ID: 1106369025

View in Genome Browser
Species Human (GRCh38)
Location 13:29113349-29113371
Sequence CTCTAATTCTTGAGGCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106369025_1106369028 14 Left 1106369025 13:29113349-29113371 CCCACTTGCCTCAAGAATTAGAG 0: 1
1: 1
2: 1
3: 6
4: 94
Right 1106369028 13:29113386-29113408 TATAGTCAAATTGCCAAGAAAGG 0: 1
1: 0
2: 1
3: 23
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106369025 Original CRISPR CTCTAATTCTTGAGGCAAGT GGG (reversed) Intronic
901151846 1:7108768-7108790 CACTAAGTTTTGAGGCAATTAGG - Intronic
901162822 1:7193004-7193026 CTCTAAGTTTTGATGCATGTGGG - Intronic
902743270 1:18455313-18455335 CTTTATTTCTGGGGGCAAGTGGG - Intergenic
909339924 1:74520335-74520357 CTCAAATTCTTCAGAAAAGTCGG - Intronic
915941181 1:160119453-160119475 CTCTATTTCCTGAGGGAAGTGGG + Intronic
918128225 1:181603098-181603120 TTCCAATTCTTAAGGCCAGTAGG - Intronic
920601707 1:207331949-207331971 CTCAAATGCTTGAGTCATGTTGG - Intronic
924839952 1:247698339-247698361 TTCTCCTTCTTGAGTCAAGTGGG - Intergenic
1064235874 10:13574569-13574591 CTCTACTCAGTGAGGCAAGTGGG + Intergenic
1066598822 10:37081791-37081813 CACTAATACTTCAGGCAAGCAGG - Intergenic
1070400821 10:76052286-76052308 TTCCAATTCTTGAGGGAACTGGG - Intronic
1071042408 10:81329078-81329100 GTCTAATTATTGAGGTATGTAGG - Intergenic
1077738285 11:4815769-4815791 CTGCATTTCTTGAGGCATGTCGG - Intronic
1077765121 11:5150504-5150526 CTCTGATTCTTGAGGAATGATGG - Intergenic
1077836606 11:5932177-5932199 CTCTCCTTCTTGGGGCTAGTCGG + Intronic
1078368336 11:10724763-10724785 CTCTGTTTCTTGAGGCAGTTGGG - Intergenic
1079648668 11:22898731-22898753 CTCTAATTCTTGAGGTCCCTTGG + Intergenic
1081171225 11:39872190-39872212 GACTGACTCTTGAGGCAAGTGGG - Intergenic
1081881990 11:46461290-46461312 CTCAATTTGTTGAGGCAAATAGG + Intronic
1082062252 11:47871064-47871086 TTCAAATTCTTTGGGCAAGTGGG + Intergenic
1085796838 11:79549454-79549476 TTCTTATTCTGGAGGCAGGTGGG + Intergenic
1087895493 11:103581147-103581169 ATCTAATTTGTGAGGGAAGTAGG + Intergenic
1088840833 11:113626411-113626433 CTCTAGTTCTGGAGGCTAGAAGG + Intergenic
1094196274 12:27753197-27753219 CCCAAATTCCTGAGCCAAGTGGG - Intronic
1094210554 12:27885590-27885612 CACTGCTTCTTGAGGCAGGTAGG + Intergenic
1102271603 12:111541242-111541264 CTTTAATTCTGGAGGAAAGGTGG - Intronic
1106369025 13:29113349-29113371 CTCTAATTCTTGAGGCAAGTGGG - Intronic
1107378037 13:39825770-39825792 TTGTACTTCCTGAGGCAAGTAGG + Intergenic
1108423676 13:50276583-50276605 CTGAAATTCTTGAGCCAGGTAGG - Intronic
1108911950 13:55565127-55565149 CTCCAGTTGTTGAGGTAAGTGGG - Intergenic
1111747937 13:92293188-92293210 TTCTAATTCTTGAAGAATGTTGG + Intronic
1113068415 13:106394402-106394424 GACTAATTCTTAAGGCAGGTGGG - Intergenic
1116940092 14:50783029-50783051 CACAAAATCTTAAGGCAAGTGGG + Intronic
1117133473 14:52708879-52708901 CTCTAATTCTTGAGGCAAGCAGG + Intronic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1120278367 14:82407672-82407694 CTATAATTTTTGTGGAAAGTGGG + Intergenic
1131682811 15:94741867-94741889 CTCTACCTCTGGAGGCTAGTTGG - Intergenic
1133568800 16:7021819-7021841 TTCTAATTCTTGAAGGTAGTTGG + Intronic
1133804709 16:9115974-9115996 CTCTAATCCTTCATGGAAGTGGG - Intronic
1134247098 16:12548106-12548128 GTCTATTTCTTGGGACAAGTAGG + Intronic
1141048716 16:80741322-80741344 ATTTAATTCTTGAGGTAAATTGG - Intronic
1141391690 16:83670025-83670047 CTCAAATTCTTGTTTCAAGTAGG - Intronic
1145192996 17:20863594-20863616 CACTAATGCTTGGGTCAAGTGGG + Exonic
1145403408 17:22565598-22565620 CACTAATGCTTGGGTCAAGTGGG + Intergenic
1145723503 17:27094238-27094260 CACTAATGCTTGGGTCAAGTGGG - Intergenic
1153918999 18:9771978-9772000 CTGTAACTCTTCAGACAAGTTGG + Intronic
1157102109 18:44740448-44740470 TAATAATTCTTGAGGCAAGTTGG - Intronic
1162494452 19:11015632-11015654 CTGAAATTATTGAGGAAAGTAGG - Intronic
1165529178 19:36382415-36382437 CTGGAATTCTAGAGGCAAGAGGG + Intergenic
1168493075 19:56827020-56827042 CTCTGCTTCTTGAGTCAGGTTGG - Intronic
925758382 2:7157418-7157440 CTCTAAGTATTGGGGCAAGTAGG + Intergenic
926026196 2:9547039-9547061 CTCTCATTCTAGAGAGAAGTAGG - Intronic
928010217 2:27600431-27600453 GCCTAATTCTTGAAGCAACTGGG + Intronic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
939790881 2:146574064-146574086 TTCTAATTCTGGAGGCATGTGGG + Intergenic
940069224 2:149666113-149666135 CTAAAATTCTTGAGGAAAATAGG - Intergenic
942035492 2:172006507-172006529 TTCTAATGCTTGAGGAAAGCGGG - Intronic
948551753 2:238777716-238777738 GTCTAATTCCTGAGGCCAGCAGG + Intergenic
1172993468 20:39052586-39052608 CTTTGTTTCTTGAGGCAAGTGGG + Intergenic
1174729450 20:52901367-52901389 CCCTAACTCTTGAGGCAAGTTGG - Intergenic
1174898018 20:54471224-54471246 CTCTCATTTTGGAGGCAAGATGG + Intergenic
1178625463 21:34214228-34214250 CTTTATTTTTTGAGGCATGTTGG + Intergenic
1179894124 21:44351835-44351857 CTCTAATCCCAGAGGCAAGCAGG - Intronic
1180632274 22:17237812-17237834 CTCTAAGGCTAGAGGCAAGTTGG - Intergenic
950356525 3:12414770-12414792 CTCTAATTTTTAAGGAAATTGGG - Intronic
954845054 3:53548053-53548075 CTCTACTCCTTGATGGAAGTGGG - Intronic
955663670 3:61327950-61327972 CTCAAACTCCTGAGGCGAGTGGG + Intergenic
960632416 3:119745645-119745667 CTCTTATTCAGGAAGCAAGTTGG - Intronic
965917841 3:173872706-173872728 CTAAAATCCTTGAAGCAAGTCGG - Intronic
966026643 3:175292291-175292313 CTCGAAGACTTTAGGCAAGTGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
970446677 4:16129014-16129036 CTCTACTTCTTGAAGAAAGCTGG - Intergenic
970719519 4:18970115-18970137 TTATAAATCTTTAGGCAAGTCGG + Intergenic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
978473179 4:109093797-109093819 CACTAATTCTTAATGCAATTTGG + Intronic
983511800 4:168616883-168616905 CTCTATTACTTGAGGCATGAGGG - Intronic
986966733 5:13282186-13282208 CTTCAATTTTTGAGGCAAATTGG + Intergenic
992445628 5:76830995-76831017 CTCTAATTCTGGGGAAAAGTAGG - Intronic
996413989 5:123189711-123189733 CTCTAATTTTCCAGGCATGTGGG + Exonic
1005238180 6:23790753-23790775 TTCTAATGTCTGAGGCAAGTGGG + Intergenic
1005379109 6:25215944-25215966 CTCCTATTCCTGAGGCAAATAGG - Intergenic
1010730682 6:79387603-79387625 CTGGACTTCTTGAGGCAATTGGG + Intergenic
1012370935 6:98506343-98506365 ATCTAATTTTAGAGGCAAATGGG + Intergenic
1015527216 6:134185174-134185196 CTAAAGTTCTTGAGGAAAGTTGG - Intronic
1016986382 6:149898746-149898768 CTCTAAATCTTCAGTAAAGTTGG - Intergenic
1017273998 6:152544450-152544472 CTCCAATTCCTGAGGCCTGTAGG - Intronic
1022334448 7:29409057-29409079 CTATAAAACTTGAGGAAAGTGGG - Intronic
1030942173 7:115666433-115666455 CTAGAATTTTTGAGACAAGTTGG - Intergenic
1040601571 8:48889883-48889905 CTCTAATTCTTATGGTAATTTGG + Intergenic
1042710110 8:71707856-71707878 CTCACATTCTAGAGGCAAGCTGG + Intergenic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1048846956 8:138611181-138611203 CTCCATTTCTGGAGGCAAGAGGG - Intronic
1049028710 8:140016057-140016079 TACTAATTCTTGAGGAAAGAAGG - Intronic
1051411068 9:16789916-16789938 CTGTATTTATTGAGCCAAGTAGG - Intronic
1055702701 9:78962868-78962890 CTCTAATTCTTGAATAGAGTTGG - Intergenic
1186832300 X:13403277-13403299 CTCTGCCTCTTGAGGCATGTAGG + Intergenic
1188651486 X:32635962-32635984 ATCTAGTTACTGAGGCAAGTAGG - Intronic
1189864459 X:45311054-45311076 CAATAATTCTTGGGTCAAGTGGG - Intergenic
1190637722 X:52452624-52452646 CTCCATTTTATGAGGCAAGTGGG - Intergenic
1190639693 X:52471900-52471922 CTCCATTTTATGAGGCAAGTGGG - Intergenic
1198280234 X:135134311-135134333 GTCCAGTTCTTGAGGCAAGGAGG + Intergenic
1198290724 X:135238203-135238225 GTCCAGTTCTTGAGGCAAGGAGG - Intergenic
1199100246 X:143791086-143791108 ATTTAACTCTTGAGGGAAGTTGG - Intergenic