ID: 1106378893

View in Genome Browser
Species Human (GRCh38)
Location 13:29216655-29216677
Sequence CAGGGTGAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2806
Summary {0: 1, 1: 147, 2: 425, 3: 820, 4: 1413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106378893_1106378901 23 Left 1106378893 13:29216655-29216677 CCACCCTGCTTCTGCTCACCCTG 0: 1
1: 147
2: 425
3: 820
4: 1413
Right 1106378901 13:29216701-29216723 CCAGTCCCAATGTGATGAACCGG 0: 2
1: 159
2: 424
3: 390
4: 394
1106378893_1106378902 24 Left 1106378893 13:29216655-29216677 CCACCCTGCTTCTGCTCACCCTG 0: 1
1: 147
2: 425
3: 820
4: 1413
Right 1106378902 13:29216702-29216724 CAGTCCCAATGTGATGAACCGGG 0: 3
1: 393
2: 914
3: 903
4: 1039

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106378893 Original CRISPR CAGGGTGAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr