 16:25068252-25068274 ACAGCCCCATCCGCACTCCCGGG - Intergenic
1136366608 16:29811997-29812019 ACGCCTCCTTCTTAAGTCCCCGG - Intronic
1138646141 16:58426432-58426454 TCTGGTCCTTCCCAAGTCCCTGG - Intergenic
1141710789 16:85697891-85697913 CCAGCTCCTTCTCAAGTTCCCGG - Intronic
1143773088 17:9180674-9180696 CCAGCTCCTCTCGAAGGCCCTGG - Intronic
1146514705 17:33480167-33480189 CCAGCTCCTTGCAAAGTGCCTGG - Intronic
1150591535 17:66566887-66566909 ACAGCTCCTCTCAAAGTCCCTGG - Intronic
1152365661 17:79854896-79854918 ACAGCTCCTCCTCTAGTCCCAGG - Intergenic
1155429396 18:25739833-25739855 ACATTTCCTTCCCAAGTCACTGG - Intergenic
1155989433 18:32264454-32264476 ACAGCTCCCTGAGAAGTCCAGGG - Intronic
1157324013 18:46656438-46656460 ACATCTCCTTGCAAAGCCCCAGG + Intronic
1160736913 19:667190-667212 ACAGCTCATTCTCACGTCCCAGG + Intergenic
1161050735 19:2162889-2162911 CCAGCACCTCCCCAAGTCCCCGG - Intronic
1162239522 19:9338166-9338188 ACTCCTCCTTCCCAAATCCCAGG - Intronic
1166530902 19:43542986-43543008 ACAGCTACTTCTGAAAACCCTGG + Intergenic
1167409882 19:49338467-49338489 GCAGCTCCTTCCCCAGCCCCAGG + Intronic
925156509 2:1652368-1652390 CCAGCCCCTTCCCAAGTCCCTGG - Intronic
925759408 2:7169710-7169732 ACAGCTGCTTCTGAACTGCCAGG - Intergenic
926518735 2:13883348-13883370 ACACCCCCTTCCCAATTCCCTGG + Intergenic
926616384 2:15000869-15000891 ACAGCACCTTCAGAAGGGCCTGG + Intergenic
927662408 2:25004063-25004085 TCAGCTCCATCAGAAGTACCAGG + Intergenic
927878734 2:26675828-26675850 ACAGCTCCTTCCCAAAGGCCAGG + Intergenic
928233960 2:29523993-29524015 ACAGCTGCTTCCTGAGCCCCAGG + Intronic
936560916 2:113539195-113539217 CCAGCTCCTTCCACAGACCCAGG - Intergenic
938717545 2:134034755-134034777 ACAGCTCCTTGGAAGGTCCCAGG - Intergenic
942133282 2:172901779-172901801 AGAGCTTCTTCCCATGTCCCAGG + Intronic
948944512 2:241212643-241212665 ACAGCTCATCCCCCAGTCCCGGG - Intronic
1170979396 20:21196729-21196751 CCAGCTCCTTGCCAATTCCCAGG - Intronic
1173160342 20:40647560-40647582 TCAGCTCTTTACGAAGTCCAGGG - Intergenic
1175264165 20:57692520-57692542 ACTGCTCCTTCCAAGGGCCCAGG + Intronic
1175333342 20:58179356-58179378 AGATCTCCTCCCGAAGTCCCGGG - Intergenic
1175381904 20:58569388-58569410 AGAGCTCCATCCGGAGTGCCCGG + Intergenic
1176276315 20:64271852-64271874 ACAACTCCTTCCGAGGCCCTCGG - Intronic
1179231190 21:39505245-39505267 ACTGCTCCCTCCACAGTCCCTGG - Intronic
1179334732 21:40440067-40440089 ACAACTCATTCAGAAGACCCAGG - Intronic
1180188335 21:46151244-46151266 ACAGCGACTTCCGGAGTCCCAGG - Intronic
1182755590 22:32676293-32676315 CCAGCTCCTTCCAAATACCCAGG - Intronic
1183025079 22:35058757-35058779 ACAGCTCCAGCTGAAGACCCAGG - Intergenic
1183189211 22:36310954-36310976 ACAGTTGCTTCCGCAGCCCCAGG + Intronic
1184698289 22:46151375-46151397 CCAGGTCTTTCCGGAGTCCCGGG + Intronic
962317254 3:134366674-134366696 GCAGCTACTTCCAAAGTACCTGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
977400338 4:96523722-96523744 ACAGCTCATTGCGAAGTTACGGG + Intergenic
979465171 4:121028725-121028747 ACAGCCACTTCCACAGTCCCAGG - Intergenic
981495650 4:145389231-145389253 ACAGCTCCTTCCCATGTCACAGG + Intergenic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
993742055 5:91553664-91553686 AAAGATCATTCCGAAGTTCCAGG - Intergenic
1002063873 5:176642740-176642762 ACAGCTGCTTCCCCAGCCCCAGG + Exonic
1002092332 5:176812768-176812790 GCAGCTCCTCCCGCAGGCCCAGG - Intronic
1003137265 6:3443387-3443409 ACGGCTCCTTCCAAGATCCCTGG + Intronic
1003926609 6:10882905-10882927 CCAGGTCCCTCCGAAGTCCCCGG - Intronic
1006027828 6:31158533-31158555 ACCCCTCCTTCGGAATTCCCGGG - Exonic
1006714950 6:36111842-36111864 TCACCTCCTTACGAAGTCACTGG - Intergenic
1007664658 6:43507140-43507162 CCAGTTCCCTCCCAAGTCCCAGG + Exonic
1010663455 6:78598409-78598431 ACAGCTCCTTCAGAAGAACTGGG - Intergenic
1011613404 6:89175636-89175658 ACAGCGCCTTCTGAACTACCAGG + Intergenic
1011665681 6:89630533-89630555 ACAGCTCCTGCTGGAGTCTCTGG - Exonic
1012162320 6:95901347-95901369 CCAGCTCCTGCCCCAGTCCCTGG + Intergenic
1012927146 6:105279044-105279066 AGGGCACCTTCCGAAGTACCAGG + Intronic
1017751040 6:157490857-157490879 AGAGCTCCCTCCAAAGTGCCTGG - Intronic
1017835549 6:158174182-158174204 ACAGCTGCTTCCACTGTCCCAGG + Intronic
1017949667 6:159126192-159126214 ACAGCTGCTTTCGCTGTCCCAGG + Intergenic
1021503446 7:21354852-21354874 ATAGCACATTCTGAAGTCCCAGG + Intergenic
1021510941 7:21431645-21431667 ATAGCTCCTTCTGAAGTACTTGG + Intronic
1022242894 7:28530109-28530131 ACTGCTCCTTCCAAAGTCAGAGG - Intronic
1023099272 7:36697701-36697723 AAAGCACATTCTGAAGTCCCAGG - Intronic
1023929713 7:44697810-44697832 ACAGGCCCTTCCCAAGTCCTAGG - Intronic
1026901354 7:74039179-74039201 ACAACTCCCTACGAAGTTCCAGG + Intronic
1029715729 7:102324470-102324492 TCAGCACCTTCCAAACTCCCTGG - Intergenic
1031994501 7:128220593-128220615 CCAGCTCATTCCCAGGTCCCGGG - Intergenic
1035376711 7:158411392-158411414 ACAGCTCCTTCAGCAGCCTCTGG + Intronic
1037595995 8:20354609-20354631 ACAGATCCTTCCAAGGTGCCAGG + Intergenic
1039917432 8:41870545-41870567 ACAGCTCCTTCCGTGATCCATGG - Intronic
1047825199 8:128565731-128565753 ACATCTTCTTCCCAAGGCCCAGG + Intergenic
1049891765 9:76131-76153 CCAGCTCCTTCCACAGACCCAGG + Intergenic
1050074280 9:1847366-1847388 ACAACTCCTTCCTTAGCCCCAGG - Intergenic
1051906815 9:22104889-22104911 ATAGCTCCTAGCAAAGTCCCTGG - Intergenic
1051985115 9:23075677-23075699 AAAAGTCCTTCCCAAGTCCCTGG - Intergenic
1052068793 9:24056207-24056229 GCAGTTCCTACAGAAGTCCCTGG + Intergenic
1053141961 9:35688174-35688196 TCAGCTCCCTCCCAAGTGCCAGG + Intronic
1053378887 9:37632643-37632665 ACAGCTCCTGCAAAAGTCTCGGG + Intronic
1053733189 9:41077222-41077244 CCAGCTCCTTCCACAGACCCAGG + Intergenic
1054695232 9:68354341-68354363 CCAGCTCCTTCCACAGACCCAGG - Intronic
1056233049 9:84566628-84566650 GCACCTCCCTCCGCAGTCCCAGG - Intergenic
1056778917 9:89534675-89534697 TCAGCTCCTTCCGCAGACTCTGG - Intergenic
1057597985 9:96432621-96432643 AGAGCTCTTGCCGAATTCCCTGG + Intergenic
1061133302 9:128720199-128720221 CCAGCTCCTCCAGAAGTGCCCGG + Exonic
1061483112 9:130906896-130906918 ACTGCTGCTTCCCAAGGCCCCGG + Intronic
1062008284 9:134252708-134252730 ACAGCTGCTTCCGGAGTGTCCGG + Intergenic
1187236004 X:17468019-17468041 ACAGCCCATTCCCAAATCCCTGG - Intronic
1190394174 X:49962996-49963018 TCAGCTCCTTCTGGAGTCACTGG - Intronic
1190632658 X:52402789-52402811 ACATCTCATTCAGAAGCCCCTGG - Intergenic
1200034633 X:153319510-153319532 ACAGCACCTGCCGCAGTCGCAGG + Intergenic