ID: 1106357028

View in Genome Browser
Species Human (GRCh38)
Location 13:28992665-28992687
Sequence GGGCCCAGGGGAGCATGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106357028_1106357037 28 Left 1106357028 13:28992665-28992687 CCCTCGCATGCTCCCCTGGGCCC 0: 1
1: 0
2: 1
3: 24
4: 266
Right 1106357037 13:28992716-28992738 TTAAAATTTTCTTTTTATTGTGG 0: 1
1: 1
2: 63
3: 631
4: 2818

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106357028 Original CRISPR GGGCCCAGGGGAGCATGCGA GGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900421077 1:2556219-2556241 GCGCCCCGGGGAGCAGCCGAGGG + Intronic
900534611 1:3170690-3170712 GGGCCCGGGGGAGCAGGGGAAGG + Intronic
900933171 1:5749139-5749161 GGGCCCAGGACACCATGGGAGGG - Intergenic
901971780 1:12914093-12914115 TGACCCAGGGGAGCCTGGGAAGG + Intronic
901974028 1:12930239-12930261 GGGCCCTGATGAGCATGGGAGGG + Intronic
902011152 1:13271529-13271551 GGGCCCTGATGAGCATGGGAGGG - Intergenic
902013388 1:13287647-13287669 TGACCCAGGGGAGCCTGGGAAGG - Intergenic
902783659 1:18719707-18719729 GGGCTCAGGGAAGGATGCTATGG - Intronic
902937102 1:19772428-19772450 GTCCCCAGGGGAGGATGGGATGG + Intronic
903145897 1:21371820-21371842 GGGCCTAGGGGAGGAGGGGAGGG + Intergenic
903192445 1:21664263-21664285 AGGCCCAGGGAAACAGGCGAGGG + Intronic
905772409 1:40646825-40646847 GGGCCCAGGGTAGCCTGGTAGGG - Intronic
906142382 1:43541340-43541362 GGGCCCAAGGGACCATGTGATGG - Intronic
906313025 1:44767318-44767340 GGGCCCAGGGCAGCTGGGGAGGG + Exonic
906481870 1:46204384-46204406 GGGCCCTGGGGAACCTGCCAGGG - Intronic
911025912 1:93435290-93435312 GGGCACTGAGGAGCATGGGAGGG - Intergenic
912510436 1:110185972-110185994 GGGCCCAGGAAAGCATCTGAGGG - Intronic
913045604 1:115071148-115071170 AGGCCCAGGGGAGGGTGTGAGGG + Intronic
913195406 1:116452378-116452400 TGGCCCAGGGGACCTTGGGAAGG + Intergenic
915056360 1:153134381-153134403 GGCCCCAGGGTAGCATATGATGG - Intergenic
915532302 1:156509697-156509719 GGGGACAGGGGAGCATGGCAGGG + Intergenic
915580958 1:156813244-156813266 GAGGCCAGGGGAGGATGCGGGGG - Intronic
915581244 1:156814511-156814533 GAGGCCAGGGGAGGATGCGGGGG - Intronic
919674297 1:200366337-200366359 GGGCCCAGGGCAGCATGTGCTGG + Intergenic
920101329 1:203518736-203518758 GGGCTAAGGGGAGCTGGCGAGGG - Intergenic
920355880 1:205372105-205372127 GGCCCCACGGGAGCCTGCCAGGG + Intergenic
920596053 1:207271172-207271194 GGGCCCAGGTGAGAATCCCAGGG + Intergenic
921131234 1:212221743-212221765 GGGCCCAGGACAGCCTGAGAAGG - Intergenic
921342043 1:214143886-214143908 GGGCCCATGGGGGCAAGTGATGG + Intergenic
921496778 1:215852456-215852478 GGGACCAGGGCAGCATGATATGG - Intronic
1062833913 10:623774-623796 GGGCTGAGGGGAGCAGGGGAGGG + Intronic
1063075494 10:2712621-2712643 GGGTCCAGAGGAGCCTGAGATGG - Intergenic
1067147392 10:43703335-43703357 AGGCCAAGGACAGCATGCGAAGG + Intergenic
1067227488 10:44385304-44385326 GGGCCCAGCGGAGCCTGAGAAGG - Intronic
1067242249 10:44506807-44506829 CATCCCAGGGGAGCATGTGAAGG + Intergenic
1067264301 10:44723901-44723923 GGGCCGTGGGGAGGATGGGAAGG + Intergenic
1067745810 10:48934900-48934922 GGGCACAGGCGAGCCTGGGAAGG - Intronic
1070776203 10:79111286-79111308 GGGCCCAGGTGGGCAGGCAAGGG + Intronic
1070829433 10:79409539-79409561 GGGCTCTGGGGAGCAGGTGAAGG + Intronic
1072440387 10:95448951-95448973 GGGCTCATGGGAGGATGTGAGGG - Intronic
1073776121 10:106788271-106788293 GGGCCCAGGGCAGAATGATATGG - Intronic
1075787644 10:125060967-125060989 GGCCCCAGGGGTGCACGCTAGGG + Intronic
1075877011 10:125815939-125815961 GGGCCCAGGAGAGCAGGTCATGG - Intronic
1076055098 10:127366428-127366450 GAGGCCAGGGGAGCAAGCAAAGG - Intronic
1076480028 10:130778950-130778972 GGGACAAGGGGAGCAGGCCAGGG - Intergenic
1076542816 10:131224717-131224739 GGGGCCACAGGAGCCTGCGATGG - Intronic
1076899198 10:133328806-133328828 GTTCCCAGGGGAGCCTGAGAAGG + Intronic
1077058016 11:605364-605386 GGGCCCCGAGGTGCATGCGGAGG + Intronic
1077384654 11:2263233-2263255 GAGGCCTGGGGAGCATGGGAGGG - Intergenic
1077823930 11:5783349-5783371 GGGCCCAGGAATGCATGTGATGG + Intronic
1081358509 11:42143969-42143991 GGGCCAAGGGGAGAATGATATGG - Intergenic
1081525700 11:43926020-43926042 GGCACCAGGGGAGCCTGCCAAGG - Intronic
1081969409 11:47187321-47187343 GGGCCCAGGAGAGAGTGGGAGGG - Intergenic
1082004920 11:47414158-47414180 GTGCCCAGGGGAGCAGGCCCAGG - Intronic
1082008962 11:47437826-47437848 GGGCCCAGGGGAGCAGCCCTGGG + Exonic
1083304011 11:61753459-61753481 AGCCCCAGGAGAGCATGCTAGGG - Intronic
1083902368 11:65649874-65649896 GGACCCAGGAGAGCAGGGGAGGG + Intronic
1084149433 11:67281308-67281330 GGGGCCAGAGGAGCCTGCGGGGG - Intronic
1084204541 11:67584084-67584106 GAGCCCGGGGGAGGATGCCAAGG - Intronic
1085119324 11:73957177-73957199 CGGCCCAGGGGAGCATCAGGCGG + Intronic
1086933710 11:92722008-92722030 GGGGCCAGGGGAGAATGATATGG - Intronic
1088328868 11:108629344-108629366 GGGCACTGAGGAGCATGGGAGGG - Intergenic
1088644642 11:111908001-111908023 GGCCCCGGGGGAGCAGGAGATGG - Intergenic
1088689219 11:112311091-112311113 GGGCCGAGGGGAGCCTGGGCTGG + Intergenic
1088850610 11:113700330-113700352 GGGCACAGGGGAGCCTGGCAAGG - Intronic
1090306247 11:125693574-125693596 GGGACCAGGTGAGCAGGTGATGG + Intergenic
1091449514 12:563561-563583 GGGCCCAGGTGGGCGTGCCAAGG + Intergenic
1092631838 12:10388030-10388052 TGGTTCAGGGGTGCATGCGAAGG + Intronic
1095534013 12:43224607-43224629 GGGCGCAGTGGAGCAGGGGATGG - Intergenic
1095959714 12:47826646-47826668 GGGCCCAGTGGAGCAAGTAATGG - Intronic
1097195081 12:57238675-57238697 GGGCACAAGGAAGCAGGCGAGGG - Intronic
1097641283 12:62185301-62185323 AGGCCAAGGGGAGAATGAGAGGG - Intronic
1099561005 12:84174044-84174066 GGGCACTGAGGAGCATGGGAGGG - Intergenic
1102058654 12:109915596-109915618 AGGCCCAGGGGAGCAGGGGCCGG - Intronic
1103582943 12:121929644-121929666 GGGCTCAGGGGAGGAAGGGAGGG - Intronic
1103669859 12:122604703-122604725 GGCACCAGGGCAGCATGAGAAGG - Intronic
1104801117 12:131555877-131555899 GGGTCCAGGGGAGGATGCCAGGG - Intergenic
1105426337 13:20298141-20298163 TGGCCAAGGGGAGAAGGCGAAGG - Intergenic
1105694244 13:22872321-22872343 GGGCCCAGGGAAGAATGATATGG + Intergenic
1106226502 13:27790626-27790648 GGGCCCAGGGGTGCAAGGGGCGG - Intergenic
1106357028 13:28992665-28992687 GGGCCCAGGGGAGCATGCGAGGG - Intronic
1108604243 13:52021512-52021534 GGGCAAAGGAGAGCATGGGAAGG + Intronic
1110792351 13:79600191-79600213 GGGCGCAGTGGAGCAGGGGATGG + Intergenic
1113593945 13:111518295-111518317 GGGCCCAGGTGAGGATGCTGGGG - Intergenic
1113693255 13:112326775-112326797 GGGCACACGGGAGTATACGAGGG + Intergenic
1114523505 14:23352994-23353016 GGGCCCAGGGGAGGGAGGGAAGG + Intergenic
1116260126 14:42614075-42614097 TGGCCCAGGGAGGCATGCGATGG + Intergenic
1116833963 14:49750178-49750200 AGGCCCTGAGGACCATGCGAAGG - Intronic
1119133255 14:72193872-72193894 GGGACCAGGGATGCATGCAAAGG + Intronic
1119747125 14:77052501-77052523 GGGCCTAGGGCAGCATGGGCAGG + Intergenic
1121117337 14:91352962-91352984 GGGCCCCGGGGAACTTGTGAGGG - Intronic
1122038087 14:98962750-98962772 CAGCCCAGGGGAGCACGCGCGGG + Intergenic
1122129399 14:99596377-99596399 TGGCCCTGGGGAGGAAGCGAGGG - Intronic
1122355908 14:101122738-101122760 GGGCCCAAGGGAGCCTGCGGTGG + Intergenic
1123783326 15:23646679-23646701 GGGCCCTGGGGAACCTGCGGAGG + Exonic
1125728612 15:41880701-41880723 GGGCCCAGCGGAGGAAGCGAAGG - Intronic
1126106834 15:45152254-45152276 GGGCCCAGGCAGGCAAGCGAGGG - Intronic
1129738855 15:77980171-77980193 GGGCCCAGGGGAGATGGGGAAGG - Intergenic
1129847105 15:78773010-78773032 GGGCCCAGGGGAGATGGGGAAGG + Intronic
1130651800 15:85766331-85766353 GGGCCCAGGACAGCATGAGCCGG + Intronic
1130655534 15:85789774-85789796 GGGCTTAGGGGAGCAGGCGTGGG - Intronic
1130960308 15:88654567-88654589 GGGCTGAGCGGGGCATGCGAAGG + Intronic
1131515561 15:93074035-93074057 GGGCCCAGGGAACCTTGGGAAGG - Exonic
1131787771 15:95931603-95931625 GGGTCCAGGGGAGAATGCTGTGG + Intergenic
1132155989 15:99495544-99495566 AGGCCCAGGGGAGCATCCACAGG + Intergenic
1132381245 15:101368271-101368293 GGCCCCAGGGGAGCGGGAGAGGG + Intronic
1133029727 16:3004645-3004667 GGGCCCAGGGGCTGAGGCGACGG - Intergenic
1135296439 16:21283643-21283665 GGGCTCTTGGGAGCATGCGCGGG + Intronic
1136295851 16:29301653-29301675 GGGCACAGGGGAACAGGGGAAGG + Intergenic
1138452988 16:57104908-57104930 GGGCCAAAGGAAGCAAGCGAGGG + Intronic
1140202215 16:72903910-72903932 GGGCCCAGAGGAGGAAGCGATGG - Intronic
1140410918 16:74739901-74739923 GTGCCCAGGGGAGAAGGGGAAGG - Intronic
1142101770 16:88275840-88275862 GGGCACAGGGGAACAGGGGAAGG + Intergenic
1142811563 17:2397879-2397901 GAGCCCAGGGAAGCATGTGAGGG - Intronic
1147496897 17:40925317-40925339 GGCACGAGAGGAGCATGCGAGGG - Intronic
1147658134 17:42102485-42102507 GGGCACAAGGGAACGTGCGATGG - Intronic
1147660164 17:42113062-42113084 GGGCCAAGGTGAGCCTGCTAAGG + Intergenic
1148857051 17:50584581-50584603 GGGCCCAGGGGAGCCGGGGGCGG + Intronic
1150368524 17:64613751-64613773 GGGCAGAGGGGAGCAGGCAAGGG + Intronic
1150486959 17:65550599-65550621 GGGACCAGTGGAGGATGCCAGGG - Intronic
1151366152 17:73617578-73617600 GGCTCCAGGGGAGCTTACGAAGG + Intronic
1151398106 17:73838466-73838488 GGTCCCAGGGGAGCCAGTGAGGG - Intergenic
1152069987 17:78129589-78129611 GGGCCCAGGAGGGCAGGAGAGGG + Intronic
1152334640 17:79693476-79693498 GGGCACAGGGGAGCCTGGGCAGG + Intergenic
1152582609 17:81173237-81173259 GGGGCCAGGGAACCATGCCAGGG - Intergenic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1154025861 18:10706449-10706471 GGGCCAAGGAGAGCTTGCGTGGG - Intronic
1154299709 18:13182448-13182470 GGGTCCAGGGGAGCAGCCGCAGG - Intergenic
1155579787 18:27290277-27290299 GTGCCCAGGGGAGGCTGGGAAGG + Intergenic
1157006468 18:43589850-43589872 GGGCACAGATGAGCATGGGAGGG - Intergenic
1158908240 18:62034913-62034935 GGGGCCGGGGGAGAATGCTATGG + Intergenic
1160415167 18:78705001-78705023 GTGCTCAGGGCAGAATGCGATGG - Intergenic
1160452387 18:78974281-78974303 TTGCCCAGGGGAGGCTGCGAGGG - Intergenic
1160812079 19:1017278-1017300 GGGCCCATGGGAGCATTTGCAGG - Intronic
1160858013 19:1226104-1226126 TGCCCCAGGGGAGCACGGGAGGG + Intronic
1160917401 19:1503778-1503800 GGACCCAGCGGAGCCTGGGACGG - Intergenic
1161767230 19:6214444-6214466 GCGGCCAGGGGAGCATCGGAGGG - Intronic
1163795879 19:19337799-19337821 GGGCCAAAGGGAGCATGAGGAGG - Intronic
1163829479 19:19540919-19540941 GCGCCTAGGGGAGCATGGGTGGG + Intronic
1165080764 19:33304687-33304709 GAGCCCAGGGATGCATGAGAGGG + Intergenic
1166735195 19:45079748-45079770 GGCCCCAGGGGAGAAGGGGAGGG + Intronic
1168404209 19:56102490-56102512 GGGCCCAGGTTTGCTTGCGAAGG - Intronic
925360653 2:3278172-3278194 AGGCCCAGGGGAGTCTGAGATGG + Intronic
925546789 2:5024889-5024911 GGGAGCAGGGGAGCATGCTGAGG + Intergenic
925686581 2:6479775-6479797 GGGCACAGGGAAGCATGGGGTGG - Intergenic
926231264 2:11005830-11005852 GGGCGCAGGTGTGCATGCGTGGG - Intergenic
927083948 2:19656051-19656073 GGGCCAAGGGCAGAATGCTATGG - Intergenic
927263956 2:21123912-21123934 GGGCCCCAGGGAGCATGTGCGGG - Exonic
927909593 2:26887438-26887460 AGGCCCAGGGGAGCTGGGGAAGG + Intronic
930544221 2:52746449-52746471 GGGGCCAGGGGAGAATGACATGG + Intergenic
932485266 2:72080824-72080846 GGGCACTGAGGAGCATGGGAGGG + Intergenic
933440659 2:82309488-82309510 GGGCCGAGGGGAGCAAGAAATGG + Intergenic
935296825 2:101656978-101657000 GGGACCAGGAGAGCCTGCAAAGG - Intergenic
937305486 2:120867947-120867969 GGACCCAGGCGAGCGTGCCAGGG + Intronic
939175323 2:138741210-138741232 GGGACCAGGGAAGCATGCAGGGG + Intronic
940049721 2:149449386-149449408 GGGCCCGGGGGTACAGGCGAAGG - Intronic
940826164 2:158415453-158415475 GGGGCCAGGGGAGAATGTTATGG - Intronic
941439374 2:165514373-165514395 GTGCCCAGGGGGGCCTGCAAAGG + Intronic
946227050 2:218269729-218269751 GGGCCAAGGGGATGATGGGAAGG + Intronic
947369382 2:229428843-229428865 AGGATCAGGGGAGCATGGGATGG + Intronic
948188275 2:236038479-236038501 GGGCCGAGGGCAGCATTCTAAGG - Intronic
948537747 2:238658732-238658754 GTGTCCAGGAGAGCATGCCATGG - Intergenic
1169117155 20:3072961-3072983 GGGCCCTGGGGAGCAGCTGAAGG + Intergenic
1169228630 20:3872034-3872056 GGACCCAGGGGACAATGCGAGGG + Exonic
1169239036 20:3959013-3959035 GGGCCCAGGGCAGAATCCTAAGG - Intronic
1170313396 20:15016979-15017001 GGGCCAAGGGCAGCATGATATGG - Intronic
1171249703 20:23638255-23638277 GGGGCCAGGGGAGGAGGGGAGGG - Intronic
1171444986 20:25196487-25196509 GGGCCCAGGGGAGCGTGGAAGGG + Intronic
1172786046 20:37469563-37469585 GGTCCTAGGGGAGCAGGAGAAGG - Intergenic
1173170235 20:40717592-40717614 GGGCCCACGGCAGCCTCCGAGGG - Intergenic
1173729121 20:45316608-45316630 GGGCCCCGGGGAGCAGGGGAAGG + Intronic
1174115473 20:48223885-48223907 GGGCCAATGGGAGCATGCCCTGG - Intergenic
1175516677 20:59574639-59574661 GGGCCCAAGGGAGCAGCTGATGG + Intergenic
1176216555 20:63950865-63950887 GGCCCCAGGGGTGGATGCGTGGG + Intronic
1177037461 21:16061103-16061125 GGGCACTGAGGAGCATGGGAAGG - Intergenic
1180786038 22:18548347-18548369 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181001888 22:19991650-19991672 AGCCCCAGGGGAGCAGGCGGGGG + Intronic
1181131320 22:20734072-20734094 GGGCCAAGGGGAGCATGAACCGG - Exonic
1181242961 22:21487901-21487923 GGGCCAAGGGGAGCATGAACCGG - Intergenic
1181310496 22:21942091-21942113 GGGGTCAGGGGAGCATGCCTGGG + Intronic
1181388096 22:22559030-22559052 GAGTCGAGGGGAGCATGCGCGGG - Intronic
1181527816 22:23500229-23500251 GGGCACAGGGGAGAATGCCATGG + Intergenic
1183573468 22:38671684-38671706 GGGCCTAGAGGAGCCTGTGAAGG + Intronic
1184004831 22:41700125-41700147 CGGGCCAGGGGCGCATGCGGCGG + Intronic
1184288694 22:43486724-43486746 GGGCCCTGGGGAGGCTGGGAGGG + Intronic
949355870 3:3179793-3179815 GGCCCCAGGGGAGCAGACGGCGG + Intergenic
950142028 3:10622124-10622146 GGGCCCAGGGGAGCCTAGGGGGG - Intronic
950885747 3:16361452-16361474 GGGCCAAGGGGAGAGTGTGAAGG + Intronic
952585514 3:34887574-34887596 GGGGCCAGGGCAGAATGCTACGG + Intergenic
952901709 3:38115528-38115550 TGGGCCAGGGGAGCATGTGGGGG + Intronic
953435841 3:42876517-42876539 AGGTCCAGGGGAGCAGGCAAAGG - Intronic
953983590 3:47425456-47425478 TGGCCCAGTGGAGCCTGCTAGGG + Intronic
954303160 3:49711890-49711912 GGGCCCAAGAGAGCTGGCGATGG - Intronic
955435369 3:58894151-58894173 GGGCCAAGGGGAGAATGATATGG - Intronic
958905265 3:99935193-99935215 TGGCCCAGGGGTGCATACTAGGG + Intronic
961452615 3:127009209-127009231 GGGCCCTGGGCAGCTTGGGATGG + Intronic
961648030 3:128403040-128403062 GGGGTCAGGGGAGCATGAGGGGG + Intronic
968705504 4:2075629-2075651 GGGCTCAGGGGTGCATGCAGAGG + Intronic
968904016 4:3443477-3443499 GGGCCAAGGGGAGGATGGGGCGG + Intronic
968958292 4:3730241-3730263 TGGTGCAGGGGAGCATGAGAGGG - Intergenic
969056604 4:4406532-4406554 GGCCCCGGGTGAACATGCGACGG + Intronic
970537221 4:17041940-17041962 GGGCCTGGGGGAGCAAGGGAAGG + Intergenic
970959603 4:21856928-21856950 GGGCACCGAGGAGCATGGGATGG + Intronic
971092381 4:23360696-23360718 GGGCACTGAGGAGCATGGGAAGG + Intergenic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
976215915 4:82715371-82715393 GGGCACAGAGCAGCATGAGAAGG - Intronic
977512145 4:97974467-97974489 GGGCCCAGGGTAGAATGATATGG + Intronic
977925116 4:102691893-102691915 GGGCACAGAGAAGCATGTGAAGG + Intronic
979649011 4:123107753-123107775 GGGCACTGGTGAGCATGGGAGGG - Intronic
980698795 4:136395645-136395667 GGGCGCAGTGGAGCAGGCGGCGG - Intergenic
981630864 4:146816700-146816722 GAGCCCAGGGGAGCAAGAGAGGG + Intronic
986392938 5:7302133-7302155 GGGTACAGGTGAGCATGCTAGGG - Intergenic
986685971 5:10275410-10275432 GGGCCCAGGCCTGCATGGGAGGG + Intergenic
986878931 5:12146714-12146736 GGGCCCAGGGGAGGTTGGGTGGG - Intergenic
990077937 5:51873857-51873879 GGGCCAAGGGCAGAATGCTATGG + Intergenic
991356600 5:65775434-65775456 GGACCCAGGCGAGCAGGCTAAGG - Intronic
995058560 5:107789133-107789155 GGGCCAAGGGCAGAATGCTATGG + Intergenic
996101871 5:119452626-119452648 GGGGGCAGGTGAGCATGCGAAGG + Exonic
996713659 5:126568477-126568499 TGTCCCAGGGGAGCAAGGGAAGG + Intronic
997616174 5:135247639-135247661 TGGCCCAGAGGAGCAGGCCAAGG + Intronic
997877510 5:137562749-137562771 TGGCCCAGGCTAGCATGCAATGG + Intronic
999444457 5:151628269-151628291 GGGACCAGGGGAGCCTGCCATGG - Intergenic
1000039867 5:157477584-157477606 TTCCCCAGGGGAGCCTGCGAAGG - Exonic
1000295437 5:159909323-159909345 GGCCCCAGGGGAGCAAGGCAAGG - Intergenic
1000343919 5:160298511-160298533 AGGCCCAGGGGAGCAGGCGCTGG - Intronic
1002443696 5:179277048-179277070 AGGCCCAGGGCAGCATCAGATGG - Intronic
1002783530 6:384405-384427 GGGACCAGGTGGGCATGCTAAGG + Intergenic
1003962778 6:11224465-11224487 TGCCCCAGGGGAGCATGCAAGGG + Intronic
1004148118 6:13089170-13089192 GGGCCCAGGGCAGGAAGAGACGG - Intronic
1004249908 6:14015335-14015357 GGGCCCAATGGAGGTTGCGAGGG - Intergenic
1006918644 6:37613335-37613357 GGGCCCAGGGGAGTCAGAGAGGG - Intergenic
1006942722 6:37763563-37763585 CAGCCCAGGGGAGGATGGGATGG - Intergenic
1007982920 6:46177601-46177623 GGGCCCAGGTGTGCTTGTGAAGG + Intergenic
1009892980 6:69711316-69711338 GAGCTCAGGGGAGCAAGAGAGGG + Intronic
1010926821 6:81753862-81753884 GGGCAGAGGGGAGAATGCCAGGG + Intergenic
1013188456 6:107782373-107782395 GAGCTCAAGGGAGCATGAGAAGG + Intronic
1014133667 6:117863722-117863744 GGGCCCAGGGCAGAATGATATGG - Intergenic
1017446315 6:154510203-154510225 GGGCGCAGGGGAGCAGCCGCGGG - Exonic
1018632818 6:165835340-165835362 GGGCCCAGGGCAGCCTGGGATGG - Intronic
1019379526 7:713541-713563 TGGACCAGGTGAGCATGGGAGGG - Intronic
1019379536 7:713599-713621 TGGACCAGGTGAGCATGGGAGGG - Intronic
1019379545 7:713657-713679 TGGACCAGGTGAGCATGGGAGGG - Intronic
1019379626 7:714053-714075 GGGCCGCGGGGAGCACGTGATGG - Intronic
1019428528 7:988225-988247 GGGCCCCGGGGAAGATGGGATGG - Intronic
1019514470 7:1433679-1433701 GGGCCCTGGGGAGCTTGTGCTGG - Intronic
1019523850 7:1472069-1472091 GGGCCCAGGGGAGCTGGAGGTGG - Intronic
1019702289 7:2479884-2479906 GGGCCGAGGGGAGCACCAGACGG - Intergenic
1022715110 7:32891768-32891790 GGGCCCTGAGGAGCGTGCGGCGG - Exonic
1023288299 7:38642744-38642766 GGGGCCAGGGGTGCATGTGTGGG - Intergenic
1023940022 7:44763280-44763302 GGGCCCAGGGGTGCCAGGGATGG - Exonic
1027912429 7:84268441-84268463 GGGCCCAGGTGAAAATGAGAGGG + Intronic
1029492966 7:100882271-100882293 GGGGCCAGGGGGACATGCCAGGG - Intronic
1032074860 7:128831482-128831504 GGGCCGAGGGGAGCTGGCGCGGG + Intronic
1033030450 7:137820938-137820960 GGCCCCAGGGGAGGAGGGGAGGG - Intronic
1033755501 7:144395866-144395888 GGGCTAAAGGGAGCATGAGAAGG - Intergenic
1034938145 7:155212832-155212854 GGGGCCAGGGGAGCCGGAGAGGG + Intergenic
1035119579 7:156555213-156555235 GGGCCCAGGGTTGGATGGGAGGG + Intergenic
1035644830 8:1210781-1210803 GGGCCCAGGGGAGCTGTGGAAGG - Intergenic
1038963553 8:32548210-32548232 GAGGCCAGGGGAGGGTGCGAAGG + Intronic
1040329186 8:46377258-46377280 GGGCCCAGGGTGGCATGGGTGGG + Intergenic
1040579514 8:48685889-48685911 AGGGACAGGGGAGCATGCCAGGG - Intergenic
1048870593 8:138793902-138793924 GGTCCCAGAGGAACATGGGAAGG + Intronic
1049223683 8:141439682-141439704 GGGCCCAGGGTACCATGCAGTGG - Intergenic
1049241060 8:141537559-141537581 GGGCTGAGGGGAGAATGAGAGGG + Intergenic
1049382813 8:142325820-142325842 GGGCCCTGGAGAGCATGAGAGGG + Intronic
1049382837 8:142325921-142325943 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382863 8:142326021-142326043 GGGCCCTGGAGAGCATGAGACGG + Intronic
1049382895 8:142326165-142326187 GGGCCCCGGAGAGCACGAGACGG + Intronic
1049382908 8:142326215-142326237 GGGCCCTGGAGAGCATGAGACGG + Intronic
1049382956 8:142326415-142326437 GGGCCCCGGAGACCATGAGACGG + Intronic
1049383008 8:142326616-142326638 GGGCCCCGGAGAGCATGAGACGG + Intronic
1049746422 8:144265131-144265153 CCGCCCAGGGGAGCAGGTGAGGG + Intronic
1049789350 8:144465837-144465859 GGGCCTGGGCGAGGATGCGATGG + Intergenic
1050266744 9:3898710-3898732 GGGTCCAGGGGAGCGTCCCACGG + Exonic
1052157742 9:25215586-25215608 TGGCCCAGGGGACAATGAGATGG - Intergenic
1052404724 9:28045015-28045037 GGGCCCAGGGGAGCGAGTGTGGG + Intronic
1056281233 9:85042890-85042912 GTGCCCAGGGGAGCTAGAGAGGG - Intergenic
1056473635 9:86930506-86930528 GGGACCAGGGGAGAAGGGGATGG + Intergenic
1057226909 9:93297219-93297241 ATGCCCAGGGGAGGATGCAAAGG - Intronic
1057282484 9:93722855-93722877 GGGCCCAGGTCAGCAGGGGATGG + Intergenic
1059427329 9:114229376-114229398 GGGCCAAGGGGACTATGTGATGG - Intronic
1059434525 9:114267999-114268021 GGGCCCAGGGGAGCCCGCAGAGG + Intronic
1059732829 9:117073747-117073769 GGGCCTGGGGGAGCAGGCGGTGG + Intronic
1061256426 9:129456240-129456262 GGGCACAGGGGAGCATGCCATGG - Intergenic
1062004486 9:134232327-134232349 GGGCCCGGGGGAGCAGGAGGGGG - Intergenic
1062168945 9:135123729-135123751 AGGGCCAGGGGAGGATTCGATGG - Intergenic
1189534684 X:41923773-41923795 GGGCCGAGCGGCGCATGCGCGGG + Intergenic
1195397032 X:104422183-104422205 GGGCCCAGGGGAGATGGGGAAGG + Intergenic
1199871059 X:151899422-151899444 GGGGCCAGGGCAGCAAGTGAGGG - Intergenic
1200114320 X:153763459-153763481 GGACCCAGGGCAGGAGGCGAAGG - Intergenic
1200834131 Y:7716554-7716576 GGGCCAAGGGGAGAGTGTGAAGG + Intergenic