ID: 1106363261

View in Genome Browser
Species Human (GRCh38)
Location 13:29051688-29051710
Sequence GTTGAATGCCACTGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106363255_1106363261 29 Left 1106363255 13:29051636-29051658 CCGGAAGCCACAAGAAGGAAGTG 0: 1
1: 0
2: 6
3: 29
4: 290
Right 1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1106363256_1106363261 22 Left 1106363256 13:29051643-29051665 CCACAAGAAGGAAGTGCCTCAAA 0: 1
1: 0
2: 0
3: 13
4: 202
Right 1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1106363254_1106363261 30 Left 1106363254 13:29051635-29051657 CCCGGAAGCCACAAGAAGGAAGT 0: 1
1: 0
2: 4
3: 129
4: 1685
Right 1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1106363258_1106363261 6 Left 1106363258 13:29051659-29051681 CCTCAAAGAAGCAAAAAATGGTC 0: 1
1: 0
2: 6
3: 39
4: 318
Right 1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106363261 Original CRISPR GTTGAATGCCACTGGGCAGT TGG Intronic
901762944 1:11482335-11482357 GTAGACTGCCCATGGGCAGTTGG + Intronic
902163474 1:14551147-14551169 GTTGACTGCCAAGGGCCAGTAGG - Intergenic
902356863 1:15909391-15909413 GATGAAAGCAACTGGGAAGTGGG - Exonic
905173487 1:36122864-36122886 GTTGGATCACACTGGGGAGTGGG - Intronic
913509257 1:119547507-119547529 GTGGAATGGCCCTAGGCAGTGGG + Intergenic
914947141 1:152077954-152077976 GGCGACTGCCACTGAGCAGTGGG + Intergenic
917534921 1:175867581-175867603 GCCGAATTCCACTGGGCACTGGG - Intergenic
918263234 1:182816056-182816078 TTTGGATGCCACTGGGTAATAGG - Intronic
919000604 1:191826922-191826944 GTTGTATGCCACTGGCAAATTGG + Intergenic
919944635 1:202310254-202310276 CTTCAAGGCCTCTGGGCAGTGGG + Exonic
924104853 1:240639836-240639858 TTTGAAAATCACTGGGCAGTAGG - Intergenic
1063607162 10:7532908-7532930 GTGGGATGCCACTGTACAGTCGG + Intergenic
1064095023 10:12417744-12417766 GTGGAAGGCCAATGGGTAGTGGG + Intronic
1064124094 10:12644169-12644191 GTTGAGAACCACTGGGCTGTTGG + Intronic
1066754221 10:38693813-38693835 GCTGAAAACCACTGGGCAGAAGG + Intergenic
1073641388 10:105255801-105255823 GGTGAGTGCCACTGGGAACTGGG + Exonic
1074915285 10:117949663-117949685 GTGGATTGACAATGGGCAGTTGG + Intergenic
1075746413 10:124731200-124731222 TTTGAATGCCACTGTGCGTTAGG - Intronic
1076789289 10:132768187-132768209 CTGGAATGCCACTGGGCACATGG - Intronic
1078527574 11:12111847-12111869 GTCGACTGCCACTGGGGAGGGGG - Intronic
1079316403 11:19411286-19411308 ATTGAAAGCCACTGGGTTGTGGG + Intronic
1079345991 11:19652687-19652709 GGTGACAGCCTCTGGGCAGTGGG - Intronic
1086787575 11:90989419-90989441 GTTGAATGTCACTAGTCATTAGG + Intergenic
1086865741 11:91978025-91978047 TTTGAATGCCAATTGGCAGTAGG - Intergenic
1087833410 11:102844949-102844971 GTTGATAGCCACTTGGCAGGGGG + Intergenic
1088912110 11:114199441-114199463 CATGGATGCCGCTGGGCAGTGGG + Intronic
1090924164 11:131235208-131235230 GTTCAAGGCCACGGGGCAGAAGG - Intergenic
1091259056 11:134219345-134219367 GTTCAGTGCCACTGTGCATTTGG - Intronic
1092569731 12:9709055-9709077 TTTCAATACCACTTGGCAGTTGG + Intergenic
1095516009 12:43006326-43006348 GTTCAGTGGCACTGGGGAGTGGG - Intergenic
1096596799 12:52701070-52701092 GTTGCATGGCATAGGGCAGTGGG - Intronic
1101001485 12:100362170-100362192 TTTGGAGGCCACTGAGCAGTGGG + Intronic
1101208259 12:102510589-102510611 GTTGAATGCAACTGGGTCATGGG + Intergenic
1101726624 12:107393482-107393504 GGTCAGTGCCACTGGGCAGCTGG - Intronic
1101782544 12:107848701-107848723 GTGGAATGTCTCTGGGCAGAGGG - Intergenic
1101983365 12:109426828-109426850 GTTGAAAGGCAATAGGCAGTGGG + Intronic
1102506354 12:113386952-113386974 GTTCAATGCCAGTGGGCTGCAGG + Exonic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103167663 12:118784066-118784088 GATGTGTGCCACTGGGCAGTGGG - Intergenic
1103298876 12:119911882-119911904 GTTGAAAGCCACTGGGCTAGAGG + Intergenic
1104214093 12:126719110-126719132 GTGTATTGACACTGGGCAGTGGG - Intergenic
1105594550 13:21824731-21824753 GTTCAATGTCACTGGTCATTAGG - Intergenic
1106363261 13:29051688-29051710 GTTGAATGCCACTGGGCAGTTGG + Intronic
1106552313 13:30782909-30782931 TTAGAATGGCATTGGGCAGTGGG - Intergenic
1107991488 13:45822589-45822611 AATGATTGCCTCTGGGCAGTAGG + Intronic
1108072531 13:46642818-46642840 GTTGATTCCCACTGGGCTATGGG - Intronic
1112120089 13:96400550-96400572 GTTGATGGGCACTGGGGAGTTGG + Intronic
1112540520 13:100307194-100307216 GTTGGATGCCACTGTCCACTCGG - Exonic
1112795145 13:103048661-103048683 GGTGAAGGCCAGTGGGCGGTGGG + Intronic
1113312199 13:109141869-109141891 GCTTAATGCCACTCGGCTGTGGG + Intronic
1116808261 14:49514206-49514228 GGTGAATGGCACTGGGTTGTGGG + Intergenic
1121554067 14:94823076-94823098 CTGGATTTCCACTGGGCAGTAGG - Intergenic
1124815141 15:32982725-32982747 TTCGAAGGCCACTGGGCAGGAGG - Intronic
1124995561 15:34720132-34720154 ATTGAGTGTCACTGGGCAGCAGG - Intergenic
1127488966 15:59444052-59444074 GGTCAGTGCCACTGGGCAGAAGG - Intronic
1127753177 15:62066297-62066319 CTTGCATGCATCTGGGCAGTTGG - Intergenic
1129789779 15:78333074-78333096 CTTGACTGGCACTGGCCAGTAGG - Intergenic
1129873077 15:78953971-78953993 GTTCAATACCACTGGTCATTAGG - Intergenic
1130900427 15:88202875-88202897 GTAAAATGCCACTGGCCAGCAGG + Intronic
1132840152 16:1974921-1974943 GTGGAAGGCCACTAGGCTGTGGG - Exonic
1133778737 16:8919831-8919853 GGTGAATGGTACTGCGCAGTAGG - Intronic
1136366225 16:29810462-29810484 GTTGAAGTCCCCTGGACAGTGGG + Exonic
1136728512 16:32383314-32383336 GCTGAAAACCACTGGGCAGAAGG - Intergenic
1139832192 16:69809188-69809210 GTGGATTGCAACAGGGCAGTGGG + Intronic
1202997925 16_KI270728v1_random:134441-134463 GCTGAAAACCACTGGGCAGAAGG + Intergenic
1151352853 17:73542043-73542065 ATTGTATGACACTTGGCAGTTGG - Intronic
1151391109 17:73787160-73787182 TTTGAAAGCCACTTGGCACTGGG - Intergenic
1151815184 17:76468258-76468280 GTCTAATGCAACTGTGCAGTGGG - Intronic
1155718475 18:28977744-28977766 GTAGAATTGCACTGGGGAGTAGG + Intergenic
1157819463 18:50754827-50754849 GTTTTATACCACTGGGCATTGGG + Intergenic
1158393658 18:57063351-57063373 TTTAGATGCCTCTGGGCAGTGGG + Intergenic
1158761914 18:60400252-60400274 GCAGAATGCCACTGGGGACTTGG + Intergenic
1159461706 18:68729467-68729489 ATTGTATTCCACTGGTCAGTTGG - Intronic
1161280909 19:3445360-3445382 ATGGCATCCCACTGGGCAGTGGG + Intronic
1161353004 19:3804180-3804202 ATTCAATGCCACTGGGCAGCTGG + Exonic
1162802622 19:13119341-13119363 GTTCAAAGGCACTGGCCAGTGGG + Intronic
1165101985 19:33444493-33444515 GCTCAATGCCACTGGGTGGTGGG + Intronic
1165336245 19:35171857-35171879 GTTGAGAAGCACTGGGCAGTGGG + Intergenic
1167535807 19:50050698-50050720 GATGAATGTCACTAGACAGTGGG + Intronic
1168403497 19:56099153-56099175 CTGGGAAGCCACTGGGCAGTGGG - Intronic
925500007 2:4491954-4491976 GTTGCATGATACTGAGCAGTTGG + Intergenic
926204336 2:10824489-10824511 TGTGAATGCCACTGGCCACTTGG - Intronic
926324901 2:11777169-11777191 GGTAAATCCCACTTGGCAGTGGG + Intronic
926709923 2:15871035-15871057 GATGAAGGGCACTGGGCAGGAGG - Intergenic
926918704 2:17917982-17918004 GGTCAAATCCACTGGGCAGTTGG + Intronic
929628780 2:43436606-43436628 GCTGAATGCCACTCAGCTGTTGG + Intronic
929764930 2:44836546-44836568 ATTGATTGCCACTGTGCAGGGGG - Intergenic
929841275 2:45466416-45466438 GTTGAATGTCACTGGGAGGAGGG - Intronic
937605601 2:123798152-123798174 GCTGCCTGCCACTGGGCTGTGGG + Intergenic
938146036 2:128835580-128835602 GTGCAAGGCCACTGGGCAGCAGG - Intergenic
939337090 2:140843887-140843909 GTTGTATGCAACTGGGGAGAGGG - Intronic
943468796 2:188266092-188266114 GTTGAAAGCCAGTGGGCAAGGGG - Intergenic
947551105 2:231047497-231047519 GTTTAAAGCCACTGGGCTGGTGG - Exonic
1169521829 20:6382181-6382203 CTTCAATTCAACTGGGCAGTTGG - Intergenic
1169806986 20:9569584-9569606 GTCAAATGCCACTGAGAAGTGGG + Intronic
1171030193 20:21669837-21669859 GCTGAATCCCACGGGACAGTGGG - Intergenic
1173804770 20:45917333-45917355 CTTGAATGTCCCTGGGCAGCAGG + Intergenic
1178716849 21:34972810-34972832 GTTGCATGCAACTGGACAATGGG - Intronic
1179710611 21:43211063-43211085 GAGGAATCCCACTGGGCAGTGGG - Intergenic
1180178492 21:46104848-46104870 TTTGAAGGCCACAAGGCAGTGGG + Intronic
1181147234 22:20858020-20858042 GTAGAATAACACTGCGCAGTTGG + Intronic
1183641629 22:39096367-39096389 GCTGAATGCCAAAGGTCAGTGGG + Intergenic
1184894254 22:47397875-47397897 CTTGGATGCCACTGGACGGTGGG + Intergenic
1185151138 22:49164549-49164571 GCTGAAAGCCACAGTGCAGTGGG - Intergenic
949251141 3:1985450-1985472 ATTGACTGCCACGTGGCAGTTGG + Intergenic
950501885 3:13369809-13369831 CTTGAAAGCCCCTGGGCTGTGGG - Intronic
950879834 3:16314398-16314420 GTTGAATACCACTGGCCACAGGG - Intronic
951185319 3:19705901-19705923 GTTGAATGCAATGGTGCAGTTGG + Intergenic
952978684 3:38718051-38718073 TTTCAATGCCACTGGGGAGGAGG + Intronic
961643713 3:128381231-128381253 GTTAAGTGCCACCAGGCAGTTGG + Intronic
961847398 3:129777880-129777902 GTGAAATGCCACTGGCCAATGGG + Intronic
966651688 3:182308234-182308256 GTGGAATGCCACTGGGCAAGTGG - Intergenic
967377687 3:188823694-188823716 GTAGAATGACAGTGGTCAGTTGG + Intronic
968698501 4:2043806-2043828 GGGGAATGCCAGTGGGCAGCTGG + Intronic
968703233 4:2066492-2066514 CTTGAAGGCCACTGGGGGGTAGG + Exonic
969478919 4:7436667-7436689 GTAGAATTCCACTGGGCAGGTGG + Intronic
971622534 4:28873925-28873947 GTTGAATGCCCATGGTCAGCAGG - Intergenic
971949183 4:33321697-33321719 GATGAATGCCTCTGGCCAATTGG - Intergenic
972398009 4:38673620-38673642 GTGGAATGCCACTAGCCAGATGG + Intronic
977367237 4:96085722-96085744 GTTCAATGCCATTGGCCATTAGG + Intergenic
977949757 4:102956655-102956677 GCTGAAAACCACTGGGCAGAAGG + Intronic
978335977 4:107669294-107669316 GTTGAATCCCAGTGGGCATTAGG - Intronic
979412771 4:120399165-120399187 GTTGAATATCACTAGGCATTAGG - Intergenic
988099279 5:26657045-26657067 GTTGCAGGGCACTGAGCAGTGGG + Intergenic
994470988 5:100206700-100206722 GTTGAATAGCACTGACCAGTGGG - Intergenic
998387200 5:141764260-141764282 GATGAATGCCACATGGCAGATGG + Intergenic
1002361734 5:178677362-178677384 GTTGAATATCATTGGGCATTTGG - Intergenic
1006432925 6:34009055-34009077 GTTGAATGGTTCTGAGCAGTGGG - Intergenic
1010034389 6:71306890-71306912 GTTTAATTCCAGTAGGCAGTTGG + Exonic
1011560162 6:88606138-88606160 GTTGAATGCCTGTGGGCAGTGGG + Intergenic
1024825690 7:53387097-53387119 GTTGAATGCAACCAGTCAGTAGG - Intergenic
1026299777 7:69087201-69087223 GCTGAATTCCACAGGGCAGCAGG - Intergenic
1030360683 7:108592320-108592342 GTTGACTGCGACTGGGTGGTCGG + Intergenic
1030889411 7:114980770-114980792 GTGGAATGCCTCTGTGAAGTTGG + Intronic
1034155712 7:148954823-148954845 GCAGAATGCCACAGGGCTGTGGG + Intergenic
1036943891 8:13076182-13076204 GTAGAAGGCCACTGGGCTATGGG + Intergenic
1039423609 8:37466772-37466794 GATGAATGACAAGGGGCAGTAGG + Intergenic
1040089312 8:43380513-43380535 CTTGAAACCCACTGGGAAGTGGG + Intergenic
1046727521 8:117691406-117691428 ATTGTATGCCTCTGGGGAGTAGG + Intergenic
1048569764 8:135642302-135642324 GTTGAGTGACCCTGGGCAGATGG + Intronic
1048861480 8:138727316-138727338 GTTTAATTCCACTGGGGAATTGG - Intronic
1049806702 8:144544266-144544288 GGTGGAGGCCACAGGGCAGTGGG - Intronic
1056760022 9:89407885-89407907 GATGAATGAGACTGTGCAGTGGG - Intronic
1057276877 9:93680761-93680783 TTTGGATGCCCCTGGGCTGTGGG + Intergenic
1058287650 9:103199734-103199756 GTTGAATGCCATTATGCACTTGG - Intergenic
1058678633 9:107422583-107422605 GCTGAAAGCCACTGGGCTCTGGG - Intergenic
1060294345 9:122333021-122333043 GGTGATTGACACTGGGGAGTGGG + Intergenic
1060389289 9:123266082-123266104 CTTGAATGCTACTGGCCACTGGG + Intronic
1060475658 9:123984669-123984691 GTTGAAGGGCACTGGGAAGGAGG - Intergenic
1061724801 9:132576292-132576314 GGTGGCTGCCACTGGGCAGGAGG + Intergenic
1195950400 X:110265984-110266006 TTTGAATGCCACTGGACATTTGG - Intronic
1196545004 X:116952387-116952409 GTTGAATTTCACTGGGCAAATGG + Intergenic
1200078488 X:153564013-153564035 ATTGTAGGCCACTGGGAAGTGGG - Intronic
1201184823 Y:11390490-11390512 GTTGAAAACCACTAGGCAGAAGG + Intergenic