ID: 1106360761

View in Genome Browser
Species Human (GRCh38)
Location 13:29028511-29028533
Sequence CTGAAGCAGCAGAGTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 686
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106360761_1106360764 2 Left 1106360761 13:29028511-29028533 CCTTTCTCACTCTGCTGCTTCAG 0: 1
1: 0
2: 3
3: 58
4: 624
Right 1106360764 13:29028536-29028558 CCTTTGCACCTCCCTCTGCTTGG 0: 1
1: 0
2: 6
3: 41
4: 370
1106360761_1106360768 27 Left 1106360761 13:29028511-29028533 CCTTTCTCACTCTGCTGCTTCAG 0: 1
1: 0
2: 3
3: 58
4: 624
Right 1106360768 13:29028561-29028583 TGTTCTCCCAGTTATCCAGATGG 0: 1
1: 0
2: 3
3: 64
4: 1453

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106360761 Original CRISPR CTGAAGCAGCAGAGTGAGAA AGG (reversed) Intronic
900893089 1:5463742-5463764 CTTAATCAGCAGTGTGAAAACGG - Intergenic
901287525 1:8092830-8092852 CTGCAGCAGCTGAGTATGAACGG - Intergenic
901681536 1:10915742-10915764 CAGAAGCAGGAGGGAGAGAAGGG + Intergenic
902127381 1:14227305-14227327 CAGAAGGAGCACAGTGAGAATGG + Intergenic
902357589 1:15916834-15916856 ATGAAGCAGCAGGCTGAGCATGG + Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
902703241 1:18187326-18187348 CTTTATCAGCAGAGTGAAAACGG - Intronic
904192305 1:28755057-28755079 CTGAACCAGGACAGTGGGAACGG + Intronic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904432414 1:30472976-30472998 CTGAAGGAGCAGAAAGGGAAGGG - Intergenic
904734901 1:32624186-32624208 CTTTATCAGCAGCGTGAGAATGG + Intronic
904841160 1:33372821-33372843 CTGAGGCTGCAGAGTGACAGAGG - Intronic
905008805 1:34732767-34732789 CTTTATCAGCAGTGTGAGAACGG - Intronic
905519320 1:38586052-38586074 GGGAAGGAGCAAAGTGAGAAGGG - Intergenic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
907466438 1:54640882-54640904 CTGAAGCAGCAGAAGGAGACTGG + Intergenic
907585815 1:55616835-55616857 CTTTATCAGCAGTGTGAGAACGG + Intergenic
907726056 1:57021669-57021691 CTTTATCAGCAGCGTGAGAATGG + Intronic
908094844 1:60726946-60726968 CTCAAGCATCAGAGTTTGAATGG + Intergenic
908723309 1:67148809-67148831 CAGTAGCAGCAGTGTTAGAACGG + Intronic
908735009 1:67267346-67267368 CAGAAGCAAGAGAGAGAGAAGGG - Intergenic
909342241 1:74545162-74545184 TTGAACCAGTAGACTGAGAAAGG + Intergenic
909402843 1:75253380-75253402 CTGAAATATCAAAGTGAGAAGGG + Intronic
909927137 1:81450566-81450588 GTGAGGCAGCACTGTGAGAAAGG - Intronic
910643659 1:89490455-89490477 CTTAATCAGCAGCATGAGAATGG - Intergenic
910750270 1:90621484-90621506 CTCAAGAAGAAGAGGGAGAAAGG - Intergenic
911122233 1:94308321-94308343 CTGAAGCAGCGGATGGGGAAGGG - Intergenic
912738664 1:112173683-112173705 CTGCTGAAGCAGAGTGGGAAAGG - Intergenic
913125525 1:115784148-115784170 CTGAAAGAGCAGAGAGAGGAGGG + Intergenic
915034313 1:152909611-152909633 CAAAAGCAGCAGAGAGAGAAGGG - Intronic
915199810 1:154219113-154219135 CTAAAGAAGCAGAATGAGAGTGG + Intronic
915457680 1:156051484-156051506 GTAAACCAGCAGAGGGAGAAAGG + Intronic
916008200 1:160680864-160680886 CTGAAACATCAGGGTGAGCAGGG - Intronic
916046697 1:161005327-161005349 CCGGGGCAACAGAGTGAGAAAGG - Intronic
916184771 1:162120442-162120464 CTTTATCAGCAGAGTGAAAATGG - Intronic
916636083 1:166670156-166670178 CTGAAGCAGGTGAGTGTGCAGGG + Intergenic
917245709 1:172998023-172998045 CTTTATCAGCAGTGTGAGAAAGG + Intergenic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917334870 1:173916505-173916527 CTGAAGAAGCAGAGAGAGAGAGG + Intronic
917685163 1:177408402-177408424 CTGAAGGATGAGAGTGAGCAGGG - Intergenic
917730538 1:177870605-177870627 CGGAAGCAGAAGGATGAGAAAGG + Intergenic
917834433 1:178930152-178930174 ATGAAGCAGCAGAGAGAGCCTGG + Intergenic
917923849 1:179772502-179772524 CTGAATCAGCAGATTTGGAATGG - Intronic
918114693 1:181485742-181485764 CCGTAGAAGCCGAGTGAGAAAGG - Intronic
919783850 1:201244260-201244282 CTGAAGGAGGAGAGAAAGAATGG - Intergenic
920676086 1:208039706-208039728 ATCAAGCAGCAGATGGAGAAGGG - Exonic
920885778 1:209926641-209926663 CAGAAGCAGCACAGGTAGAATGG - Intergenic
921078517 1:211719859-211719881 CTTTATCAGCAGTGTGAGAATGG + Intergenic
922362983 1:224840013-224840035 CTGAATCAGAAGAGAGCGAAGGG + Intergenic
922609385 1:226913175-226913197 CTCATGCAGTAAAGTGAGAAGGG + Intronic
922677828 1:227563624-227563646 CTGCAGCAGCAGAGTCACCAGGG - Exonic
923062580 1:230489426-230489448 GTGGAGCAGGAGAGAGAGAACGG - Intergenic
923112568 1:230903920-230903942 CTGAAGCTGCTGAGTGAAAAGGG + Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923308439 1:232709955-232709977 TTGAAGCATCTGAGTGAGCAGGG - Intergenic
923949153 1:238927487-238927509 CTGTATCAGCAGTGTGAAAATGG - Intergenic
924039815 1:239973345-239973367 CTGAAGCAGCACTGTGTGGAGGG - Intergenic
924449538 1:244165150-244165172 CTTAATCAACAGAGTGAGGAAGG + Intergenic
924509936 1:244721910-244721932 CTGAAGCAGCAAAGTGGGGAAGG - Intergenic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
924948832 1:248864269-248864291 CTGAATGAGCAGTGTGAGGAGGG - Intergenic
1062998038 10:1886162-1886184 CTGAAGCAAAGTAGTGAGAACGG - Intergenic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1063780996 10:9324287-9324309 CAGAAGCAGATCAGTGAGAATGG + Intergenic
1064791572 10:18962427-18962449 CTTAATCAGCAGTGTGAAAATGG - Intergenic
1065454862 10:25896524-25896546 CTGAAACAGCAGATCGACAATGG - Intergenic
1065624851 10:27619829-27619851 CTGGAGCAGGAGAGAGAGACGGG + Intergenic
1065895640 10:30160989-30161011 CTGAAGCAGAAGAGTGGGCACGG + Intergenic
1066062978 10:31740451-31740473 GTCATTCAGCAGAGTGAGAAGGG + Intergenic
1066113016 10:32213989-32214011 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1066484849 10:35833447-35833469 CTGCAGCAGCAAAGTGACCAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1067724662 10:48761014-48761036 CTGAGGTAGAAGAATGAGAATGG + Intronic
1067833777 10:49625450-49625472 CTGAAGGAGAGGAGTGGGAAGGG - Intronic
1068033756 10:51735019-51735041 CTGAAGAAGCAGAGTGAGATAGG + Intronic
1068049185 10:51927445-51927467 CTTTATCAGCAGAGTGAAAATGG + Intronic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068166686 10:53340359-53340381 CGGAAGCATCAGAGTAACAATGG - Intergenic
1068434129 10:56968901-56968923 GTGAAGAAGCAGATTGAGTAGGG + Intergenic
1069867489 10:71512698-71512720 CTGAAGCAGGAGAGAGGAAAAGG - Intronic
1069994997 10:72336514-72336536 GAGAAGCAGCAGAGTGAGTGTGG - Exonic
1070032386 10:72689994-72690016 CTGATGCACCAGAGAGAGATAGG - Intergenic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070507219 10:77124822-77124844 CTTTATTAGCAGAGTGAGAACGG - Intronic
1071119405 10:82260611-82260633 CTAGAGAAGCAGAGTGAGAATGG + Intronic
1071159192 10:82726647-82726669 CTTTATCAGCAGAGTGAAAATGG + Intronic
1071400635 10:85266270-85266292 AGGAAGCAACAGAGAGAGAAGGG + Intergenic
1072313923 10:94183514-94183536 CTGAAGCTGCTAAGTGAGATGGG - Intronic
1072872910 10:99139280-99139302 CAGAAGCAGAAGGGGGAGAAAGG + Intronic
1073346844 10:102789678-102789700 ATGAAACTGCAGAGTGACAAAGG - Intronic
1075089216 10:119433870-119433892 CTTAATCAGCAGTGTGAAAATGG - Intronic
1075096195 10:119473236-119473258 GGGAAGCAGGAGAGTGAGAGAGG + Intergenic
1075371578 10:121940343-121940365 CTTTATCAGCAGTGTGAGAAAGG + Intergenic
1075580903 10:123617606-123617628 CTGAAGTGGCAGGGTGAGCAAGG + Intergenic
1075821063 10:125311732-125311754 CTGAAGAGGCATAGTGAGAGTGG - Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076546897 10:131251341-131251363 AGGAAGCAGCAGAGGGAGAGGGG - Intronic
1077615457 11:3670703-3670725 AGGAGGCAGCAGAGGGAGAAGGG - Intronic
1077746562 11:4913761-4913783 CTGAAGCAGAAGTGAGAGAGAGG - Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078369776 11:10735283-10735305 TGGTAGCAGCAGAGTCAGAATGG - Intergenic
1079517295 11:21284315-21284337 CTGGAGCATGAGAGTGTGAAAGG + Intronic
1079701743 11:23556575-23556597 CCTAAGCAGCAGAGACAGAAGGG - Intergenic
1079886686 11:25999795-25999817 CTTTAGCAGCAGCGTGAAAATGG - Intergenic
1079888976 11:26026476-26026498 CTGAATCAGCAATCTGAGAATGG - Intergenic
1080369471 11:31618448-31618470 AAGAACCAGGAGAGTGAGAAAGG + Intronic
1080399381 11:31920060-31920082 GTGAATCACCATAGTGAGAATGG - Intronic
1080431317 11:32202660-32202682 CTGTAGGAGGAGAGTGAGAGGGG + Intergenic
1080550379 11:33369267-33369289 CTGAGGCAGCACAATGAGGATGG - Intergenic
1080768712 11:35320938-35320960 CTTTATTAGCAGAGTGAGAATGG - Intronic
1081559645 11:44201775-44201797 CTGGAGCAGTAGAAGGAGAAGGG - Intronic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083301124 11:61740104-61740126 CTGAAGGAGCACAGTGGGAAAGG - Intronic
1084235049 11:67782368-67782390 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1084370668 11:68740530-68740552 CTGAAACAGCAGAGAAAGGAAGG + Intronic
1084697262 11:70763069-70763091 CTGAAGGAGCAGGGTGTGACAGG + Intronic
1085413156 11:76303513-76303535 CTGCTGCAGCCGAGTGAGACAGG + Intergenic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085659257 11:78348159-78348181 CAGAAGCAGAAGAGGTAGAAGGG + Intronic
1085810962 11:79680690-79680712 CTGAAGGAGCAGTTTGGGAAGGG - Intergenic
1086127951 11:83369006-83369028 TTGAAAGAGAAGAGTGAGAATGG - Intergenic
1086148733 11:83584739-83584761 CTGATGGAGAAGGGTGAGAATGG + Intronic
1086170050 11:83825960-83825982 CTGAAGCATCAGTGAGAGTAGGG + Intronic
1086402088 11:86469397-86469419 CTGGACCAGCTGAGTGAGCAGGG + Intronic
1086572537 11:88302056-88302078 TTGAAGGAGCAGAGAGAGAGAGG - Intronic
1086614109 11:88794177-88794199 CTGAAGCAGAATAGTGGGGACGG - Intronic
1086845094 11:91739014-91739036 CAGAAGCAGGAGGGTGGGAAAGG + Intergenic
1087402243 11:97682914-97682936 CTCAAGGAGAAGACTGAGAAAGG - Intergenic
1088916465 11:114231593-114231615 CTCAAGCAGCACTGTGAGATGGG - Intronic
1089161335 11:116439834-116439856 CTTTAGCAGCAGCGTGAAAACGG - Intergenic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089689389 11:120177828-120177850 CTGAAGCTGCAGAGAGACAAAGG + Intronic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1091085571 11:132718802-132718824 GTGAAGGAGCAGAGTCTGAAGGG + Intronic
1091264279 11:134258390-134258412 GTAAAGCAGAAGAGTGGGAAGGG - Intronic
1091848201 12:3673939-3673961 CAGAAGCAGCAGAGCGAGGTGGG - Intronic
1092754854 12:11753665-11753687 CTGAATTACCAGAGAGAGAAAGG - Intronic
1092755255 12:11757336-11757358 TAGAACCAGCATAGTGAGAAGGG + Intronic
1092835832 12:12487162-12487184 CTGATGCAGCAGAATGGGATTGG - Exonic
1092872522 12:12818658-12818680 CTGTATCAGCAGTGTGAAAAAGG - Intronic
1093092456 12:14936989-14937011 CTGAAGGAGCAGAATAAGAGAGG - Intronic
1093104168 12:15065917-15065939 CTGAGGGAGCAGAGTTAGACAGG + Intergenic
1094487188 12:30934392-30934414 CTTTATCAGCAGCGTGAGAATGG - Intronic
1094575775 12:31683773-31683795 CTGTATCAGCAGTGTGAAAACGG + Intronic
1094821233 12:34227260-34227282 CTAAAGCAGCACAGTGACAATGG - Intergenic
1095093672 12:38131519-38131541 CTAAAGCAGCACAGTGACAATGG + Intergenic
1095204179 12:39420543-39420565 CAGAAACAGCAAAGTGAGTATGG + Intronic
1095747412 12:45675193-45675215 CTAAAGGAGCAGGGTGAGCAGGG + Intergenic
1096038745 12:48495527-48495549 ATGGAGCAGGAGAGTGAAAAGGG - Intronic
1097580844 12:61454561-61454583 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1098023984 12:66183609-66183631 GCAAAGCAGCAGAGTGGGAAGGG + Intergenic
1100414341 12:94356205-94356227 CTGAAGCATCAGGGTAACAATGG + Intronic
1101190936 12:102331625-102331647 CTGAATCAGCAGAAAAAGAAGGG + Intergenic
1101568386 12:105931141-105931163 CTGGAGCAGCAAAGGGATAAAGG + Intergenic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102528828 12:113531405-113531427 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1103876646 12:124132680-124132702 CTGGGCCAGCAGAATGAGAATGG - Intronic
1104132292 12:125905965-125905987 GTGAATCAGCAGTGTGAAAAAGG - Intergenic
1104189299 12:126463654-126463676 CTGAAGAACATGAGTGAGAAAGG + Intergenic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1105472659 13:20706159-20706181 CTGAAGGACAGGAGTGAGAAGGG - Intronic
1106360761 13:29028511-29028533 CTGAAGCAGCAGAGTGAGAAAGG - Intronic
1106438700 13:29746220-29746242 CTGAAGCAGAGGATTGAAAAGGG + Intergenic
1107107448 13:36660448-36660470 CTTAAGAAGCTGAGAGAGAATGG + Intergenic
1107310707 13:39074040-39074062 CTGCAACAGCACATTGAGAAGGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1107669941 13:42734866-42734888 CTTTACCAGCAGCGTGAGAACGG + Intergenic
1109211545 13:59540817-59540839 CTGAAACAGTATAGTGACAAAGG + Intergenic
1109821857 13:67667674-67667696 CTGATACAGCTGAGTGAGCATGG + Intergenic
1110177610 13:72575903-72575925 CTGAAGCAACAGAGTGTAAGAGG + Intergenic
1110231223 13:73169448-73169470 CTGAAGCATGAGAGAGAGATGGG + Intergenic
1110399791 13:75076585-75076607 CTGAGGAAGCAGAGCTAGAAGGG + Intergenic
1111173984 13:84567952-84567974 CAGCAGCAGCAGAGTTTGAAAGG - Intergenic
1112190431 13:97172047-97172069 CTTTATCAGCAGAGTGAAAACGG + Intergenic
1112478910 13:99755944-99755966 CTTAGGAGGCAGAGTGAGAAAGG - Intronic
1112824906 13:103381319-103381341 CTTTAGCAGCAGTGTGAGAAGGG - Intergenic
1112971956 13:105272657-105272679 CTTAGGTAGCAGTGTGAGAATGG - Intergenic
1112996092 13:105576352-105576374 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1114354518 14:21892571-21892593 CAGAAGCAGGATGGTGAGAACGG + Intergenic
1114734403 14:25029124-25029146 CAGCAGCAGCAGAGTTTGAAAGG + Intronic
1115085640 14:29512233-29512255 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1115489320 14:33943900-33943922 CTGAAGCAGAAAGGTTAGAAAGG + Intronic
1115627981 14:35214529-35214551 CTTAAGCAGCAGGGCAAGAATGG + Intronic
1115998432 14:39217378-39217400 CTTTATCAGCAGCGTGAGAACGG - Intergenic
1116144893 14:41052571-41052593 CTGAAGGTGCAGAGTGAAAGTGG - Intergenic
1116655742 14:47651449-47651471 ATGAGGCAGCAGAGTGGGCAGGG + Intronic
1116746248 14:48823127-48823149 CAGAAGCAAGAGAGTGTGAAGGG + Intergenic
1117225023 14:53648350-53648372 CAGAAGGAGAAGAGAGAGAATGG + Intergenic
1117841135 14:59861444-59861466 CTTAATCAGCAGTGTGAAAATGG + Intronic
1118108579 14:62690007-62690029 CGGGATCAGTAGAGTGAGAATGG + Intergenic
1118266145 14:64296329-64296351 CTGAAGCCACCTAGTGAGAAAGG + Intronic
1118877478 14:69797423-69797445 CAGAAGCAGCAAAGTGACAAGGG - Intergenic
1119101246 14:71881716-71881738 CTTTATCAGCAGTGTGAGAATGG + Intergenic
1119350564 14:73961403-73961425 CTCTGGCAGCAAAGTGAGAAGGG - Intronic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119964749 14:78901861-78901883 ATGAAGCAACAGAGTAAGAAAGG - Intronic
1120014215 14:79451730-79451752 CTGGAGCAGCAGAATGCAAAGGG - Intronic
1120477646 14:85008525-85008547 CTTTATCAGCAGCGTGAGAATGG + Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120645288 14:87067032-87067054 CAGAGGCAGAAGAGTGATAAAGG - Intergenic
1121248524 14:92482650-92482672 GTGAAGGGGCAGAGTGAGAAAGG - Intronic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122389982 14:101373533-101373555 CTGAAGCACCAGAGTCTGAAAGG - Intergenic
1122572642 14:102717655-102717677 CTCACTCAGCAGAGGGAGAAAGG - Intronic
1123457130 15:20436430-20436452 CAGAAGCAGCACAGAGAGCATGG + Intergenic
1123485241 15:20729800-20729822 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123541729 15:21298849-21298871 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1123660932 15:22563929-22563951 CAGAAGCAGCACAGAGAGCATGG - Intergenic
1124073348 15:26416218-26416240 CAGAAGGAGCAGAAAGAGAATGG + Intergenic
1124263284 15:28211583-28211605 CAGAAGCAGCACAGAGAGCATGG + Intronic
1124314733 15:28658163-28658185 CAGAAGCAGCACAGAGAGCATGG - Intergenic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1125407524 15:39369250-39369272 CTGGAGCAGGAGAGTGGGACAGG + Intergenic
1125923058 15:43537969-43537991 CAGAAACAGAAGAGGGAGAAGGG + Intronic
1126366976 15:47904224-47904246 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1126686426 15:51252354-51252376 CTGAGGCAGAAGGTTGAGAAAGG - Intronic
1128046558 15:64623079-64623101 CTGCAGAAGCAGGTTGAGAAGGG - Intronic
1128718472 15:69927838-69927860 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1128796360 15:70469539-70469561 CTCAACCTGCAGAGTGAGCAGGG - Intergenic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1129404305 15:75304702-75304724 GTGACCCAGCAGAGAGAGAAAGG - Intergenic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129712570 15:77827997-77828019 CTGAAGGAGAAGAGTTGGAAGGG - Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131535417 15:93233120-93233142 CTGAAGCTGCAGTTTGAGATTGG + Intergenic
1131826565 15:96326389-96326411 CACAAGCAGAAAAGTGAGAAAGG - Intronic
1131915499 15:97260868-97260890 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1202950044 15_KI270727v1_random:25991-26013 CTGAGTAAGCAGAGCGAGAAAGG - Intergenic
1133721445 16:8498233-8498255 CTGCAGAAGCAGAGCGGGAATGG - Intergenic
1134566163 16:15253580-15253602 CTGAAGCATTAGAGTAAGAGGGG + Intergenic
1134736332 16:16503118-16503140 CTGAAGCATTAGAGTAAGAGAGG - Intergenic
1134931185 16:18209049-18209071 CTGAAGCATTAGAGTAAGAGGGG + Intergenic
1136550446 16:30979846-30979868 CTGCAGCAGCAGCGGGAGGAGGG + Exonic
1136854072 16:33639220-33639242 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137482953 16:48867506-48867528 CTCAAGCTGCAGAGAGAGAAGGG - Intergenic
1138158487 16:54729328-54729350 GTGAAGCAAGAGAGTGAGATGGG - Intergenic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138707129 16:58926881-58926903 CTTTATCAGCAGTGTGAGAATGG + Intergenic
1138756561 16:59493511-59493533 CTGAAGCAGAAGAGGAAGAGAGG - Intergenic
1138852151 16:60641965-60641987 ATGAATCAGCAGAGTTAGGAAGG + Intergenic
1139431099 16:66911452-66911474 CTGAAGCTGGAGAGAGAGACTGG - Intronic
1141263952 16:82479106-82479128 ATGAAACACCAGAGTGGGAAGGG - Intergenic
1142107389 16:88311920-88311942 CTTCATCAGCAGTGTGAGAATGG - Intergenic
1142111951 16:88337468-88337490 CTTTATCAGCAGTGTGAGAACGG + Intergenic
1142134158 16:88443989-88444011 CTGAAGCAGCAGGGGGAGGCAGG + Intergenic
1203115649 16_KI270728v1_random:1487659-1487681 TTTGAGCAGCAGGGTGAGAAAGG + Intergenic
1142506118 17:364352-364374 CTGAAGCAGGACAGAGAGAGGGG + Intronic
1142882844 17:2894893-2894915 TGCAAGCAGCAGAGAGAGAACGG - Intronic
1143163596 17:4886605-4886627 CGGAAGAAGCGGGGTGAGAAAGG + Exonic
1143379910 17:6489534-6489556 CTGAAGGAGGGGAGTAAGAAAGG + Intronic
1143380683 17:6494246-6494268 CTGAAGGAGGGGAGTAAGAAAGG + Intronic
1144471244 17:15543294-15543316 CTAAACCAGCAGAAAGAGAAGGG + Intronic
1144925222 17:18801399-18801421 CTAAACCAGCAGAAAGAGAAGGG - Intronic
1144995614 17:19266077-19266099 ATCAAGCAGCAGTGGGAGAAAGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1148390178 17:47266466-47266488 CAGAAGCAGAAGAGAGACAAAGG - Intronic
1149370798 17:55992015-55992037 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1150490106 17:65568529-65568551 CTGAAGCAGGAGAATGACATGGG - Intronic
1150653834 17:67026900-67026922 CTGGGGCAGGAGAGAGAGAAAGG - Intronic
1150844116 17:68637882-68637904 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1152695762 17:81793798-81793820 CTGAAGGCGCTGAGTGAGACTGG - Intergenic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153538896 18:6133983-6134005 CTTTATCAGCAGAGTGAAAATGG - Intronic
1154087049 18:11316874-11316896 GTGAAGAAGCAGAATGAAAAAGG - Intergenic
1154302598 18:13207402-13207424 CTGAGGCAGCAGAGCGGGAATGG + Intergenic
1155394035 18:25367714-25367736 CTGGAACTGCAGAGTGAGAAGGG + Intergenic
1155721154 18:29013314-29013336 CAGAAGCAGAACAGGGAGAAAGG - Intergenic
1155781090 18:29837135-29837157 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1157045706 18:44099876-44099898 CTCCAGCAGCAGCGTGAAAATGG + Intergenic
1157474404 18:48012123-48012145 CAGATGGAGCAGAGTGGGAAGGG + Intergenic
1157928150 18:51789181-51789203 CTTTATCAGCAGCGTGAGAACGG - Intergenic
1158404904 18:57152282-57152304 CAGAATCAGAAGAGGGAGAATGG + Intergenic
1158462469 18:57658353-57658375 GTGAAGCAGGAGAGAGATAAAGG - Intronic
1158551160 18:58437405-58437427 CTGACCCAGCAAAGTGAGGAAGG + Intergenic
1159629266 18:70730500-70730522 CTTTATCAGCAGTGTGAGAACGG + Intergenic
1160524271 18:79525877-79525899 CTGAACCAGCGCAGTGGGAAAGG + Intronic
1161668916 19:5593724-5593746 CTGCAGCAGCGCAGTGAGATCGG + Intronic
1161737528 19:6000774-6000796 CTGTATCAGCAGCATGAGAATGG + Intronic
1162461560 19:10816924-10816946 CTGGAGCAGCAGTGGGAGAAGGG + Intronic
1164794816 19:31017338-31017360 CTGTATTAGCAGTGTGAGAATGG - Intergenic
1164902067 19:31936654-31936676 CTTTATCAGCAGTGTGAGAATGG + Intergenic
1165740626 19:38203294-38203316 CTGCAGCTGCAGAGGGAGATGGG - Intronic
1166325277 19:42046120-42046142 CTGAAGCAGGGCAGTGGGAAGGG + Intronic
1166401475 19:42483900-42483922 CTGAATCAGTAGTGTGAGTAAGG - Intergenic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1168115642 19:54220263-54220285 CGGAAGCAGGAGAGTGGGAGTGG - Intronic
1168118629 19:54240009-54240031 CGGAAGCAGGAGAGTGGGAGTGG - Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168368359 19:55809543-55809565 CTGAAGCGGCAGATGGACAAGGG - Exonic
925536350 2:4922099-4922121 CTTTAGCAGCAGTGTGAAAATGG - Intergenic
925759206 2:7168159-7168181 CTGCAGCAGGAGGGTGAGAGTGG + Intergenic
925829956 2:7884137-7884159 CTTTATCAGCAGAGTGAAAATGG + Intergenic
926309155 2:11662083-11662105 CTGGAGCTGCTGAGTGAGGAGGG - Exonic
926638383 2:15208084-15208106 CTTTATCAGCAGAGTGAAAATGG - Intronic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927344733 2:22024747-22024769 CTGAAGCAGCAAAGTAGAAAAGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927637761 2:24828510-24828532 CTGAAGCAACAGTGTGATATGGG - Intronic
928107147 2:28477915-28477937 CTGCAGAAGCAGACTCAGAAGGG - Intronic
929145292 2:38702053-38702075 CTAAAGCAGCACAGTGAAAATGG - Intronic
929694128 2:44099711-44099733 CTGAAATAGCAGAGAGGGAATGG - Intergenic
931294232 2:60905933-60905955 CTTTATCAGCAGAGTGAAAACGG - Intronic
932038751 2:68276217-68276239 CTGAAGTGGCAGAGAGAGAATGG + Intergenic
933069732 2:77842257-77842279 CTGATGCAGTAGACTGGGAAAGG + Intergenic
933583588 2:84155032-84155054 CAGAAGCAAGAGAGAGAGAATGG - Intergenic
933934545 2:87191469-87191491 GGGAGGCAGCAGAGGGAGAAAGG - Intergenic
935626093 2:105173441-105173463 CTGTATCAGCAGTGTGAAAACGG - Intergenic
935821296 2:106895511-106895533 CTGAAACAGCTGAGTGACCAGGG - Intergenic
936094278 2:109519927-109519949 CTGAAGCATCTGCGTGAGGATGG + Intergenic
936358598 2:111774427-111774449 GGGAGGCAGCAGAGGGAGAAAGG + Intronic
936948716 2:117955047-117955069 CTTTATCAGCAGGGTGAGAATGG + Intronic
937449621 2:121991475-121991497 ATGAAGCAGCTCAGTGAGATGGG + Intergenic
938044001 2:128100133-128100155 CTAAGGCAGGAGAATGAGAATGG - Intronic
938310537 2:130285942-130285964 CTGGAGGAGCAGGGAGAGAATGG + Intergenic
938794365 2:134705771-134705793 GTTAAGCAGCTGGGTGAGAAGGG - Intronic
938987311 2:136590382-136590404 GAGAAGCAGCAGAGAGAGAGAGG + Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
940485294 2:154289338-154289360 CTTTATCAGCAGTGTGAGAATGG - Intronic
941527171 2:166620674-166620696 TTGAAGCAGGGGAGTGGGAATGG - Intergenic
942235202 2:173897413-173897435 CTGAGCCATCTGAGTGAGAAAGG + Intergenic
943149217 2:184090237-184090259 CTGAAAAAGAAAAGTGAGAAAGG + Intergenic
943293392 2:186105607-186105629 CTCCAGCAGCAGAGAAAGAAGGG + Intergenic
943959323 2:194241352-194241374 CTTTATCAGCAGAGTGAAAACGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944685586 2:202114633-202114655 CTGAAGCATCATATTGACAATGG - Intronic
945345950 2:208716828-208716850 AGGAAGCAGCAGAGTTTGAAAGG - Intronic
945397595 2:209339310-209339332 CTCTTGCAGCAGAGTGAGAAGGG - Intergenic
945938463 2:215925402-215925424 CTGTAGCAGGCGAGTGATAACGG - Intergenic
946122328 2:217527035-217527057 TTGAAGGTGCACAGTGAGAAGGG - Intronic
946699992 2:222402945-222402967 CTTTATCAGCAGTGTGAGAATGG - Intergenic
946733747 2:222733883-222733905 CTGCAGCAGGAGAGTGAGTCTGG - Intergenic
946875013 2:224120165-224120187 CTTTATCAGCAGTGTGAGAATGG + Intergenic
947277323 2:228407124-228407146 CTGTATTAGCAGTGTGAGAAAGG + Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948540944 2:238691145-238691167 CTCAAGAAGCAGAGTGAGAGAGG - Intergenic
1168889623 20:1286402-1286424 CTGCAGCTGGAGAGGGAGAAGGG + Intronic
1169971112 20:11270447-11270469 GAGAAGCAGCAAAGTGAGACAGG + Intergenic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170245052 20:14211673-14211695 GTGAGGCAGCAGAGTGAGAGAGG + Intronic
1170749348 20:19131384-19131406 CACAAGCAGCACTGTGAGAATGG - Intergenic
1170942294 20:20858511-20858533 CTGATGCAGCAGTGTGAGTAGGG + Intergenic
1171091606 20:22290684-22290706 CTGAAGGACCAGAGAGAGATAGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1171935246 20:31268938-31268960 CTTAAGGGGAAGAGTGAGAAGGG + Intergenic
1172477900 20:35252734-35252756 CTGAAGCACCGGAGTGAGGCTGG + Intronic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173913020 20:46684325-46684347 CTTTATCAGCAGTGTGAGAACGG - Intronic
1175128999 20:56775118-56775140 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1176695260 21:9969646-9969668 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1176871977 21:14091165-14091187 CTAAAGCAGCACAGTGACAATGG - Intergenic
1176976708 21:15329097-15329119 TTGAAGCAGCACACTGACAAAGG + Intergenic
1177276756 21:18922352-18922374 CTGAAGTAACAGAGTGTGATTGG - Intergenic
1177557890 21:22715395-22715417 CTTTATCAGCAGCGTGAGAATGG - Intergenic
1178005864 21:28219154-28219176 CTGAAGCAGCATTGAGAGAATGG - Intergenic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1178216379 21:30603804-30603826 CTTTATCAGCAGTGTGAGAACGG + Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178374720 21:32057227-32057249 CTTTAGTAGCAGTGTGAGAACGG - Intergenic
1178419272 21:32430488-32430510 CTTTATTAGCAGAGTGAGAATGG - Intronic
1178809432 21:35867800-35867822 CTTTATCAGCAGGGTGAGAAGGG - Intronic
1179026601 21:37683818-37683840 GTGAAGTGGCAGAGGGAGAAAGG + Intronic
1180149256 21:45939362-45939384 TTGAAGCAGCTGAGGGAGGAGGG - Intronic
1180247770 21:46559798-46559820 AGGAGGCAGCAGAGTGAGACAGG - Intronic
1181782704 22:25204740-25204762 GTGAAGCAGGGGAGGGAGAAGGG - Intronic
1181839043 22:25638748-25638770 CTGAATCAGCAGGCAGAGAAGGG - Intronic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1182294426 22:29304844-29304866 CTGAGGCAGGAGAAGGAGAATGG - Intergenic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1183180065 22:36253895-36253917 CTGAGACAGGGGAGTGAGAAGGG + Exonic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1184481191 22:44748358-44748380 CTTCATCAGCAGCGTGAGAATGG + Intronic
1184999837 22:48238617-48238639 CTGAAGCCTGAGAGGGAGAATGG + Intergenic
1185373042 22:50469679-50469701 CGGAAGCAGCAGAGCCAGATGGG + Intronic
949635446 3:5976891-5976913 CTGAAGTAGCACTGTGGGAATGG - Intergenic
949819452 3:8100225-8100247 CTCAAGCCTCAGAGTGATAATGG + Intergenic
950523084 3:13507876-13507898 CTGAGGCAGCAGAGTGGGGATGG - Intergenic
951865294 3:27300461-27300483 CTTTAGCAGCAGCGTGAAAATGG + Intronic
952152818 3:30610826-30610848 GTGAAGCAGCAGAGTCAAATGGG - Intronic
952296362 3:32066118-32066140 CTGAAGAAAGAGAGAGAGAAAGG + Intronic
952711873 3:36439789-36439811 CTGAAAAAGCTAAGTGAGAAGGG - Intronic
953279994 3:41545722-41545744 CAGAAACAGAAGAGAGAGAATGG - Intronic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
953759375 3:45674661-45674683 CTGAAGCTGCAGAGCTAGGAGGG + Intronic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955919821 3:63943867-63943889 CTGATGCAATAGAGTGAGACAGG - Intronic
956637698 3:71382567-71382589 GTGAAGCAGGAGAGTGGAAAAGG - Intronic
956803547 3:72786169-72786191 CTGAGCCAGGTGAGTGAGAATGG - Intronic
957099441 3:75809479-75809501 CAGAAGCATCAGAGTAACAATGG - Intergenic
958471174 3:94522688-94522710 CTGCAGCAGCATAGTTACAAGGG + Intergenic
958831963 3:99100126-99100148 CTTTATCAGCAGAGTGAAAACGG + Intergenic
961118627 3:124353834-124353856 GTGAAGCAGCAGAGAAATAAAGG + Intronic
961370668 3:126427902-126427924 CTGGAGCAGCAGCAAGAGAATGG + Intronic
961456669 3:127027979-127028001 ATCAAGCAGCAGATGGAGAAGGG + Exonic
961884691 3:130088897-130088919 CTTTATTAGCAGAGTGAGAATGG + Intronic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962210287 3:133471898-133471920 TTTCAGCAGCAGAGGGAGAAGGG + Intronic
962304852 3:134277004-134277026 CTGAAGGAATACAGTGAGAATGG + Intergenic
962942208 3:140135561-140135583 CTGAAGGAGGAAACTGAGAACGG + Intronic
964092871 3:152896493-152896515 CTGAAGAAGAAGAGTAAGACAGG + Intergenic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964459593 3:156909233-156909255 CTTTATCAGCAGAGTGAAAATGG + Intronic
964469312 3:157035500-157035522 CTGAAACATGAGAGTGTGAAGGG - Intronic
964739936 3:159954525-159954547 CTGAATCAGCAGATTGAGTGAGG - Intergenic
964951226 3:162296036-162296058 CTGAAAGAGCAGCATGAGAAAGG + Intergenic
965006567 3:163033984-163034006 CTTTAGTAGCAGCGTGAGAACGG + Intergenic
965382506 3:168007302-168007324 CTGAACCAGAATAGTGAGTATGG + Intergenic
965944140 3:174219234-174219256 CTGAAGCAGTAAAGTGGGGATGG + Intronic
966126623 3:176584784-176584806 CTGAAGCAACAGAGGAAGAATGG + Intergenic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
968077078 3:195821865-195821887 CTGGAGGAGCAGGGTGAGAGAGG + Intergenic
968531455 4:1094134-1094156 CTGAGGCAGGAGACTGAGGATGG - Intronic
968961953 4:3750171-3750193 CTGCAGCAGCAGGGACAGAAGGG + Intergenic
969271819 4:6108226-6108248 CAGAAGCAGCAGAGTGAGGCTGG + Intronic
969820097 4:9713391-9713413 CTTTATTAGCAGAGTGAGAAAGG - Intergenic
969846436 4:9923671-9923693 CTCAAGCAGCTGAGACAGAACGG + Intronic
969964843 4:10983505-10983527 CTGACGCTGCAGGATGAGAAAGG + Intergenic
969994684 4:11299616-11299638 CTTTATCAGCAGTGTGAGAATGG + Intergenic
970050480 4:11908785-11908807 GTGAAGGAACAAAGTGAGAAGGG - Intergenic
970548015 4:17149208-17149230 CTGTATCAGTAGAGTGAAAATGG + Intergenic
970581610 4:17478575-17478597 CTTAATCAGCAGCGTGAAAACGG - Intronic
971134674 4:23855253-23855275 CTTTAGCAGCAGAGTGAGACTGG + Intronic
971248759 4:24954068-24954090 CAGAAGGAGAAGAGAGAGAAAGG + Intronic
971546183 4:27890320-27890342 CTTAATTAGCAGTGTGAGAATGG + Intergenic
971875230 4:32300166-32300188 CTTTATCAGCAGAGTGAAAATGG + Intergenic
971996704 4:33974720-33974742 CTGTATTAGCAGTGTGAGAATGG - Intergenic
973720724 4:53720914-53720936 CTTTATCAGCAGTGTGAGAACGG - Intronic
973849356 4:54945924-54945946 CTGAAGCAGGAGAGGGCGAGAGG - Intergenic
975279105 4:72539933-72539955 CTGTATCAGCAGCGTGAAAATGG + Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975592507 4:76014596-76014618 CGGAAGGAGAAGAGAGAGAAAGG + Intronic
975937595 4:79600476-79600498 GTGAAGCAGCAGGATCAGAATGG - Intergenic
977023363 4:91785653-91785675 TTGAAGCAGAAGGGTGGGAAAGG - Intergenic
977444333 4:97110176-97110198 CAGAAGCTGGAGAATGAGAAAGG - Intergenic
978247738 4:106595292-106595314 CAGAAGAAGCAGAGTGAATAGGG - Intergenic
978261831 4:106768873-106768895 CTGACGCAGCAGAGTCATAGTGG + Intergenic
978752323 4:112264085-112264107 CTAAAACAGCAGAGAGAGAGAGG - Intronic
979185055 4:117778254-117778276 CTGAAACAGAAGATTTAGAAAGG - Intergenic
980367887 4:131829876-131829898 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
980575490 4:134680597-134680619 CTGTAGCAGGCGAGTGATAACGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
980876811 4:138670082-138670104 CTGAAGCAGAAGATTGAGGCAGG + Intergenic
981062482 4:140439924-140439946 CAAGAGCAACAGAGTGAGAATGG - Intergenic
981152731 4:141397924-141397946 CTCCAACAGCAGAGGGAGAAGGG - Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
982113784 4:152080033-152080055 CTGCAGCAGCACAGTCAGCATGG - Intergenic
982151881 4:152467439-152467461 CTTTATCAGCAGCGTGAGAACGG + Intronic
982329321 4:154163877-154163899 GTGTAGCAGCAGCGTGGGAAAGG - Intergenic
982553214 4:156828296-156828318 CTGTATCAGAAGAGTGAGATGGG - Intronic
982832776 4:160085301-160085323 CTTTATCAGCAGAGTGAAAACGG - Intergenic
983310716 4:166057556-166057578 CTGTATTAGCAGCGTGAGAATGG - Intronic
984291915 4:177807051-177807073 CAGAAGCAGCACGGTGAGAATGG - Intronic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
986817978 5:11433616-11433638 CGGGAGCAAAAGAGTGAGAAAGG + Intronic
987165660 5:15195369-15195391 CTTTATTAGCAGAGTGAGAATGG - Intergenic
987213740 5:15711192-15711214 CTTTATCAGCAGCGTGAGAATGG + Intronic
987296312 5:16555026-16555048 CTAAAGCAGAAGAGGGAGTAGGG - Intronic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
987385398 5:17324285-17324307 TTGAAGCACCATAGTCAGAAAGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
987773752 5:22337717-22337739 CTTTAGCAGCAATGTGAGAATGG + Intronic
988006121 5:25413396-25413418 ATGAAACATCACAGTGAGAAGGG + Intergenic
988335812 5:29908077-29908099 CTGAAGGAGCAGAGGGGGAGGGG - Intergenic
988623971 5:32851350-32851372 CTGAAGCAGGAAGGTGAGATGGG + Intergenic
989403643 5:41036472-41036494 CTTTATCAGCAGAGTGAAAATGG + Intronic
990264464 5:54060636-54060658 CTTTATCAGCAGAGTGAAAATGG + Intronic
990370697 5:55115112-55115134 CTGAAGCAGCTTAATGAAAAAGG + Intronic
990526921 5:56637215-56637237 CTGAATCAGGAATGTGAGAAAGG - Intergenic
990573243 5:57100175-57100197 CTGAAGAGGGATAGTGAGAATGG - Intergenic
990594796 5:57302016-57302038 CTTTATTAGCAGAGTGAGAATGG - Intergenic
990650978 5:57899231-57899253 GGGAAGCAGAAGAGTGAGATGGG - Intergenic
991247598 5:64524771-64524793 CTGAAGCAGGAGAGGGAGAGAGG - Intronic
994082023 5:95717602-95717624 CAGAGGCAGCAGAATGAGACAGG - Intronic
994265671 5:97713516-97713538 CTTTATCAGCAGAGTGAAAATGG - Intergenic
994758112 5:103819333-103819355 CTGAGGCAGGAGAGGGAGACAGG + Intergenic
994878288 5:105452295-105452317 CTTTATCAGCAGTGTGAGAATGG + Intergenic
995009279 5:107239675-107239697 CTTTATCAGCAGTGTGAGAATGG + Intergenic
995188870 5:109299396-109299418 AGGAAGCAGAAGAGTAAGAAAGG - Intergenic
996152603 5:120058210-120058232 CTAAAGCAGCAGGGTGAGAGTGG + Intergenic
997331781 5:133068696-133068718 CTGAAGCACAGGAGAGAGAAAGG + Intronic
997376884 5:133403745-133403767 CTGGAGAAGCAGAGTTGGAAGGG + Intronic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
998569613 5:143245418-143245440 CTGTATTAGCAGTGTGAGAACGG + Intergenic
999192267 5:149757170-149757192 CTGAAGCTGGAGAATCAGAAAGG + Intronic
999257012 5:150215349-150215371 GTGAAGCAGCAGATTCAGAGGGG - Intronic
999327247 5:150650883-150650905 CTGAAGCAGCGGAGAGGAAACGG - Exonic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999372840 5:151066556-151066578 ATGAAAGATCAGAGTGAGAAAGG + Intronic
999446686 5:151646022-151646044 CTGAAGCAGCAGAGGATGAATGG + Intergenic
1000118883 5:158178188-158178210 CTGTAACTGCAGAGAGAGAAGGG - Intergenic
1000483720 5:161812352-161812374 CTGAAGAATCAGAGTCTGAAGGG + Intergenic
1001306495 5:170578163-170578185 CGGAGACAACAGAGTGAGAAGGG + Intronic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1003445418 6:6179177-6179199 CTGAAGGAGCAAAGAGGGAATGG + Intronic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003912609 6:10756095-10756117 CTGAAGCAAAAGAGTCAGTATGG + Intronic
1003974707 6:11331359-11331381 CTGAAGCAACAGGGTGAGGCGGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1005002309 6:21254511-21254533 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1005449713 6:25960964-25960986 CTGGATCAGCAGTGTGAAAATGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1007166593 6:39832779-39832801 CCCAAGCAGCAGAGAGAGCAAGG - Intronic
1007981318 6:46161974-46161996 CTTAAGCAGCAGGGGAAGAAGGG + Intronic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1009344869 6:62600913-62600935 CAGAAGCCACATAGTGAGAAAGG - Intergenic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010545512 6:77150613-77150635 CAGAATCAGCGGCGTGAGAAAGG + Intergenic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1011148016 6:84240270-84240292 AGGAAGCAGCATAGTGTGAAAGG - Intergenic
1011340655 6:86309499-86309521 CAGAAGCATGAGAGTGAGAGGGG + Intergenic
1011353762 6:86452770-86452792 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1011473495 6:87730911-87730933 AAGAACCAGAAGAGTGAGAAAGG + Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1011824371 6:91288810-91288832 CTGATGCAGAAGAGTGAGAAGGG + Intergenic
1012121254 6:95369983-95370005 TTGAATCAGCAGACTGAGTAAGG + Intergenic
1012127682 6:95451652-95451674 CTTAATCAGCAGTGTGAAAACGG + Intergenic
1012687465 6:102270221-102270243 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1012919742 6:105209176-105209198 CTGAAGCAGAACAGAGAGTAGGG - Intergenic
1013900051 6:115144265-115144287 CTGAAGCAGAAGAATCAGAGAGG + Intergenic
1014694460 6:124601813-124601835 CTTAAGCAAATGAGTGAGAAGGG + Intronic
1014962309 6:127702658-127702680 CTTTATCAGCAGAGTGAAAATGG - Intergenic
1015099125 6:129453856-129453878 CACAAGTATCAGAGTGAGAAAGG + Intronic
1015292987 6:131559664-131559686 CTGAGGCAGGAGAATGAGAATGG - Intergenic
1015506630 6:133995060-133995082 CTGGAGCAGCTTCGTGAGAATGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015886537 6:137923839-137923861 CTGAACCAGCTGAGTGACACTGG + Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1015970702 6:138740439-138740461 CTTCAGCAGCAGCGTGAAAACGG - Intergenic
1016223054 6:141699318-141699340 CTGAAGGAGGAGAGTGGGAAGGG + Intergenic
1016238319 6:141895136-141895158 TGGAAGCACCTGAGTGAGAAAGG + Intergenic
1016625037 6:146156754-146156776 CTGAAACAGAGGAGAGAGAAAGG + Intronic
1016686930 6:146892251-146892273 ATGAACCAGGAGAGTCAGAAAGG + Intergenic
1016728360 6:147401087-147401109 CTGAAGCAACAGCCTGAGCAGGG + Intergenic
1017448135 6:154528178-154528200 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1017590972 6:155977633-155977655 CTGAAACAGTAGAGGAAGAAAGG + Intergenic
1018180195 6:161216585-161216607 CTTCAGCAGCAGTGTGAAAACGG - Intronic
1018297815 6:162368002-162368024 CAGAAGCAGGAGAGAGGGAAGGG + Intronic
1018573635 6:165235834-165235856 CTGTATCAGCAGTGTGAAAATGG + Intergenic
1018862145 6:167718924-167718946 CTTTATCAGCAGAGTGAAAACGG + Intergenic
1018938381 6:168289773-168289795 CTGAAACACCAAAGTGATAAGGG - Intergenic
1020261650 7:6533988-6534010 CTGAAGCAGAAGAGGGTGACGGG + Intronic
1020318069 7:6920906-6920928 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1021036686 7:15808894-15808916 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1021063676 7:16145113-16145135 CTGAAGCAGCATAGTGACCTAGG + Intronic
1021820079 7:24488111-24488133 CGGATGCAGAAGAGTGAGAAAGG - Intergenic
1022170013 7:27817388-27817410 TTGAAGCAGCAAAGTGTTAATGG + Intronic
1022471784 7:30686059-30686081 ATGAAGCAGGAGGGTGAGGATGG - Intronic
1023641638 7:42264885-42264907 GTGCAGGAGGAGAGTGAGAAAGG + Intergenic
1024153778 7:46599736-46599758 CAGAAGCAGAAGAGAGAGAGAGG + Intergenic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024438427 7:49387160-49387182 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026476486 7:70740394-70740416 CTGAAGCAGCAAAGGAAGGAAGG - Intronic
1027818198 7:83006494-83006516 ATGAAACAGCAGTATGAGAAAGG - Intronic
1028210339 7:88066741-88066763 CAGAAGCAGCAGCAAGAGAAAGG + Intronic
1028421946 7:90642957-90642979 CTGGAGATGCAAAGTGAGAAAGG + Intronic
1029463309 7:100709078-100709100 CTGGAGCAGCCCAGTGAGAAGGG - Intergenic
1029510367 7:100990851-100990873 CTGAGGTTGCAGAGTGGGAAGGG - Exonic
1029613152 7:101638392-101638414 CTGTATCAGCAGTGTGAAAACGG + Intergenic
1029865202 7:103620326-103620348 CTTCATCAGCAGCGTGAGAATGG + Intronic
1030144524 7:106340238-106340260 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030342878 7:108400768-108400790 GCAAAGCAGCAGCGTGAGAATGG + Intronic
1030549999 7:110946230-110946252 CAGAAGCATCAGAGTCAGCAGGG - Intronic
1031623249 7:123961714-123961736 CTTAATCAGCAGCGTGAAAATGG - Intronic
1032364308 7:131285061-131285083 CAGAAGCTGCAGGGTGAGGATGG + Intronic
1032468921 7:132164227-132164249 ATCAAGCAGCAGATGGAGAAGGG - Exonic
1032472299 7:132187428-132187450 CTGCAGCACCAGAGAGGGAAAGG - Intronic
1033392497 7:140941108-140941130 CTGAACCAACAGACTAAGAAGGG + Intergenic
1033642899 7:143279273-143279295 CTGGAGGAGCAGTGTGGGAAAGG + Intergenic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034970026 7:155413089-155413111 CTCCAGCAGCAGGGTGAGGAAGG + Intergenic
1036430514 8:8685475-8685497 CTGTAGCAGAACAGAGAGAAAGG - Intergenic
1036637149 8:10559218-10559240 CATAAGCAGGACAGTGAGAAAGG - Intergenic
1037455894 8:19063736-19063758 CTGAAGGTGCATAGTCAGAAAGG + Intronic
1038433526 8:27518847-27518869 CAGAAGCAGCAGAGTGCAAGAGG - Intronic
1038706417 8:29898131-29898153 CTTTATCAGCAGCGTGAGAATGG - Intergenic
1040579674 8:48687511-48687533 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1040883771 8:52236925-52236947 CTAATTCAGCAGAGTTAGAATGG + Intronic
1041727746 8:61033572-61033594 TGGAGGCAGGAGAGTGAGAAAGG - Intergenic
1041878450 8:62717902-62717924 CTTTATCAGCAGTGTGAGAATGG - Intronic
1042817780 8:72896718-72896740 TTGAAAAAGCACAGTGAGAAAGG - Intronic
1043284639 8:78514310-78514332 CTGGAGCAGGAGAAAGAGAAGGG - Intergenic
1043338026 8:79201510-79201532 CTGGACCAGCAGGGTGAGAGAGG - Intergenic
1044022989 8:87129831-87129853 CTTTATCAGCAGTGTGAGAATGG - Intronic
1044198279 8:89403968-89403990 CTGAAACAGCAGACTTATAAGGG - Intergenic
1045251067 8:100483956-100483978 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1045265454 8:100614941-100614963 CTGGGGAAGCAAAGTGAGAATGG + Intronic
1046411106 8:113844216-113844238 GTGAAGCAGGAGAGAGATAAAGG - Intergenic
1046632727 8:116637484-116637506 CTGGAGTAGGAGAGAGAGAAAGG - Intergenic
1046807207 8:118492552-118492574 GTGAAACAGCAGAGAGAGCATGG - Intronic
1047529051 8:125658729-125658751 GTACAGCAGTAGAGTGAGAAAGG - Intergenic
1047750577 8:127877294-127877316 CAGAAACAGCAGCGTGAAAAGGG - Intergenic
1047935958 8:129778402-129778424 CATAAGCAGAAGAGTGAAAATGG + Intronic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048699911 8:137077239-137077261 CTTTATCAGCAGTGTGAGAATGG + Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1050189441 9:3009669-3009691 CTTTAGTAGCAGCGTGAGAACGG - Intergenic
1051224350 9:14883243-14883265 CTGAAGCAACACAGTTAGGAGGG + Intronic
1052080962 9:24204522-24204544 CTTAATCAGCAGTGTGAAAATGG + Intergenic
1052408641 9:28094486-28094508 ATGAAGCAATAGAGAGAGAAAGG + Intronic
1052747818 9:32458006-32458028 CTAAAGAAGCAGACTTAGAAAGG + Intronic
1052862598 9:33446161-33446183 CCGAGGCAGGAGAGTGATAAAGG + Intronic
1053164394 9:35834436-35834458 GGGAAGCAGGAGAGAGAGAAAGG - Intronic
1053632238 9:39955590-39955612 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1053773523 9:41507940-41507962 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1054211650 9:62295108-62295130 CTGAAGCAGCAAAGGGCAAAGGG - Intergenic
1054313332 9:63553727-63553749 CTGAAGCAGCAAAGGGCAAAGGG + Intergenic
1055177943 9:73343467-73343489 GTGATGCAGGAGAGAGAGAACGG - Intergenic
1055427351 9:76210159-76210181 GTGAAGCAGGAGAGTCAGATAGG + Intronic
1056081448 9:83098581-83098603 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1056417014 9:86386536-86386558 CTGAAGGAGAAAGGTGAGAATGG + Intergenic
1056766201 9:89446216-89446238 CAGAGGCAGCAGAGGGAGATCGG - Intronic
1057262227 9:93591517-93591539 CTGAAGCTGCACAGTGAGTTAGG + Intronic
1057317581 9:93979619-93979641 CTGGGACAGCAGAGTGAGTATGG - Intergenic
1057577755 9:96257011-96257033 CTGGAGCAGCAGGAAGAGAAGGG - Intronic
1058076988 9:100661255-100661277 CTGTATCAGCAGTGTGAAAATGG - Intergenic
1058764652 9:108169584-108169606 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1059614641 9:115935616-115935638 CTGTATTAGCAGTGTGAGAATGG + Intergenic
1059626780 9:116075426-116075448 CTGTCCCAACAGAGTGAGAAGGG - Intergenic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1061113569 9:128593093-128593115 GAGAAGCGGCAGAGGGAGAATGG - Intronic
1061510281 9:131056912-131056934 CTGGACCTGCAGAGCGAGAAGGG - Exonic
1061648564 9:132027138-132027160 CTGAATCAACGGAGTGAGGATGG + Intronic
1061902318 9:133679188-133679210 CTGATGCAGCACAGAGAGACTGG - Intronic
1062357989 9:136174049-136174071 CTGAGGCTGCAGACTCAGAAAGG + Intergenic
1203607659 Un_KI270748v1:70683-70705 CTGAGCCAGAAAAGTGAGAAGGG + Intergenic
1186069902 X:5808362-5808384 CTGTATTAGCAGCGTGAGAATGG - Intergenic
1186148104 X:6645905-6645927 CTTTATCAGCAGCGTGAGAACGG + Intergenic
1187598299 X:20799217-20799239 CTTCATCAGCAGTGTGAGAATGG + Intergenic
1187949004 X:24453737-24453759 CTTTATCAGCAGTGTGAGAATGG - Intergenic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188562944 X:31490449-31490471 CTGAGGCAGGAGAAGGAGAATGG + Intronic
1188990782 X:36817520-36817542 CTTTAGCAGCAGTGTGAGAATGG - Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1189799051 X:44675260-44675282 CTCAATCAGCAAAGGGAGAAAGG - Intergenic
1189845815 X:45135676-45135698 CTTTATCAGCAGAGTGAAAATGG + Intergenic
1189910974 X:45810289-45810311 TTGAAGCTGCAAAGAGAGAAGGG + Intergenic
1190256276 X:48765102-48765124 CTGAAGCTGCAGAATGGGAAAGG + Intronic
1190715924 X:53103532-53103554 CTGAAGTGGCAGAGGGCGAAGGG - Intergenic
1191842830 X:65525153-65525175 CTGAAGCAGCATAGGGAGGAGGG + Intronic
1191887721 X:65906132-65906154 CTGGAGCACCAGAGACAGAAGGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192136013 X:68601207-68601229 CAGAAGGAGAAGAGAGAGAAAGG + Intergenic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192680344 X:73247324-73247346 CTGCATCAGCAGTGTGAAAATGG + Intergenic
1192687720 X:73324473-73324495 CGGAAGCATCAGGGTGACAATGG - Intergenic
1193267445 X:79488859-79488881 CTGTATCAGCAGCGTGAAAATGG - Intergenic
1193744641 X:85261094-85261116 CTGAAGAAGGAGAGGAAGAAGGG + Intronic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194049495 X:89052149-89052171 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1194323044 X:92476296-92476318 CTTTATCAGCAGTGTGAGAATGG + Intronic
1195592846 X:106651790-106651812 CTGAAGCAGCACAGAAAAAAAGG + Intronic
1197094325 X:122575008-122575030 CTGAAGCTGCACAGGGAAAACGG + Intergenic
1197247916 X:124185379-124185401 CTTAAGCAGAAGAGACAGAAGGG - Intronic
1197841561 X:130753235-130753257 CTGAAACAGAAGAGATAGAATGG - Intronic
1198477010 X:137004899-137004921 CTGTATCAGCAGCGTGAGAATGG - Intergenic
1198510030 X:137341135-137341157 CTGAAGCAGCCCGGTGAGGAGGG - Intergenic
1198608898 X:138375232-138375254 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1199663074 X:150072063-150072085 CTGATACAACAGAGTGAGAAAGG - Intergenic
1200236185 X:154468862-154468884 ATCAAGCAGCAGATGGAGAAGGG + Exonic
1200279790 X:154767163-154767185 CTGCAGCAGCCGACTGAAAAGGG - Intronic
1200631145 Y:5589456-5589478 CTTTATCAGCAGTGTGAGAATGG + Intronic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic
1201363135 Y:13175182-13175204 CAGAAGCATCAGGGTGACAATGG - Intergenic
1201461945 Y:14235417-14235439 CTGTAACAGCAGTGTGAAAACGG + Intergenic
1201730081 Y:17193246-17193268 AAGAAGAAGCAGAGTGTGAAGGG + Intergenic
1201767527 Y:17586396-17586418 CCAAAGCAGCACAGTGACAATGG - Intergenic
1201834026 Y:18319589-18319611 CCAAAGCAGCACAGTGACAATGG + Intergenic
1201959131 Y:19659674-19659696 CGGAAGCATCAGAGTAACAATGG - Intergenic