ID: 1106366225

View in Genome Browser
Species Human (GRCh38)
Location 13:29083479-29083501
Sequence CTGTTGAAGTGGGAGCTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106366222_1106366225 11 Left 1106366222 13:29083445-29083467 CCTTTAGAGGTAAAGGAAAGTTT 0: 1
1: 0
2: 3
3: 14
4: 271
Right 1106366225 13:29083479-29083501 CTGTTGAAGTGGGAGCTGAATGG 0: 1
1: 0
2: 3
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106366225 Original CRISPR CTGTTGAAGTGGGAGCTGAA TGG Intronic
900667611 1:3825920-3825942 CTCGTGACGTGGGAGCGGAACGG - Intronic
901854933 1:12038527-12038549 ATGATGAAGTGGGAGTGGAAGGG - Intergenic
903497464 1:23779173-23779195 CTTCTGAAGTGTGAACTGAAAGG - Intronic
906543060 1:46603066-46603088 GTGTTGAGGTGGGAGCAGATGGG + Intronic
906778982 1:48555690-48555712 CTGGTGAAGTGGGATTTGAAGGG + Intronic
907066684 1:51491326-51491348 TGGTTGAGGTGGGAGTTGAAAGG - Intronic
907697701 1:56750380-56750402 CTATTGAAGTGTCAACTGAAAGG + Intronic
908579904 1:65503629-65503651 CTGTTGAAGTGGGAGCTTACAGG + Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909738376 1:78996144-78996166 ATGTAGAAATGGGAACTGAAGGG + Intronic
910584485 1:88864083-88864105 TTATTGATGTGGGATCTGAATGG - Exonic
912257513 1:108075985-108076007 CTGTTTGAGTGGGAGATGATAGG - Intergenic
912879332 1:113392041-113392063 TTGTTGAAGTGGTAGGTTAAAGG + Intronic
913093057 1:115492888-115492910 AGGTTGAGGTGGGAGCTGGAAGG - Intergenic
913365347 1:118031808-118031830 CTGTTGGAGTGAGTGCTGAAGGG + Exonic
916456870 1:164980122-164980144 CTGCTGAAGTGAGCACTGAAAGG + Intergenic
919002229 1:191847371-191847393 TTGTTGAAGTGTGAGCTCAGAGG - Intergenic
920213826 1:204348309-204348331 GTGTTGAAGGGAGGGCTGAAGGG - Intronic
921254396 1:213325993-213326015 CTGAAGAAGAGGGAGCTGAGGGG - Intergenic
922866941 1:228868425-228868447 CTGTGGAAGAGGGTGCTAAAAGG - Intergenic
923475521 1:234327784-234327806 CTCTTGCTGTGGAAGCTGAAGGG + Intergenic
924619454 1:245648029-245648051 CCGTTGGAGTTGGAGATGAAGGG + Intronic
924686903 1:246302167-246302189 CTGTTGAATTTGGAGCTGAGAGG + Intronic
1062953782 10:1526517-1526539 GTGTTGCAGTGAGAGCTGATTGG + Intronic
1063381638 10:5589533-5589555 CTGATGAACTGGGGGCTGACAGG - Intergenic
1069219716 10:65868333-65868355 ATCTTGAAGTGGGAGCTTACAGG + Intergenic
1070181707 10:74020424-74020446 TAGTTGAAGTGAGAGCTCAAAGG + Intronic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1071058663 10:81542802-81542824 CTGTTTCAGTGGGTTCTGAATGG + Intergenic
1072643824 10:97235898-97235920 CTTTTTAAGTGGGAAATGAATGG - Intronic
1073599432 10:104832404-104832426 CTATTGAACTGGAAGCTGAAAGG - Intronic
1074168789 10:110911597-110911619 CAGTTGCAGCGGGAGGTGAACGG + Intronic
1075603551 10:123788324-123788346 CTGGTGAAGGGGGAGGTAAAAGG - Intronic
1075747533 10:124738074-124738096 TTGGTGAAGTGGCATCTGAAGGG - Intronic
1076068418 10:127467011-127467033 CCGGTGAAGTGTGAGCAGAATGG - Intergenic
1078852545 11:15177986-15178008 ATGTTGGGGTGGGAGATGAAGGG - Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1081222612 11:40480406-40480428 ATTTAAAAGTGGGAGCTGAACGG + Intronic
1081374201 11:42339778-42339800 ATGTTGAAGAGGCAGCTGGATGG + Intergenic
1081590816 11:44421896-44421918 CAGATGTAGTAGGAGCTGAATGG + Intergenic
1081679093 11:44989309-44989331 CGGTTGAACTGGGAGGTGCAGGG + Intergenic
1083000303 11:59284888-59284910 TTTTTTAAGTGGGTGCTGAAGGG - Intergenic
1083241485 11:61392098-61392120 GTGGTGCAGTGGGAGCTGAGAGG - Exonic
1083298343 11:61727263-61727285 CTGGTGAAGTGGGCCCTGGAGGG + Intronic
1083944008 11:65913857-65913879 CTGTTGGGGTGGGGGCTGCAAGG - Intergenic
1084039018 11:66530913-66530935 CAGGTGAAGTGTGAGCTTAAAGG - Exonic
1084884854 11:72197100-72197122 CTTTTGAAGTCTGAGATGAAAGG - Intergenic
1085505552 11:77056673-77056695 CTGTTCAAATGGGAGCCCAAGGG + Intergenic
1087731453 11:101782886-101782908 CCTTTTAAGTGGGAGCTAAATGG - Intronic
1088627067 11:111737171-111737193 CTGTTGGACTGGGAGGTGATAGG + Intronic
1089322885 11:117638521-117638543 CTGTTGGAGTGATAGCTAAAGGG - Intronic
1090585738 11:128210573-128210595 CTGTTGAACTGGGTGCTGAATGG + Intergenic
1094168497 12:27466520-27466542 CTGTTCAAGTGAGAGACGAAAGG + Intergenic
1094295153 12:28897512-28897534 CAGTTGAAGTGGAAGGTGAAAGG - Intergenic
1095470970 12:42536455-42536477 CCGCTGAAGAGGGAGCTGGATGG - Intronic
1096374266 12:51095163-51095185 CTCTTGAAGGGGGATATGAATGG - Exonic
1096439981 12:51633128-51633150 CTGTGGAAGAGGGTGCTGAGGGG + Intronic
1096814938 12:54196044-54196066 ATTTTGAAGAGGGAGCTGGAGGG - Intergenic
1098524332 12:71469631-71469653 CCAGTGAAGTGGAAGCTGAAAGG + Intronic
1098760988 12:74424997-74425019 TTGTTAGAGTGGGAGCTGACAGG - Intergenic
1100126062 12:91427006-91427028 CTGCTGAAGTGGTAGATGAGAGG - Intergenic
1100145718 12:91675021-91675043 ATGTATAAGTGGGAGCTGAATGG - Intergenic
1101222787 12:102658175-102658197 CTGCTGCAGTGGTGGCTGAAAGG - Intergenic
1102423538 12:112823010-112823032 CTTTTGAAGTTGCAGCTGCAGGG + Intronic
1102643125 12:114383863-114383885 CTGTGCAGGTGGGAGCTGAAGGG - Intronic
1104630715 12:130399800-130399822 GTGTTTTAGGGGGAGCTGAATGG - Exonic
1105836434 13:24216212-24216234 CTGGTGTAGTGAGAGATGAAAGG - Intronic
1105870970 13:24505991-24506013 CTGTAGGAGTGGGAGGTGAAAGG - Intronic
1106313303 13:28572479-28572501 CTGTTCAAATGGGAGGTGAAGGG - Intergenic
1106366225 13:29083479-29083501 CTGTTGAAGTGGGAGCTGAATGG + Intronic
1106989236 13:35397016-35397038 GTGTTAAAGTGGAAGCTGAAAGG - Intronic
1109099123 13:58157312-58157334 CTGATGAAGGAGGGGCTGAAAGG + Intergenic
1110556279 13:76863309-76863331 GTGTTGAGGTGGGAGGTGACTGG + Intergenic
1111083873 13:83347711-83347733 CTGTGGAAATGGGCACTGAAAGG + Intergenic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1114377153 14:22159359-22159381 CTGCTGAAGTGTGATTTGAAGGG - Intergenic
1114772024 14:25438905-25438927 CTGTTGAAGGTGGGACTGAATGG + Intergenic
1117769054 14:59113670-59113692 CTGTGGGAGTGGGAGTTGACAGG - Intergenic
1119391942 14:74296679-74296701 CTGAAAAAGTGGGAACTGAAAGG + Intronic
1120926809 14:89805267-89805289 CTCTAGAAGTGGGAGCTCACTGG + Intronic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1128300605 15:66564396-66564418 CAAGTGAAGGGGGAGCTGAAGGG - Intronic
1128648323 15:69393073-69393095 CAACTGAAGTGGGAGCTGAGGGG + Intronic
1129733484 15:77945176-77945198 CTGTTGATGTTGAAGCTGTAGGG - Intergenic
1130033927 15:80341094-80341116 GTATGGAAGTGGGAGCTGGAGGG - Intergenic
1135142993 16:19937523-19937545 CTTATGAAATGGGAGCTGAATGG + Intergenic
1139274972 16:65719182-65719204 GTGTTGAGGGGAGAGCTGAAGGG + Intergenic
1141033652 16:80610480-80610502 CTTTTGAAGAGGGAACTTAAGGG + Intronic
1143580770 17:7824386-7824408 CTGTAGAAGTGGGAGGTACAGGG - Intronic
1147519234 17:41153487-41153509 TTGATGAAGATGGAGCTGAAAGG - Intergenic
1147860855 17:43522192-43522214 CTGTTGAAGAGGGCACTGGAAGG - Exonic
1148002295 17:44396965-44396987 CCGTTGATGTGGGAACTGGATGG + Intronic
1148759499 17:49992258-49992280 CCGTTGAGGTGGGAGATGGACGG + Intronic
1148846388 17:50532513-50532535 CTGTTGAAGAGGCAGGGGAAGGG + Intergenic
1150636257 17:66915315-66915337 CTGCAGAAGTGGGAGGTGGAAGG + Intergenic
1152191501 17:78891031-78891053 GTCTTGAAGGTGGAGCTGAAGGG + Exonic
1153663826 18:7350527-7350549 CTTTTGAAGTGGAAGAAGAAAGG - Intergenic
1153979401 18:10296476-10296498 ATGCGGAAGTGTGAGCTGAAGGG + Intergenic
1156389111 18:36634189-36634211 CCTTTGGAGTGGGAGCTGGAGGG + Intronic
1156819324 18:41353562-41353584 CTGGTAAAGTGGCATCTGAATGG + Intergenic
1157297990 18:46459655-46459677 CTAAAGAAGTGGGAGCTGCAGGG - Exonic
1158624022 18:59056496-59056518 GTGTTGAAGTGGGGCCTGATAGG - Intergenic
1166274476 19:41742837-41742859 CTGGTGATGGGGGAGGTGAAAGG + Intronic
1166992194 19:46699233-46699255 CTGAGGAAGTGGCAGTTGAAGGG - Intronic
924993379 2:335814-335836 CTGATGCAGTTGGAGCAGAATGG + Intergenic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
925517210 2:4696220-4696242 CTGTTGAACTGGGAACAGAGAGG + Intergenic
925999424 2:9318566-9318588 TTGCTGAAGGGGGACCTGAAAGG + Exonic
926424490 2:12728673-12728695 CTGCTGAAGTGGGTACTGACCGG - Intronic
928408580 2:31034402-31034424 ATTTTGAAGTGTGAGCTGGAAGG - Intronic
929746853 2:44667956-44667978 CTGTTGAAGTGAGAGAGGAAGGG - Intronic
933947573 2:87300035-87300057 GTGTTGAAGAGGTAGCTGGAAGG - Intergenic
934089306 2:88537650-88537672 CTGCTGCAGTGGGGTCTGAATGG - Intergenic
935940356 2:108231091-108231113 CTGATAAAGTGGGAGCTTATAGG - Intergenic
936332623 2:111561542-111561564 GTGTTGAAGAGGTAGCTGGAAGG + Intergenic
936924213 2:117720377-117720399 TTGTTGAAATAGGAGCTGAGGGG - Intergenic
940269135 2:151872417-151872439 CTGTTGATGTGGGAGTTGCTCGG + Exonic
940363426 2:152819939-152819961 CTTTTGAAATGACAGCTGAATGG - Intergenic
941499180 2:166248391-166248413 ATTTTGAAGTTAGAGCTGAAGGG - Intronic
943158465 2:184215460-184215482 ACGTATAAGTGGGAGCTGAATGG - Intergenic
943292660 2:186094091-186094113 GTGTTGAAGATGGGGCTGAATGG - Intergenic
1168981008 20:2003484-2003506 TTCTTGAAATGGGAGCTGATGGG + Intergenic
1169174138 20:3494128-3494150 CATTTGAAGTGAGATCTGAAAGG + Intronic
1169619378 20:7488028-7488050 GTCTTGAAGTAGGAGCTTAAAGG - Intergenic
1170467885 20:16639401-16639423 ATCTTGAAGTGGGAGCTTATAGG + Intergenic
1172630921 20:36377714-36377736 TTGCTCAAGTGGGAGCTAAAAGG - Intronic
1173716283 20:45209501-45209523 CTGGTACAGTTGGAGCTGAAGGG + Intronic
1173754603 20:45504518-45504540 CTGTTGCAGTGGGGGCAGACTGG - Intergenic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1183068045 22:35377183-35377205 CTCTTTAGGTGGGAGGTGAAAGG + Intergenic
1183722050 22:39568400-39568422 CTGCGGAAGTGTGGGCTGAATGG + Intergenic
1184175441 22:42786283-42786305 CCGTTGCAGTCGGAGCTGCATGG + Intergenic
1184639489 22:45861820-45861842 CTGGTGAAGTAGGAGGTGAGAGG - Intergenic
949739097 3:7209650-7209672 CTGTTGACGAGGTAGCTCAAAGG + Intronic
949739847 3:7219510-7219532 CTGTTGGAGTGGGAGTTTACAGG + Intronic
950626910 3:14253935-14253957 CTGTTCTAATGGGAGCTGCATGG + Intergenic
953809560 3:46100383-46100405 CTGTGGAAGGGGGTGCTGATGGG + Intergenic
954455688 3:50598567-50598589 ATGGTGAAGTGGGAGCTGGAGGG + Intergenic
954529677 3:51308145-51308167 CTGTGGAGGTGGGAGGGGAAGGG + Intronic
954603146 3:51887921-51887943 CTGTTGAAGGGGAGTCTGAATGG + Intergenic
958513918 3:95087900-95087922 CTGTTGAAGAGGACACTGAAAGG + Intergenic
958995470 3:100899860-100899882 CTAATGAAGTGGGAGCCAAATGG + Intronic
960985651 3:123278884-123278906 CTGGGGACGTGAGAGCTGAAAGG + Intergenic
964945589 3:162219676-162219698 CTCCTTAAGTGGGAGCTTAAAGG + Intergenic
966854371 3:184184104-184184126 GTGTTGATGTGGGAGCTACATGG + Intronic
968054131 3:195678112-195678134 CCTTGGAAGTGGGAGCTGAACGG - Intergenic
968562584 4:1292416-1292438 CTGGTGAAGTGGGAAGAGAATGG + Intronic
970110187 4:12629088-12629110 ATGTTGAACTGGAAGGTGAAAGG - Intergenic
970706480 4:18810103-18810125 CTGTTGCATTGGGTGATGAAAGG + Intergenic
971824018 4:31597844-31597866 CTGTTTTAGTGGGAGATGAGAGG - Intergenic
973702268 4:53548943-53548965 ATATCTAAGTGGGAGCTGAATGG + Intronic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
974614984 4:64269100-64269122 ATGTTGAAGTGGGGGCTTACAGG + Intergenic
975626429 4:76353317-76353339 CTGTTGATGTAGATGCTGAAAGG + Intronic
975663907 4:76715049-76715071 ATGTTGAAGTGGGAGGTTGATGG + Intronic
976608129 4:87001714-87001736 GTGTTGAAGTCACAGCTGAAGGG + Intronic
978084061 4:104628413-104628435 CAGCTGAAGTTGGAACTGAATGG + Intergenic
980681717 4:136171248-136171270 CTTTTGAAGTAGGAGGAGAAAGG - Intergenic
981097092 4:140793099-140793121 CTGTTGCAGAGGGGGCTGTAAGG - Intergenic
981660669 4:147162899-147162921 CTATTTAGGTGTGAGCTGAAAGG - Intergenic
985909015 5:2864486-2864508 CTGTTGAAGTAGCAGTGGAAGGG + Intergenic
988874648 5:35430505-35430527 CAGTTGTAGTGGTAGCTGATAGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
991570701 5:68050476-68050498 CTGGTGAAGTGGGTGGGGAATGG - Intergenic
991765892 5:69979036-69979058 TCTTAGAAGTGGGAGCTGAACGG + Intergenic
991781430 5:70139126-70139148 TCTTAGAAGTGGGAGCTGAACGG - Intergenic
991845128 5:70854108-70854130 TCTTAGAAGTGGGAGCTGAACGG + Intergenic
993494859 5:88596615-88596637 CCTTTGAAGTGGGAGGGGAAAGG + Intergenic
993611596 5:90060946-90060968 CATTTGAAGTTGGATCTGAAAGG - Intergenic
997296350 5:132771347-132771369 TTGTTGCAGTGGGAGTAGAAAGG + Intronic
997662859 5:135602957-135602979 CTGCTGGTGTGAGAGCTGAATGG - Intergenic
999023442 5:148196785-148196807 CTGGTGAAAAGGGATCTGAAAGG + Intergenic
1000965729 5:167653851-167653873 CTGTTGAACTTGCAGCTGAAAGG + Intronic
1001564496 5:172690666-172690688 CTGTTGAGGTGGGTGCCCAAAGG + Exonic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1003469109 6:6412098-6412120 CTGTTGAAGTCAGAGCAGAGTGG - Intergenic
1007980318 6:46148401-46148423 TTGTGGAAGAGGCAGCTGAAAGG + Intergenic
1008420957 6:51298630-51298652 CTGTTGAAATGGGAGTTGAAAGG + Intergenic
1009812024 6:68680427-68680449 GTTTTGAAGTGTGTGCTGAAAGG + Intronic
1012720327 6:102734150-102734172 CAGTTGAAGTAGAAACTGAATGG - Intergenic
1012993014 6:105945701-105945723 CTGTTGCAGTGGGAGATATAAGG + Intergenic
1013029001 6:106312163-106312185 CTGTAGCAGTGGGGGATGAAAGG + Intronic
1015882295 6:137881394-137881416 CTGTTGCAGTGGCAGCTGAGGGG - Exonic
1016580353 6:145622756-145622778 GTGTAGAAGTTGGAGATGAAAGG - Intronic
1016606265 6:145931697-145931719 ATGTTGAAGTGGTGGCTGTAGGG + Intronic
1017005646 6:150026626-150026648 CTGCTGAACTGGGAGCTCAGAGG - Intergenic
1017009639 6:150054583-150054605 CTGTTGTAGTGTGAGGTGCATGG - Intergenic
1017137796 6:151163591-151163613 CTGTTGGAGTGGGAGATTACAGG - Intergenic
1017308642 6:152950833-152950855 CTGTTAAAGTGTGGACTGAATGG - Intergenic
1020283552 7:6663813-6663835 ATGTGGAGGTGGGAGGTGAAGGG + Intergenic
1023178065 7:37452887-37452909 CTGTTGATTTGAGACCTGAAGGG + Intergenic
1023242962 7:38168546-38168568 CAATTGAAGTTGGAGCTGGAGGG - Intergenic
1024788308 7:52933763-52933785 ATGGTGAAGTGGGATGTGAATGG + Intergenic
1027826056 7:83118129-83118151 TTGTTATAGTGCGAGCTGAAAGG - Intronic
1028440172 7:90850597-90850619 CTGTGGAAGAGGGAACAGAAAGG + Intronic
1028487700 7:91378058-91378080 GTGATGCAGTGGGAACTGAAAGG + Intergenic
1028631488 7:92939431-92939453 CTGGTGAAATGGAAGCAGAATGG + Intergenic
1029359149 7:100075616-100075638 CTTTTGAAGGAAGAGCTGAAGGG + Exonic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031847098 7:126819023-126819045 CAGTTCAGGTGAGAGCTGAAGGG - Intronic
1031871960 7:127097250-127097272 CTTTTAAAGTGGCAACTGAATGG + Intronic
1034359318 7:150480220-150480242 GTGTTGCAGCTGGAGCTGAATGG + Intergenic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1035008835 7:155693029-155693051 CAGTTACAGGGGGAGCTGAAGGG - Intronic
1035393357 7:158520152-158520174 CTCTTGGAAGGGGAGCTGAAGGG - Intronic
1038117367 8:24572572-24572594 CTCTTGAAGTGAGATCTGAGTGG - Intergenic
1038143598 8:24872739-24872761 CTGTTGAGCTGAGATCTGAAAGG - Intergenic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1041869470 8:62616698-62616720 CTCCTGAAGTGGGAGGGGAAAGG - Intronic
1043148875 8:76687869-76687891 CTGTTGAATAGGGTCCTGAATGG + Intronic
1044121137 8:88397587-88397609 CTGTTGATGTGTGAGGTGGAAGG - Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1047717730 8:127611100-127611122 CTCATGAAGTGGGGGCTGAATGG + Intergenic
1048116142 8:131525301-131525323 ATGTTGAAAGGGGAGATGAAAGG + Intergenic
1048173125 8:132127434-132127456 CTGTTGACATGTGAGTTGAAAGG + Exonic
1050308714 9:4331491-4331513 CTGTTGAAATGGGAGAGAAAGGG - Intronic
1051982892 9:23045900-23045922 CTGTTGGAGTGGGACCTGCTAGG - Intergenic
1054826929 9:69582675-69582697 CTGGTGAAGTGGGACCAAAATGG - Intronic
1055432471 9:76258027-76258049 CTGTGGAAAAGGGAGCTGAGAGG - Intronic
1056681467 9:88722809-88722831 CTGGTGAGGGGGGAGGTGAAAGG - Intergenic
1057479343 9:95432345-95432367 CTGCTGAAGTGGAAGGTCAAGGG + Intergenic
1057526526 9:95808007-95808029 CTGTTGGGCTGGGAGCTGGAGGG - Intergenic
1057705964 9:97395368-97395390 CTGCTGAAATGGCAGCAGAATGG + Intergenic
1058001373 9:99869422-99869444 ATCTTGAAGTGGGAGCTTACAGG + Intergenic
1061561592 9:131407656-131407678 ATACTGAAGTGGGAGCTAAAAGG - Intronic
1062426629 9:136509057-136509079 CCGTTGAAGCAGGAGCTGCAAGG + Exonic
1185491190 X:518209-518231 CAGTTGGGGTGGGAGGTGAAGGG + Intergenic
1186105528 X:6201804-6201826 TTGTTGAAAGGGGAGCTGTAAGG + Intronic
1186250072 X:7656213-7656235 ATCTTGAAGTGGGAGCTTACAGG + Intergenic
1186344377 X:8676488-8676510 CTGTTGAAGTGTGAGGGGAAGGG + Intronic
1189667434 X:43371892-43371914 CTGTTGGAGTGGGAGGTTACAGG + Intergenic
1192544131 X:71998700-71998722 AAGATGAAGGGGGAGCTGAAAGG - Intergenic
1194843930 X:98779969-98779991 ATCTTGAAGTGGGAGCTTACAGG + Intergenic
1195374143 X:104209718-104209740 CTCTTGAAGGGAGATCTGAATGG + Intergenic
1195641434 X:107179478-107179500 ATGTATAAGTGGGAGCTAAACGG - Intronic
1195773571 X:108378192-108378214 CATTTGGAGTGGGAGATGAAGGG - Intronic
1196941282 X:120778620-120778642 ATTTATAAGTGGGAGCTGAATGG + Intergenic
1196950810 X:120874792-120874814 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196951652 X:120931194-120931216 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196952336 X:120936055-120936077 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953021 X:120940916-120940938 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196953706 X:120945776-120945798 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196954391 X:120950637-120950659 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955074 X:120955497-120955519 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196955762 X:120960380-120960402 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196956443 X:120965241-120965263 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957125 X:120970101-120970123 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196957807 X:120974961-120974983 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196958489 X:120979821-120979843 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1196959170 X:120984681-120984703 CTGGTGAAGCGGGTGGTGAAGGG - Intronic
1197888581 X:131243622-131243644 GAGATGAAGTGGGAGCTGAATGG - Intergenic
1200110745 X:153739719-153739741 CTGGTGAAGTGGGAGTCGGATGG + Intronic
1201266116 Y:12208375-12208397 CAGTTGAAGAGGGAGATGAATGG - Intergenic
1201465773 Y:14278873-14278895 ATGTTGAAGTGGAAGCTTACAGG + Intergenic