ID: 1106374879

View in Genome Browser
Species Human (GRCh38)
Location 13:29176603-29176625
Sequence CCATATCTTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 0, 2: 9, 3: 90, 4: 514}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106374874_1106374879 4 Left 1106374874 13:29176576-29176598 CCACTCTCTGCTTCATGACACCT 0: 1
1: 0
2: 3
3: 32
4: 322
Right 1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG 0: 1
1: 0
2: 9
3: 90
4: 514
1106374873_1106374879 5 Left 1106374873 13:29176575-29176597 CCCACTCTCTGCTTCATGACACC 0: 1
1: 0
2: 0
3: 27
4: 228
Right 1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG 0: 1
1: 0
2: 9
3: 90
4: 514
1106374872_1106374879 18 Left 1106374872 13:29176562-29176584 CCAAGATCAAAGGCCCACTCTCT 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG 0: 1
1: 0
2: 9
3: 90
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106374879 Original CRISPR CCATATCTTCAGATGGTGGA AGG Intronic
900814473 1:4832940-4832962 CAATGTCCTCACATGGTGGAAGG + Intergenic
900874171 1:5329796-5329818 CTGTATCCTCACATGGTGGAAGG + Intergenic
901395313 1:8976881-8976903 CCATATCGCCCCATGGTGGAGGG + Intergenic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902189551 1:14752569-14752591 CTATGTCCTCACATGGTGGAAGG + Intronic
902613270 1:17609440-17609462 CCATATCTTCAGTTGTGGGACGG + Intronic
902774717 1:18667331-18667353 CCGCATCTTCAGAGAGTGGAAGG + Intronic
902907739 1:19571179-19571201 CCATGTCCTCACATAGTGGAAGG - Intergenic
902907743 1:19571210-19571232 CTGTATCCTCACATGGTGGAAGG - Intergenic
903388732 1:22948145-22948167 CTGTATCCTCACATGGTGGAAGG - Intergenic
904553999 1:31345738-31345760 GCATATCTTCATATGGCGGCAGG + Intronic
905350178 1:37340117-37340139 CTGTGTCTTCACATGGTGGAAGG - Intergenic
905945399 1:41897458-41897480 ACGTGTCCTCAGATGGTGGAGGG - Intronic
906663046 1:47596050-47596072 GCATGTCTTCAGATGGTGGCAGG + Intergenic
907390896 1:54157641-54157663 CCATGTCCTCACATGGTGGAAGG + Intronic
907598664 1:55745002-55745024 CTGTATCCTCACATGGTGGAAGG + Intergenic
907945215 1:59129698-59129720 CTGTATCCTCACATGGTGGAAGG - Intergenic
908076158 1:60521204-60521226 CTGTGTCTTCAGATGGTGAAAGG + Intergenic
908089597 1:60671819-60671841 CTGTGTCTTCACATGGTGGAAGG - Intergenic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
908584817 1:65556141-65556163 CCATGTCTTCACATGGCAGAAGG - Intronic
908969940 1:69815904-69815926 CTATGTCTTCAGCTGGTGGAAGG + Intronic
909038012 1:70617202-70617224 GCACATCTTCACATGGTGGCAGG + Intergenic
909129105 1:71712877-71712899 GCACATCTTCACATGGTGGCAGG - Intronic
909454683 1:75837174-75837196 CTGTATCTTCACATGGTAGAAGG - Intronic
909487465 1:76189702-76189724 CCATACCTCCACATGGTGGGAGG - Intronic
910290996 1:85600301-85600323 GCACATCTTCACATGGTGGCAGG - Intergenic
910722480 1:90301932-90301954 CCATTTCCTGATATGGTGGAGGG - Intergenic
911317702 1:96375430-96375452 CTCTATCCTCACATGGTGGAAGG - Intergenic
911386140 1:97177938-97177960 CTGTATCTTCACATGGTGGAAGG + Intronic
911610925 1:99958455-99958477 CCATGTCCTCACATAGTGGAAGG - Intergenic
911724151 1:101224027-101224049 CTATGTCTTCACATGGTGGAAGG - Intergenic
912748504 1:112266101-112266123 CCAGACAGTCAGATGGTGGAAGG + Intergenic
915647514 1:157284299-157284321 CCGTGTCCTCACATGGTGGAAGG + Intergenic
915647555 1:157284543-157284565 CTATGTCCTCACATGGTGGAAGG + Intergenic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
915663109 1:157420037-157420059 CCTTGTCCTCACATGGTGGAAGG - Intergenic
915663125 1:157420128-157420150 CCATGTCCTCATATGGTAGAAGG - Intergenic
915663130 1:157420159-157420181 CCATGTCCTCACATGGTGGAAGG - Intergenic
915877805 1:159630878-159630900 GCACATCTTCACATGGTGGCAGG + Intergenic
916086140 1:161270916-161270938 CTATATCCTCACATGGTAGAAGG - Intronic
916142860 1:161714205-161714227 CCACGTCCTCATATGGTGGAAGG - Exonic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917453041 1:175163020-175163042 CCATCTCTTCAGCTGCAGGATGG - Intronic
918631208 1:186720516-186720538 CTATTCCTTCACATGGTGGAAGG - Intergenic
918994858 1:191744175-191744197 CCTTGTCTTCACATGGTGGAAGG + Intergenic
919105154 1:193140393-193140415 ACATATCCCCAGAGGGTGGATGG - Intronic
919109359 1:193198425-193198447 CAGTGTCTTCACATGGTGGAAGG - Intronic
919323738 1:196079276-196079298 CCATTTCTTCAGATGGAGTATGG + Intergenic
919545439 1:198911879-198911901 CCACATCTTAACATGGTGGCAGG + Intergenic
920918363 1:210276941-210276963 CTGTGTCTTCATATGGTGGAAGG - Intergenic
921882864 1:220274037-220274059 GCATTTCTTCAGATGGAAGAAGG - Intergenic
922136542 1:222833023-222833045 CCATCTCTTCAGCTGGAGGAGGG + Intergenic
922219634 1:223548577-223548599 CTATAACTTCACATGGTAGATGG - Intronic
922910393 1:229210929-229210951 CCATGTGTTGAGATGGTGGAGGG - Intergenic
923757378 1:236804321-236804343 CTGTATCTTCACATGGTGGAAGG - Intronic
924047537 1:240047274-240047296 CTGTGTCTTCACATGGTGGAAGG - Intronic
1063012343 10:2036215-2036237 CCATTTCCTCACATGCTGGAAGG + Intergenic
1063023557 10:2155023-2155045 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1063230954 10:4065207-4065229 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1063857247 10:10269003-10269025 TTGTATCTTCACATGGTGGAAGG + Intergenic
1064328195 10:14370380-14370402 CTATGTCCTCACATGGTGGAAGG - Intronic
1065453194 10:25880122-25880144 CCATGTCTTCAGATGTGGGCAGG - Intergenic
1065653129 10:27915398-27915420 CCTTAACTTCACATGGTAGAAGG + Intronic
1066147289 10:32574467-32574489 CCAAACCTTCAGAGAGTGGATGG + Exonic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1068293094 10:55031740-55031762 CTGTATCCTCACATGGTGGAAGG - Intronic
1068579045 10:58718272-58718294 CTATGTCTTCACATGGTAGAAGG + Intronic
1069441078 10:68428570-68428592 CCAGATTTTCAGAGGGTGAATGG + Intronic
1069587696 10:69619505-69619527 CTGCATCTTCACATGGTGGAAGG + Intergenic
1069764273 10:70841511-70841533 CTGTATCTTCACATGGTAGAAGG + Intronic
1071549150 10:86552861-86552883 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1071805072 10:89109881-89109903 GAATATTTTCAGATTGTGGAGGG + Intergenic
1072548722 10:96460632-96460654 GCACATCTTCACATGGTGGCAGG - Intronic
1072589921 10:96819843-96819865 CTGCATCTTCACATGGTGGAAGG + Intergenic
1073303257 10:102483927-102483949 CCATTTCTTCAGTTGGGTGATGG - Intronic
1073454739 10:103629691-103629713 CCATTTGTTGACATGGTGGAAGG + Intronic
1073529915 10:104221474-104221496 CCATGTCCTCACATGGTAGAAGG - Intronic
1073708703 10:106015534-106015556 CCATTGCTTCAGAGGGTGCAAGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074512075 10:114122650-114122672 CCATATATTCAGAGGGCAGAAGG + Exonic
1074643683 10:115418789-115418811 CAATATATTCAGAATGTGGAAGG + Intronic
1074654509 10:115569968-115569990 CTGTATCTTCACATGGTGAAAGG + Intronic
1074917762 10:117974018-117974040 CTATGTCCTCACATGGTGGAAGG + Intergenic
1075951434 10:126481131-126481153 CAAGATCTGCAGATGATGGAAGG - Intronic
1075989043 10:126817299-126817321 CCATGTCCTCACATGGTAGAAGG - Intergenic
1077875939 11:6305783-6305805 CTATGTCTTCACATGGTAGAAGG - Intergenic
1078824594 11:14916908-14916930 CTGTATCTTCACATGATGGAAGG + Intronic
1078936641 11:15957136-15957158 GCATGTCTTCACATGGTGGCAGG + Intergenic
1079319881 11:19442908-19442930 ACATTTCTCCCGATGGTGGAAGG - Intronic
1079738495 11:24028221-24028243 CTGTATCTTCACATGGTAGAAGG + Intergenic
1080095759 11:28404465-28404487 CTGTATCCTCACATGGTGGAAGG + Intergenic
1080425504 11:32150504-32150526 CCAAACCTTCAGAGGGTGAAGGG + Intergenic
1081337084 11:41880075-41880097 CTATGTCCTCACATGGTGGAAGG - Intergenic
1081575097 11:44314222-44314244 CCAGCTCTGCAAATGGTGGAAGG + Intergenic
1082251674 11:49988949-49988971 CCATAATCTCAGATGGTGAAAGG - Intergenic
1082556806 11:54572500-54572522 CCATAATCTCAGATGGTGAAAGG + Intergenic
1083915829 11:65743247-65743269 CCGTATCCTCGCATGGTGGAAGG + Intergenic
1084392150 11:68884460-68884482 GCAAATCTTCAGAGGGTGGAAGG - Intergenic
1085296473 11:75434447-75434469 CGGTATCCTCATATGGTGGATGG - Intergenic
1085816342 11:79741357-79741379 CCACGTCTTCTGATGGTGGCAGG - Intergenic
1086508716 11:87532116-87532138 GCAAACCTTCAGATGGTGAAGGG + Intergenic
1086572090 11:88296805-88296827 CTATAACTTCACATGGTAGAAGG - Intronic
1086937502 11:92761253-92761275 TCATGTCCTCATATGGTGGAAGG + Intronic
1087087009 11:94230071-94230093 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1087474457 11:98619092-98619114 GCACATCTTCACATGGTGGCAGG + Intergenic
1089173549 11:116532748-116532770 CTGTGTCTTCAGATGGTGAAAGG - Intergenic
1089420532 11:118330087-118330109 CCATATCCTCACATGGTAGAAGG + Intergenic
1089564901 11:119365577-119365599 ACATTGCTTCAGATGGTGTAGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090980463 11:131716149-131716171 CTATGTCTTTACATGGTGGAAGG + Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091499683 12:1004082-1004104 CCATAACAGGAGATGGTGGAAGG - Intronic
1091953104 12:4611823-4611845 AAATATTTTCAGATGGTTGAAGG + Intronic
1092293348 12:7178737-7178759 CTGCATCTTCACATGGTGGAAGG - Intergenic
1092395091 12:8118914-8118936 CCATGTCTTCACATGGCAGAAGG - Intergenic
1093351319 12:18106165-18106187 CTAGATCTTCACATGGTGGAAGG - Intronic
1093747805 12:22762810-22762832 CTATGTCTTCACATGGTAGAAGG - Intergenic
1095174830 12:39079684-39079706 GCGTATCCTCACATGGTGGAAGG + Intergenic
1095695975 12:45144455-45144477 TGATGTCTTCACATGGTGGAAGG + Intergenic
1095695981 12:45144489-45144511 TGATATCTTCACATGGTGGAAGG + Intergenic
1097343787 12:58468591-58468613 GCATGTCTTCACATGTTGGAAGG + Intergenic
1097669377 12:62517601-62517623 CTTTGTCTTCACATGGTGGAGGG - Intronic
1099091231 12:78311809-78311831 CCTTATGTTCACATGATGGAAGG - Intergenic
1099218993 12:79889872-79889894 ACGTATCCTCATATGGTGGAAGG + Intronic
1099242366 12:80153266-80153288 TTATGTCCTCAGATGGTGGAAGG + Intergenic
1099773116 12:87089440-87089462 CTGTATCTTCACATGGTGGAAGG + Intergenic
1099790941 12:87332651-87332673 CTTCATCTTCACATGGTGGAAGG - Intergenic
1099801332 12:87460447-87460469 TCAAATCTTCAGAGGGTGAAAGG - Intergenic
1099820862 12:87707706-87707728 CTACATCATCACATGGTGGAAGG + Intergenic
1100026476 12:90134693-90134715 CTGTATCTTCAAATGGTGGGGGG + Intergenic
1100059560 12:90557959-90557981 CTATGTCTTCACATGGTGAAAGG + Intergenic
1100593684 12:96053406-96053428 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1100695696 12:97090344-97090366 CCTCATCCTCAAATGGTGGAAGG - Intergenic
1100794925 12:98171801-98171823 CTGTATCTTCACATGGTGTAAGG - Intergenic
1101314681 12:103618293-103618315 CTGTATCTTCACTTGGTGGAAGG - Intronic
1101426471 12:104592424-104592446 CTATGTCCTCACATGGTGGAGGG + Intronic
1101469109 12:104978201-104978223 CTATATCCTCACTTGGTGGAAGG + Intergenic
1102596763 12:113998825-113998847 CCACATCTTCACATGGTGAAAGG - Intergenic
1103192426 12:119013038-119013060 GCATATCTGGAGATGCTGGAGGG - Intronic
1105755372 13:23458854-23458876 CCATATTTTCAAATGGTCAATGG + Intergenic
1105764915 13:23549618-23549640 CTATATCATCCCATGGTGGAAGG - Intergenic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106920589 13:34559109-34559131 CCATCTCCTCAGCTGCTGGAGGG - Intergenic
1106999352 13:35525834-35525856 CTGTGTCTTCACATGGTGGAAGG + Intronic
1107711718 13:43157111-43157133 AGATATCTACAGATGGTGGGTGG - Intergenic
1107825998 13:44329797-44329819 CCACATCTTCAGTTCATGGATGG + Intergenic
1108017348 13:46089729-46089751 CTATATATTCACATGGTGGAAGG - Intronic
1108132464 13:47317524-47317546 CCATTTCCTGTGATGGTGGATGG + Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1109282028 13:60367806-60367828 GCACATCTTCACATGGTGGCAGG - Intergenic
1109310465 13:60686788-60686810 CTATGTCTTCACATGGTGAAAGG - Intergenic
1110315965 13:74107083-74107105 GCTTGTCTTCACATGGTGGAAGG + Intronic
1111333347 13:86790425-86790447 CTGTATCTTCACATGTTGGAAGG + Intergenic
1114795557 14:25711582-25711604 ACATATGTTCACATGGTGGCAGG + Intergenic
1115340730 14:32290945-32290967 CCATTGCTTCAGAAGATGGAAGG + Intergenic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1117050097 14:51851104-51851126 CCAAATCTAGAGAGGGTGGAAGG + Intronic
1117084117 14:52181407-52181429 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
1117327179 14:54680046-54680068 CCTTATCTTCAGATCATGGGTGG + Intronic
1117732081 14:58733222-58733244 CCATATCCTCACATGGCAGAAGG + Intergenic
1118974781 14:70667304-70667326 ACATATCTTTTGGTGGTGGAAGG + Intronic
1120095610 14:80384429-80384451 CTATGTCCTCACATGGTGGAAGG + Intronic
1120169571 14:81235557-81235579 CCATGTCTTCACATGATGGAAGG + Intergenic
1120317873 14:82919430-82919452 GCATATCTTCACATGGTGTCAGG + Intergenic
1120318047 14:82921378-82921400 GCATATCTTCACATGGTGGCAGG - Intergenic
1120355225 14:83424859-83424881 CTATGTCTTCACCTGGTGGAAGG - Intergenic
1120498908 14:85269687-85269709 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1120535256 14:85687219-85687241 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1121043233 14:90767554-90767576 CCTTATCTTCCCATGGTGGAAGG - Intronic
1121853171 14:97242374-97242396 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1121968054 14:98328846-98328868 CCATGTCCTCACATGGTAGAAGG + Intergenic
1122039978 14:98980284-98980306 CTGTATCTTCACAGGGTGGAAGG - Intergenic
1122110210 14:99494869-99494891 CCGCATCCTCAAATGGTGGAAGG + Intronic
1202917314 14_GL000194v1_random:188231-188253 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1123428219 15:20190599-20190621 GCATATCTTCACATGGTGGCAGG - Intergenic
1124598993 15:31115940-31115962 CTATGTCCTCACATGGTGGAAGG + Intronic
1124628040 15:31320847-31320869 CTATAACCTCACATGGTGGAAGG + Intergenic
1125146918 15:36481765-36481787 CTATGTCTTCACATGGTGGAAGG + Intergenic
1126243997 15:46481955-46481977 CTGTATCATCACATGGTGGAAGG - Intergenic
1127211398 15:56778386-56778408 GCAAACCTTCAGAGGGTGGAAGG - Intronic
1128345534 15:66850386-66850408 GCCTATCTTCAGAAGGGGGATGG + Intergenic
1128776819 15:70326753-70326775 CCAGACCTTCAGATGTGGGATGG - Intergenic
1128838147 15:70828078-70828100 CCAAATCTTCAGCTGGGGCATGG - Intergenic
1129580471 15:76803667-76803689 CTGTGTCTTCACATGGTGGAGGG + Intronic
1129900850 15:79148449-79148471 TCATTTCTTCACATGGAGGAAGG + Intergenic
1129956657 15:79643288-79643310 TCATATCTCCACATGGTGGAAGG - Intergenic
1129962528 15:79700503-79700525 CCATAACATCAAATGGTGGAAGG + Intergenic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130186533 15:81688866-81688888 CCCTATCTTCAGGTGCTGGCTGG + Intergenic
1130246265 15:82252446-82252468 CCATATAATCACCTGGTGGAGGG + Intronic
1130454368 15:84090514-84090536 CCATATAATCACCTGGTGGAGGG - Intergenic
1130833809 15:87629982-87630004 CCGCATTTTCACATGGTGGAAGG + Intergenic
1131857339 15:96611486-96611508 CCATATTTTCATATGGTGGTTGG + Intergenic
1132001273 15:98182276-98182298 CTGTGTCTTCAGATAGTGGAAGG - Intergenic
1133452029 16:5911769-5911791 CCATGTCTGCATATGGTGGGAGG + Intergenic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1133508746 16:6437728-6437750 GCACATCTTCACATGGTGGCAGG + Intronic
1134902741 16:17953341-17953363 CTATATCCTCACCTGGTGGAGGG + Intergenic
1136856099 16:33659151-33659173 GCATATCTTCACATGGTGGCAGG + Intergenic
1136901331 16:34041466-34041488 CCATGTCCTCACATAGTGGAAGG + Intergenic
1137292765 16:47063116-47063138 CTATGTCTTCACATGGTGTAAGG - Intergenic
1137949954 16:52774218-52774240 CCAGCTATTCAGAAGGTGGAAGG + Intergenic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139462627 16:67134717-67134739 CCGTATCCTCATATGGTGCAAGG + Intronic
1140060343 16:71564168-71564190 CCATATCTTAAGGTGTTGGCTGG - Intronic
1140470779 16:75213129-75213151 CCATATCTTCACCTGGTGGAAGG - Intergenic
1140582160 16:76243793-76243815 CAAAATTTTCAGATGGTTGAAGG - Intergenic
1140671769 16:77286673-77286695 CCACATCTTCAGATGGGGGCAGG - Intronic
1140941400 16:79724764-79724786 CAAGATCTCCAGGTGGTGGAAGG - Intergenic
1141888003 16:86906119-86906141 CCAAACCTTCAGAGAGTGGATGG - Intergenic
1203117685 16_KI270728v1_random:1507630-1507652 GCATATCTTCACATGGTGGCAGG + Intergenic
1143271567 17:5679307-5679329 CTATGTCTTCACATGGTGGAAGG - Intergenic
1144215609 17:13052492-13052514 GCTTGTCTTCACATGGTGGAAGG - Intergenic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145752956 17:27368276-27368298 ACACATCTTCACATGGTGGCAGG + Intergenic
1148638352 17:49166279-49166301 CCATCTCTACAGATTGTGGCTGG - Intronic
1149228536 17:54504464-54504486 CAATTTCTTCAGATTGGGGATGG + Intergenic
1149359971 17:55884893-55884915 CTATGTCCTCACATGGTGGATGG - Intergenic
1149384877 17:56132756-56132778 CCATGTCCTCACATGGTGGAAGG + Intronic
1149404158 17:56329880-56329902 CTATAGCTTCACATGGCGGAAGG - Intronic
1149937716 17:60825695-60825717 CCATGTCCTCACATGGTGGAAGG + Intronic
1150222603 17:63505615-63505637 GCACATCTTCACATGGTGGCAGG - Intronic
1150603901 17:66675221-66675243 CCACATCCTCACACGGTGGAAGG + Intronic
1151512881 17:74572200-74572222 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1152275175 17:79352329-79352351 GCACATCTTCACATGGTGGCAGG - Intronic
1152302241 17:79501930-79501952 CCATTTATTAAAATGGTGGATGG + Intronic
1153421926 18:4916701-4916723 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
1154336186 18:13466826-13466848 TTATATCTTCACATGGTGGAAGG + Intronic
1155105822 18:22664998-22665020 GCACATCTTCACATGGTGGCAGG - Intergenic
1155486935 18:26354465-26354487 CCTTATCATCAGATGTTGGATGG + Intronic
1155836675 18:30594370-30594392 CCAAATTTTCAATTGGTGGAGGG - Intergenic
1156139679 18:34091430-34091452 CCATATCCTCTCATGGTGGCAGG - Intronic
1156525973 18:37767735-37767757 TCATGTCCTCACATGGTGGAAGG + Intergenic
1156612979 18:38749612-38749634 CTGTATCCTCACATGGTGGAAGG + Intergenic
1156670101 18:39458640-39458662 GCATGTCTTCACATGGTGGCAGG - Intergenic
1157014064 18:43688337-43688359 CTATTTCTTCATGTGGTGGAAGG + Intergenic
1157049273 18:44141930-44141952 ATGTATCTTCACATGGTGGAAGG - Intergenic
1157689008 18:49665573-49665595 CTATGTCCTCACATGGTGGAAGG + Intergenic
1158129870 18:54140518-54140540 GCATATCTTCATCTGGTGGCAGG - Intergenic
1159419872 18:68204437-68204459 CAAAATCTTCAAATGGTAGAGGG + Intergenic
1162847909 19:13407989-13408011 GCACATCTTCACATGGTGGCAGG - Intronic
1163408746 19:17140344-17140366 CCATGTCCTCACACGGTGGAAGG + Intronic
1165117845 19:33539661-33539683 CCCTATCTTCAGATGCTGGCAGG - Intergenic
1165269029 19:34688849-34688871 CCTTATCTTCAGGTGCTGGCTGG + Intergenic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1168163505 19:54529281-54529303 TCTTATCTTCAATTGGTGGAGGG - Intergenic
925785498 2:7428670-7428692 TCATATCATCAGATGGGTGAGGG - Intergenic
926232942 2:11018694-11018716 GCATCTGTTCAGATGGTGGCTGG - Intergenic
926560753 2:14414905-14414927 GCACATCTTCACATGGTGGCAGG + Intergenic
926576882 2:14592400-14592422 CACTATCTTCCCATGGTGGAAGG - Intergenic
926598385 2:14815003-14815025 GCATGTCTTCACATGGTGGCAGG - Intergenic
926618098 2:15019787-15019809 TCCTATCATCATATGGTGGAAGG - Intergenic
926846022 2:17140156-17140178 TCAAACCTTCAGATGGTAGAGGG - Intergenic
927092419 2:19722219-19722241 CCATGTCCTCGCATGGTGGAAGG + Intergenic
928539637 2:32272322-32272344 CTATATCCTCACGTGGTGGAAGG - Intergenic
928653112 2:33422584-33422606 CTGCATCTTCACATGGTGGAAGG - Intergenic
929124005 2:38506562-38506584 GCACATCTTCACATGGTGGCAGG - Intergenic
930163223 2:48178896-48178918 ACATGTCCTCACATGGTGGAAGG + Intergenic
931634872 2:64332110-64332132 CTATGTCTTCACACGGTGGAAGG - Intergenic
931826824 2:66008924-66008946 CAATATCTTCAGATTGTATAGGG + Intergenic
932163399 2:69483467-69483489 CCAAATGTTCAGTTGGTGAATGG - Intronic
932784741 2:74590268-74590290 CTGTATCCTCATATGGTGGAGGG + Intronic
932837679 2:75052257-75052279 CTAAGTCCTCAGATGGTGGAAGG - Intronic
933071547 2:77864737-77864759 TCAAACCTTCAGAGGGTGGAAGG + Intergenic
933420433 2:82038578-82038600 ACATGTCTTCACATGGTGGCAGG + Intergenic
933505675 2:83174481-83174503 CTATTTCCTCACATGGTGGAAGG + Intergenic
933649210 2:84835761-84835783 CTATATCTTCACATGGTGGAAGG + Intronic
934014294 2:87862529-87862551 CTATATCCTCACATGGTAGAAGG - Intergenic
935745229 2:106184599-106184621 CTGTATCCTCACATGGTGGAAGG + Intronic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
937433884 2:121864154-121864176 CTGTATCCTCACATGGTGGAAGG - Intergenic
937820500 2:126304769-126304791 CTATTTCTTAAGTTGGTGGAGGG - Intergenic
937941255 2:127287857-127287879 CTTGATCTTCAAATGGTGGATGG - Intronic
938586412 2:132695021-132695043 CTATGTCTTCACATGGTAGAAGG + Intronic
939269266 2:139916692-139916714 CTGTATCTTCACATGGTGGAAGG - Intergenic
939798989 2:146683538-146683560 GCACATCTTCACATGGTGGAAGG + Intergenic
940770524 2:157834891-157834913 CTCTGTCTTCACATGGTGGAAGG - Intronic
940823297 2:158382071-158382093 CTCTGTCTTCACATGGTGGAAGG - Intronic
941211740 2:162648257-162648279 GCACATCTTCACATGGTGGGAGG + Intronic
941349858 2:164418768-164418790 CTGTATCCTCACATGGTGGAAGG + Intergenic
941525302 2:166599091-166599113 GCACATCTTCACATGGTGGCAGG + Intergenic
941821018 2:169843316-169843338 CTGCATCTTCACATGGTGGAAGG + Intronic
942530615 2:176905852-176905874 TTATATCTTCACATGGTTGATGG - Intergenic
942718243 2:178919082-178919104 CTGTATCCTCACATGGTGGAAGG - Intronic
942991327 2:182206857-182206879 GCACATCTTCACATGGTGGCAGG - Intronic
944087931 2:195870703-195870725 CCATGTCCTCAAATGGTGGAAGG - Intronic
944302355 2:198138280-198138302 GCACATCTTCACATGGTGGCAGG + Intronic
944625509 2:201564684-201564706 CCATATCCTCACACTGTGGAGGG - Intronic
945609672 2:211984162-211984184 CCATGTCCTCACATGGTGGAAGG + Intronic
946045897 2:216820733-216820755 ATGTATCTTCACATGGTGGAAGG - Intergenic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946574901 2:221064203-221064225 CCACATCATCCAATGGTGGAAGG + Intergenic
946658977 2:221979072-221979094 CCATGTCCTCACATGGTGGTGGG - Intergenic
947251914 2:228115973-228115995 CCATATCCTCACATGGGAGAAGG - Intronic
947994960 2:234519502-234519524 CCATGCCCTCACATGGTGGAAGG + Intergenic
1168912373 20:1459334-1459356 GCACATCTTCACATGGTGGCAGG - Intronic
1169301440 20:4445171-4445193 CTGCATCATCAGATGGTGGAAGG - Intergenic
1169606274 20:7323128-7323150 CTGTATCCTCACATGGTGGAGGG + Intergenic
1169837933 20:9901189-9901211 CTGTATCTTCACATGGTGGAAGG + Intergenic
1169944645 20:10975625-10975647 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1170671520 20:18438825-18438847 CTGTGTCTTCATATGGTGGAAGG + Intronic
1171383760 20:24753166-24753188 ACATGTTTTCACATGGTGGAGGG - Intergenic
1172101506 20:32486415-32486437 CAATGTCTTCAGAGGCTGGAGGG - Intronic
1172780316 20:37432925-37432947 CCAGCTCTTCTGATGATGGAAGG - Intergenic
1173677837 20:44853151-44853173 CTGCATCTTCACATGGTGGAAGG + Intergenic
1173678662 20:44860557-44860579 CTATATCTTCACATGGTGAAAGG + Intergenic
1175048139 20:56126636-56126658 CTGTGTCTTCATATGGTGGAAGG - Intergenic
1176636762 21:9252333-9252355 TCATACCTTCAGAGGGTAGAGGG + Intergenic
1176887140 21:14270288-14270310 CCATGTTTTCACATGGTGGAAGG - Intergenic
1177182857 21:17762007-17762029 CAACATCCTCACATGGTGGAAGG - Intergenic
1177206566 21:18017399-18017421 GCACATCTTCACATGGTGAAAGG - Intronic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1177504772 21:22006235-22006257 CCATATCCTCATATGGCAGAAGG + Intergenic
1177519087 21:22194062-22194084 GCATGTCTTCACATGGTGGCAGG + Intergenic
1177611888 21:23460483-23460505 GCATATCTTCACATGGTGGCAGG + Intergenic
1177697722 21:24594827-24594849 GCACATCTTCACATGGTGGTAGG - Intergenic
1178189421 21:30263465-30263487 GCATCTCTGCAGATGGTGGAGGG + Intergenic
1178608844 21:34062651-34062673 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1178839054 21:36124019-36124041 CTTTGTCTTCACATGGTGGAAGG - Intergenic
1180527149 22:16302999-16303021 CTATATCCTCACATAGTGGAAGG + Intergenic
1180947879 22:19706744-19706766 CTATAATTTCACATGGTGGAAGG - Intergenic
1181435867 22:22910491-22910513 CCATAGCTTCAGGTGGGGGATGG + Intergenic
1181838523 22:25631961-25631983 CCAAATGTTCAGTTGGTGGATGG - Intronic
1182891684 22:33824352-33824374 GCATGCCTTCACATGGTGGAAGG + Intronic
1184443077 22:44530599-44530621 ACATCTCTTCTGATGGTGGGGGG - Intergenic
1203322808 22_KI270737v1_random:84654-84676 CTATATCCTCACATAGTGGAAGG - Intergenic
949170889 3:995103-995125 GCATCTCATCAGATGGTGGAAGG - Intergenic
949931533 3:9082388-9082410 CTGTGTCTTCACATGGTGGAAGG - Intronic
950518511 3:13482477-13482499 TAATATCATCAGAAGGTGGAGGG + Intronic
950816052 3:15703505-15703527 CCATATCCTCACATGGTAGAAGG - Intronic
951347462 3:21563199-21563221 CTGTATTTTCACATGGTGGAAGG - Intronic
951471917 3:23065664-23065686 CCAAGTCTTCAGCTGGTGGTGGG - Intergenic
951545288 3:23818801-23818823 GGATGTCTTCAGATGGAGGATGG + Intronic
951942081 3:28090540-28090562 CTATATCTTCACATGGTGGAAGG - Intergenic
955165126 3:56503475-56503497 CTGTGTCTTCACATGGTGGAAGG + Intergenic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
956946077 3:74225296-74225318 CTATGTCCTCACATGGTGGAAGG + Intergenic
957103998 3:75862932-75862954 TCATACCTTCAGAGGGTAGAGGG - Intergenic
957174392 3:76786996-76787018 GCACATCTTCATATGGTGGCAGG + Intronic
957587394 3:82149745-82149767 CTATGTCTTCATGTGGTGGAAGG + Intergenic
958593203 3:96187194-96187216 CTATGTCCTCATATGGTGGAAGG - Intergenic
959349837 3:105248312-105248334 CCATGTCCTCACGTGGTGGAGGG - Intergenic
959760876 3:109963418-109963440 CTATATCCTTATATGGTGGAAGG + Intergenic
959877046 3:111395378-111395400 CTGTGTCTTCACATGGTGGAAGG - Intronic
959891678 3:111563050-111563072 CCATGTCCTCACATGGTGGAAGG + Intronic
960435289 3:117619075-117619097 GCATATCTTCACAGGGTGGCAGG - Intergenic
960461588 3:117942525-117942547 CTGTATCCTCACATGGTGGATGG - Intergenic
962177383 3:133168366-133168388 CTACATCTTCACATGGCGGAAGG + Intronic
962185785 3:133258179-133258201 CCATGTCTTCAAACGGAGGAAGG - Intronic
962267807 3:133955826-133955848 CCAGAACTTCTGATGCTGGAGGG + Intronic
962321412 3:134393699-134393721 CTATGTCTTCATATGGTGGAAGG + Intergenic
963390779 3:144661094-144661116 CTGTGTCTTCACATGGTGGAAGG + Intergenic
963462791 3:145638175-145638197 CTGTGTCTTCACATGGTGGAAGG - Intergenic
963678527 3:148345449-148345471 CTATATCTTTATGTGGTGGAAGG - Intergenic
964088514 3:152846825-152846847 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
964663229 3:159143964-159143986 TTGTATCTTCACATGGTGGAAGG + Intronic
965956622 3:174377895-174377917 GCATCTCTGCGGATGGTGGAGGG - Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966452442 3:180077638-180077660 GCATGTCTTCACATGGTGGCAGG + Intergenic
966758877 3:183397331-183397353 CCGCATCCTCACATGGTGGAAGG + Intronic
967015824 3:185480801-185480823 GCATGTCTTCACATGGTGGTAGG + Intronic
967209814 3:187158425-187158447 CTACATCCTCACATGGTGGAGGG + Intronic
967501578 3:190203966-190203988 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
1202750133 3_GL000221v1_random:152686-152708 TCATACCTTCAGAGGGTAGAGGG - Intergenic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
971022142 4:22547568-22547590 CTGTCTCTTCACATGGTGGAAGG - Intergenic
971112609 4:23605873-23605895 TCATGTCCTCACATGGTGGAAGG + Intergenic
971324641 4:25633985-25634007 CTGTATCCTCACATGGTGGAAGG + Intergenic
971485809 4:27159001-27159023 CTATATCCTTACATGGTGGAGGG - Intergenic
971614573 4:28771383-28771405 CCTTGTCTTCACATGGTGGAAGG + Intergenic
971718900 4:30218703-30218725 CCATAGCTGCAGTTGGTGAATGG + Intergenic
972226149 4:37015134-37015156 CTATACCCTCACATGGTGGAAGG - Intergenic
972405936 4:38746773-38746795 GCACATCTTCACATGGTGGCAGG - Intergenic
972406198 4:38748686-38748708 GCATGTCTTCACATGGTGGCAGG - Intergenic
972624029 4:40778527-40778549 CTGTATCCTCAGATGGTGAAAGG - Intronic
972842252 4:42945102-42945124 GCGTGTCTTCACATGGTGGAAGG - Intronic
973208490 4:47587674-47587696 CTGCACCTTCAGATGGTGGAAGG + Intronic
973766432 4:54167492-54167514 CCATGTCTGCACATGGTGGAAGG + Intronic
974469013 4:62295160-62295182 CTCTATCTTCCCATGGTGGAAGG - Intergenic
974583415 4:63836867-63836889 CCCTATGGTCAGGTGGTGGATGG + Intergenic
974645672 4:64687784-64687806 TCATGTCATCTGATGGTGGAAGG - Intergenic
974855146 4:67452445-67452467 GCATGTCTTCACATGGTGGCAGG - Intergenic
974904982 4:68044493-68044515 CTGTATCCTCACATGGTGGATGG - Intergenic
975030911 4:69614946-69614968 GCACATCTTCACATGGTGGCAGG + Intronic
975274940 4:72485886-72485908 CTACATCCTCACATGGTGGAAGG - Intronic
975673765 4:76806800-76806822 CTACATCCTCACATGGTGGAAGG - Intergenic
976285013 4:83362886-83362908 CTATGTCCTCACATGGTGGAAGG - Intergenic
976626595 4:87190830-87190852 TTGTGTCTTCAGATGGTGGAAGG + Intronic
976839795 4:89418779-89418801 CTATGTCCTCACATGGTGGAAGG + Intergenic
977378681 4:96241585-96241607 GCATGTCTTCACATGGTGGAAGG - Intergenic
977495449 4:97769809-97769831 CCATATCCTAAAATGGTGCATGG - Intronic
978963950 4:114719125-114719147 CTATAACTTCACATGGAGGAAGG + Intergenic
979021224 4:115501050-115501072 CTGTATCCTCACATGGTGGAAGG - Intergenic
979069559 4:116184920-116184942 CTGTATCTTCACATGGTAGAAGG - Intergenic
979141901 4:117186216-117186238 CTATGTCTTCACATGGTGGAAGG - Intergenic
979437724 4:120713905-120713927 CCCTGTCCTCACATGGTGGAAGG + Intronic
979519746 4:121652693-121652715 CCATGTCTTCAGATAGTGGAAGG + Intergenic
979657519 4:123213051-123213073 ACATAGCTTCAAATGCTGGAAGG - Intronic
979925565 4:126558804-126558826 CCGTGTCCTCATATGGTGGAAGG - Intergenic
980078283 4:128317327-128317349 CCATATCATAACATGGTGGAAGG - Intergenic
980426927 4:132637359-132637381 GCACATCTTCAGAAGGTGGCAGG - Intergenic
980429211 4:132668305-132668327 CTGTATCCTCACATGGTGGAAGG + Intergenic
980452420 4:132991815-132991837 CTGTATCCTCACATGGTGGAAGG - Intergenic
981266270 4:142787395-142787417 CCACATCATCCCATGGTGGAAGG - Intronic
981287435 4:143034951-143034973 CCAGATCTTTAAATGGTAGAGGG + Intergenic
981890560 4:149731300-149731322 CTGTGTCTTCACATGGTGGAAGG - Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
983053170 4:163071851-163071873 CCCTATCTTCAGGTGCTGGTTGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
983882833 4:172952312-172952334 CCATAGCCTCAGGTGGTGGGAGG + Intronic
985220961 4:187705071-187705093 GCAAACCTTCAGATGGTGAAGGG - Intergenic
1202751650 4_GL000008v2_random:10775-10797 TCATACCTTCAGAGGGTAGAGGG + Intergenic
985617076 5:929477-929499 CCATGGCTTCAGAGGGTGCAAGG + Intergenic
985617776 5:934446-934468 CCATGGCTTCAGAGGGTGCAAGG - Intergenic
985798784 5:1987308-1987330 GCACATCTTCACATGGTGGCAGG - Intergenic
986531622 5:8742715-8742737 CTATATCCTTACATGGTGGAAGG + Intergenic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
986945692 5:13016492-13016514 CTGTATCCTCACATGGTGGAAGG + Intergenic
987015509 5:13814654-13814676 CCATTTCTTGAGACGGTGGCAGG + Exonic
987436994 5:17906587-17906609 CTGTGTCTTCACATGGTGGAAGG - Intergenic
988142777 5:27264623-27264645 CCACATCTTCACATGGTGGTAGG - Intergenic
988363610 5:30267555-30267577 CCTTTCCTTCACATGGTGGAAGG - Intergenic
988412646 5:30907155-30907177 CTATATCTTCAAATGGCAGAAGG + Intergenic
988794066 5:34636045-34636067 CCGCATCATCAGATGGTGAAAGG + Intergenic
989193031 5:38689785-38689807 GCACATCTTCACATGGTGGCAGG - Intergenic
989439771 5:41456738-41456760 CTATGTCCTCATATGGTGGAAGG - Intronic
989450131 5:41577222-41577244 CCATGTCTTCACATGGTGGAAGG + Intergenic
990538700 5:56750559-56750581 CCATTTCCTCACATGGTAGAAGG + Intergenic
990939437 5:61187153-61187175 GCATATCTTCACATGGTGGCAGG - Intergenic
991045746 5:62220932-62220954 GCACATCTTCACATGGTGGCAGG - Intergenic
991582810 5:68174459-68174481 CCGTGTCCTCACATGGTGGAAGG + Intergenic
991900654 5:71456312-71456334 CCATGTCTTCAAGTGGTGGTAGG + Intronic
992035111 5:72766032-72766054 CCATGTCCCCACATGGTGGAAGG + Intergenic
993120101 5:83764686-83764708 CTATATCTTCACATGGCAGAGGG + Intergenic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
994181576 5:96772651-96772673 TAAAATCTTCAGCTGGTGGATGG + Exonic
994577467 5:101596841-101596863 CCTTGTCCTCACATGGTGGATGG - Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996095062 5:119389694-119389716 AAAGAGCTTCAGATGGTGGAGGG + Intronic
996106917 5:119516142-119516164 CCATATAATCAGGTGATGGAGGG + Intronic
996251037 5:121332109-121332131 CCATTGCTTCAGAGGGTGCAAGG + Intergenic
996426859 5:123322209-123322231 CTACGTCTTCATATGGTGGAAGG - Intergenic
996439141 5:123470038-123470060 GCACATCTTCACATGGTGGCAGG + Intergenic
996622137 5:125519574-125519596 CCATGTCATCACATGGTGGGAGG - Intergenic
996993709 5:129668494-129668516 CTATGTCCTCACATGGTGGAAGG + Intronic
997132711 5:131293233-131293255 CTGTATCTTCACATGGTAGAAGG - Intronic
997147090 5:131447023-131447045 CCATATCTTCAAAGCGTGGGTGG - Intronic
997789212 5:136742082-136742104 GCATATCTTCACATGGTGACAGG - Intergenic
998277097 5:140766612-140766634 ACACATCTTCACATGGTGGCAGG + Intergenic
998518313 5:142776632-142776654 CCAAATCATCAGCTGGTGAATGG - Intronic
999818024 5:155197393-155197415 CCATAACCTCACATGGTGGAAGG - Intergenic
1000738827 5:164939257-164939279 CTATGTCTTCACATGGTGAAAGG + Intergenic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001437256 5:171709698-171709720 CCGTGTCTTCACATGGTGGAAGG - Intergenic
1001923749 5:175621051-175621073 CCATGTCCTCACATGGTGGAAGG - Intergenic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1003193033 6:3890843-3890865 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1003201459 6:3965088-3965110 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1003946216 6:11078269-11078291 CTATGTCCTCACATGGTGGAAGG - Intergenic
1004271567 6:14200723-14200745 CCATGTGCTCACATGGTGGAAGG + Intergenic
1005827095 6:29639433-29639455 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1006949947 6:37813473-37813495 CCATGTCTTCATATGGTAGAAGG - Intergenic
1008307046 6:49916190-49916212 ACACATTTTCAAATGGTGGAGGG - Intergenic
1008679048 6:53853030-53853052 CCATGTCCTCACATTGTGGAAGG + Intronic
1008717386 6:54305554-54305576 CCTTATCTTCAGAGTCTGGAAGG + Intergenic
1008721672 6:54361424-54361446 CCATATCTTCACATGGCGATAGG + Intronic
1008952337 6:57174233-57174255 CCATGTCTTCAGAACGTTGAGGG + Intronic
1009532043 6:64830143-64830165 CCATGTCCTCACATGGTGGAAGG - Intronic
1009947416 6:70355914-70355936 CTGTATCCTCACATGGTGGAAGG - Intergenic
1010162969 6:72880339-72880361 CTATGTCCTCACATGGTGGAAGG + Intronic
1014301678 6:119689645-119689667 GCACATCTTCACATGGTGGCAGG - Intergenic
1014619494 6:123648094-123648116 CTATGTCTTCACATGGTGGAAGG + Intergenic
1015256814 6:131186705-131186727 CTGTATCCTCACATGGTGGAGGG + Intronic
1015975594 6:138787292-138787314 CCATGTCCTCACATGGTAGAAGG - Intronic
1016029293 6:139321340-139321362 CTTTATCTTCATATGGTAGAAGG - Intergenic
1016105667 6:140159084-140159106 GCACATCTTCAGATGGTGGTAGG + Intergenic
1016122746 6:140364103-140364125 CCATGGCTTCAGATGGGGCAAGG + Intergenic
1016254146 6:142083696-142083718 GCATGTCTTCACATGGTGGCAGG - Intronic
1016409539 6:143767658-143767680 CCATGTCATCACATGGTGGAAGG + Intronic
1017334902 6:153244750-153244772 GCACATCTTCAAATGGTGGCAGG - Intergenic
1017429597 6:154358133-154358155 CCATGTCCTCATATGGTGGAGGG - Intronic
1017518383 6:155179113-155179135 GCATATATTCATATGGTGCAGGG - Exonic
1017792880 6:157817023-157817045 CTATGTCCTCACATGGTGGAAGG - Intronic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1018439557 6:163797663-163797685 CCAGCTCTTCAGATGGAGAATGG + Intergenic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1019791947 7:3020074-3020096 CCGTGTCCTCACATGGTGGAAGG - Intronic
1019843084 7:3468894-3468916 GCATACCTTCAGAGGGTGAAGGG + Intronic
1020366571 7:7386968-7386990 CCGTGTCCTCACATGGTGGAAGG + Intronic
1020809396 7:12833151-12833173 GCACATCTTCACATGGTGGCAGG + Intergenic
1020809647 7:12835161-12835183 GCATGTCTTCACATGGTGGCAGG + Intergenic
1020936597 7:14473290-14473312 CCATAGCTTCAGAGGGTGCAAGG + Intronic
1021291478 7:18850854-18850876 CTAAATCCTCACATGGTGGAAGG + Intronic
1021510785 7:21429670-21429692 CCACAACTTCAGACAGTGGAAGG + Exonic
1021523271 7:21557484-21557506 CTATGTCTTCACATGGTGGAAGG + Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022842819 7:34180875-34180897 CCATATTCTCACATGGTGGAAGG - Intergenic
1022858258 7:34338653-34338675 GCATTTCTTCACATGGTGGCAGG + Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1024401791 7:48932314-48932336 CAATGTCCTCAGATGGTGGAAGG + Intergenic
1024724592 7:52178051-52178073 CTATATCCTCACATAGTGGAAGG + Intergenic
1025563262 7:62398533-62398555 CTATGTCTTCACATAGTGGAAGG + Intergenic
1027695728 7:81407823-81407845 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1028295571 7:89126029-89126051 CAATATCTTCAGATTGTCCATGG + Intronic
1030260075 7:107554732-107554754 ATCTATCTTCACATGGTGGAAGG + Intronic
1030618961 7:111769019-111769041 CTGTATCTTCACATGGTGAAAGG - Intronic
1030641937 7:112015847-112015869 CTTTGTCTTCACATGGTGGAAGG + Intronic
1030752309 7:113242729-113242751 GCATATCTTCAAATGCTGGCAGG - Intergenic
1030776811 7:113543663-113543685 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1030804527 7:113898799-113898821 CCTTATCTTCAGGTGTTGGCTGG - Intronic
1031035495 7:116784034-116784056 CCACTTCTCCATATGGTGGAAGG - Intronic
1031681061 7:124675210-124675232 CCATGTCCTCATATGGTGGAAGG - Intergenic
1031690885 7:124786285-124786307 GCATCTCTTCAGAGGGTGGCAGG - Intronic
1031732995 7:125320887-125320909 GCACATCTTCACATGGTGGCAGG - Intergenic
1032866806 7:135933964-135933986 TCATATCTTCTCATGGTGGCAGG - Intronic
1034003707 7:147444950-147444972 GCACGTCTTCACATGGTGGAAGG + Intronic
1034203475 7:149296498-149296520 CTAAATCTTCAGATGGTGGCGGG - Intronic
1036677548 8:10847510-10847532 CCATGTCCTCACAGGGTGGAAGG - Intergenic
1036960887 8:13243346-13243368 GCACATCTTCACATGGTGGCAGG - Intronic
1037130599 8:15404117-15404139 CTATGTCTTCACATGGTGGAAGG + Intergenic
1037586914 8:20283344-20283366 CTATGTCTTCAGATGGTGGAAGG - Intronic
1037843083 8:22259433-22259455 CTATGTCCTCACATGGTGGAAGG - Intergenic
1038143977 8:24876783-24876805 TTATGTCTTCACATGGTGGAAGG + Intergenic
1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1041623729 8:60001252-60001274 ACATACCTGCAGATGGTGGCTGG - Intergenic
1041632212 8:60100690-60100712 GCACATCTTCACATGGTGGCAGG + Intergenic
1042510223 8:69603384-69603406 CCATGTCTTCAGCTGCTGGCTGG - Intronic
1042596153 8:70450362-70450384 CTATATCTTCACATGGTAAAAGG - Intergenic
1043103750 8:76082281-76082303 CCATATCCTTACAGGGTGGAAGG + Intergenic
1043138086 8:76552977-76552999 CCATATCTTCACATGGAGAAAGG + Intergenic
1043158381 8:76815446-76815468 CAGTATCCTCACATGGTGGAAGG + Intronic
1044362481 8:91304411-91304433 GCATGTCTTCACATGGTGGCAGG - Intronic
1044548145 8:93482337-93482359 CTGTATCCTCACATGGTGGAAGG - Intergenic
1045714115 8:105021578-105021600 CCATGTCTTCACATGGTGGAAGG - Intronic
1045859768 8:106803095-106803117 CCATAACCTCACATGGTAGAAGG + Intergenic
1046268015 8:111857619-111857641 GCATGTCTTCACATGGTGGCAGG - Intergenic
1046416640 8:113923678-113923700 CTGTATCTTCACATGGTAGAAGG - Intergenic
1046453885 8:114433177-114433199 CCATTTCTCCAGATTGTGGAGGG + Intergenic
1046897901 8:119493014-119493036 CTATGTCCTCACATGGTGGAAGG - Intergenic
1047415070 8:124658018-124658040 CTATATCCTCACGTGGTGGAGGG - Intronic
1047617350 8:126573657-126573679 CCCTGTCTTTATATGGTGGATGG - Intergenic
1047668655 8:127120435-127120457 CCATGTCCTCAGATAGTAGAAGG - Intergenic
1047738192 8:127784842-127784864 CCCTATCTTCAGGTGTTGGCTGG + Intergenic
1047924493 8:129669566-129669588 CCATGGCTTCAGATGGTGCAAGG + Intergenic
1047992534 8:130301082-130301104 CCATTAGTTCAGATGGTGTATGG + Intronic
1048427589 8:134337030-134337052 CCACCTCTTCAGACGGTGGACGG + Intergenic
1049579363 8:143404429-143404451 CCACCTCTTCATCTGGTGGAGGG + Intergenic
1049843739 8:144789892-144789914 GCATCTCTGCGGATGGTGGAGGG + Exonic
1050302670 9:4275282-4275304 CCATTTCTTCAGCTCATGGATGG + Intronic
1050667257 9:7953649-7953671 CTACATCTTCACAAGGTGGAAGG - Intergenic
1050832261 9:10029062-10029084 CCATGGCTTCAGAGGGTGCAAGG + Intronic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1051806876 9:21004530-21004552 CTATATGTTCACATGGTGGAGGG - Exonic
1051921436 9:22271090-22271112 CCATCTCCTCACATGGTAGAAGG + Intergenic
1052686687 9:31765472-31765494 GCACATCTTCACATGGTGGCAGG + Intergenic
1054885581 9:70194449-70194471 CTATGTCTTCACATGGTGGATGG - Intronic
1055140700 9:72874098-72874120 GCATATCTTCACATGGTGGCCGG + Intergenic
1055633935 9:78255552-78255574 CCATGTCCTCACATGGTGGAAGG + Intronic
1056195669 9:84226038-84226060 CCAGATCTCTAAATGGTGGAGGG - Intergenic
1056625912 9:88252942-88252964 GCACATCTTCAAATGGTGGCAGG - Intergenic
1057056284 9:91963700-91963722 CTGTATCCTCACATGGTGGAGGG - Intergenic
1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG + Intergenic
1057268197 9:93632567-93632589 CCATGTCCTCATATGGTGGAAGG + Intronic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058600093 9:106659884-106659906 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1058827760 9:108790078-108790100 CCATTTCTTGATATGGGGGATGG + Intergenic
1058940339 9:109807515-109807537 ATATATGTTCACATGGTGGAAGG + Intronic
1059600496 9:115772233-115772255 CCATTTCCTCAGATGGTGTCTGG - Intergenic
1059613384 9:115923194-115923216 CTGTATCCTCACATGGTGGAAGG + Intergenic
1059955786 9:119514737-119514759 CTATGTCTTCATATGGTGAAAGG - Intronic
1061249443 9:129417891-129417913 CCTTGTCCTCACATGGTGGAAGG + Intergenic
1061266678 9:129509829-129509851 CTGTATCCTCACATGGTGGAAGG + Intergenic
1061891968 9:133626791-133626813 GCATATCTTCACAGGGTGGCAGG + Intergenic
1062069615 9:134548498-134548520 CTATGTCCTCACATGGTGGAAGG + Intergenic
1203718775 Un_KI270742v1:182776-182798 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1203653003 Un_KI270751v1:146450-146472 TCATACCTTCAGAGGGTAGAGGG - Intergenic
1185636098 X:1553241-1553263 CCATGTCCTCACATGGTAGAAGG - Intergenic
1185848411 X:3462382-3462404 CTGTGTCTTCAAATGGTGGAAGG + Intergenic
1186208418 X:7224562-7224584 CCATGTTCTCATATGGTGGAAGG - Intronic
1186211400 X:7253979-7254001 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186242354 X:7583141-7583163 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186275311 X:7931975-7931997 CCCTGTCCTCACATGGTGGAAGG + Intergenic
1186313899 X:8348524-8348546 CTGTGTCTTCACATGGTGGAAGG + Intergenic
1186451783 X:9680061-9680083 CTGTGTCTTCACATGGTGGAAGG + Intronic
1186689701 X:11962282-11962304 CCACATCCTCACATGGTAGAAGG + Intergenic
1186819105 X:13268533-13268555 CCATAACTTAAGATAGTTGAAGG - Intergenic
1187227065 X:17383559-17383581 GCACATCTTCACATGGTGGCAGG + Intronic
1187762070 X:22598321-22598343 CTGTACCTTCACATGGTGGAAGG - Intergenic
1187952174 X:24481706-24481728 GCACATCTTCACATGGTGGCAGG - Intronic
1188162340 X:26819398-26819420 CCATTGCTTCAGAGGGTGTAAGG + Intergenic
1189219949 X:39363014-39363036 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1194541591 X:95178712-95178734 GCACATCTTCACATGGTGGCAGG - Intergenic
1194909947 X:99629971-99629993 CCATGTCTTCACATGGTGACAGG + Intergenic
1194910213 X:99632004-99632026 ACACATCCTCAGATGGTGGCAGG + Intergenic
1195141308 X:101963335-101963357 GCACATCTTCACATGGTGGCAGG + Intergenic
1196250871 X:113458740-113458762 CTGTATCTTCAGATAGTGGGAGG + Intergenic
1196407596 X:115380916-115380938 CCGTGTCCTCACATGGTGGAAGG - Intergenic
1196937614 X:120745246-120745268 GCACATCTTCACATGGTGGCAGG - Intergenic
1197372782 X:125645766-125645788 ACACATCTTCACATGGTGGCAGG + Intergenic
1197405760 X:126047068-126047090 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1197412052 X:126128842-126128864 TCATGTCCTCACATGGTGGAAGG - Intergenic
1198881902 X:141291109-141291131 CTGCATCTTCACATGGTGGAAGG + Intergenic
1199035009 X:143039859-143039881 GCACATCTTCACATGGTGGCAGG + Intergenic
1199046843 X:143184446-143184468 CCACATCTTCACATGGTGGCAGG + Intergenic
1199119519 X:144035052-144035074 TCATATTTTCACATGGTGGAAGG - Intergenic
1199971668 X:152866216-152866238 CCATGTCCTCACATGGTGGAAGG + Intronic
1200036049 X:153331496-153331518 CCATGTCCTCATATGGTGGAAGG + Intergenic
1200783488 Y:7238050-7238072 CTGTGTCTTCACATGGTGGAAGG - Intergenic
1201381263 Y:13382328-13382350 CTATATATTCAGTTGGTTGATGG - Intronic
1201447641 Y:14075536-14075558 CCCCATCCTCACATGGTGGAAGG - Intergenic