ID: 1106380749

View in Genome Browser
Species Human (GRCh38)
Location 13:29236506-29236528
Sequence TTGAAATAGCTTGTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106380747_1106380749 -8 Left 1106380747 13:29236491-29236513 CCTAGACAGAAGAGGTTGAAATA 0: 1
1: 0
2: 0
3: 15
4: 310
Right 1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG 0: 1
1: 0
2: 3
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106380749 Original CRISPR TTGAAATAGCTTGTGGTGAA AGG Intronic
901010318 1:6197737-6197759 TAGAAAAAGCTTGTGGTGAAGGG - Exonic
901310987 1:8269590-8269612 TTTAAATAGAGTGTGGAGAAGGG + Intergenic
902061609 1:13648454-13648476 TAGAAATATTTTGAGGTGAATGG - Intergenic
902431831 1:16369280-16369302 TTGAAATACCTTTTGGAGAAAGG + Intronic
902431856 1:16369499-16369521 GTGAAAAAGCCTGTGGTGAAGGG - Intronic
904890386 1:33775061-33775083 TGGAAATAGGGTGTGGAGAATGG + Intronic
907535906 1:55156755-55156777 TTGAAACTTCTTGTGGTGAGTGG + Intronic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
910492118 1:87784077-87784099 GTGGAAAAGCTTGGGGTGAAGGG - Intergenic
912574664 1:110656937-110656959 TTCAAATTGATTGTGATGAAAGG - Intergenic
913676131 1:121142407-121142429 GTGAAAAAGCTTGTGGTGAAAGG - Intergenic
914028024 1:143930351-143930373 GCGAAAAAGCTTGTGGTGAAAGG - Intergenic
914441614 1:147712479-147712501 GGGAAATAGCTTTTGGAGAATGG - Intergenic
914765909 1:150637525-150637547 TTAAAATAGCTTCTGGTGTGGGG - Intergenic
915719024 1:157970395-157970417 TTGAAACAGCTTGTTGTGTGTGG - Intergenic
916708756 1:167381549-167381571 TTGAAATAGCCTATGTTTAATGG + Intronic
918498897 1:185171679-185171701 ATGAAAAACCTTGTGGTAAAGGG - Intronic
920463499 1:206161245-206161267 GTGAAAAAGCTTGTGGTGAAAGG - Intergenic
920735240 1:208527476-208527498 TTGAAAGAGATGGTGCTGAATGG + Intergenic
921386244 1:214572663-214572685 TTTAAAGATCTTATGGTGAAAGG - Intergenic
923814079 1:237355848-237355870 TGGAAGTAGATTGTGGTGCAAGG + Intronic
923886584 1:238164421-238164443 TTCAGTTGGCTTGTGGTGAATGG + Intergenic
924015871 1:239721971-239721993 TTGGAATGCCTTGTGTTGAAGGG - Intronic
1064135286 10:12745435-12745457 TAGAAACAGAATGTGGTGAAGGG + Intronic
1064278118 10:13925914-13925936 TTGAAATTGCATGAGGTAAAGGG - Intronic
1064586531 10:16844668-16844690 TTGAAATAGCTTGTGGCCTCGGG + Intronic
1064951719 10:20858720-20858742 TTAAAAAAGCCTGTGGTGATAGG - Intronic
1065549017 10:26851884-26851906 TTAAAATAGTTTGTGGTAAGTGG + Intronic
1066323232 10:34326580-34326602 CTGAAATAGGTGGTGATGAAAGG + Intronic
1067655968 10:48191519-48191541 TTGATTTAGTTTGTGGTGCACGG + Intronic
1068479439 10:57570931-57570953 TTGAGATGGCATGTGGTGACTGG + Intergenic
1070673494 10:78394938-78394960 CTGAAATTGATTGTGGTGATGGG - Intergenic
1072065246 10:91862457-91862479 TTGAAATAGTTAATGGTAAAGGG - Intronic
1073842428 10:107513302-107513324 TTGGAACAACTTGTGGTGCAGGG + Intergenic
1074595791 10:114865598-114865620 TTGAAGTAGCTTCTTTTGAAGGG - Intronic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1077189942 11:1251773-1251795 TTGGCATAGCATGTGGGGAAAGG - Intronic
1077767067 11:5170597-5170619 TGGAAATAGCTTCTGGAGCAGGG - Intronic
1079021057 11:16909339-16909361 TTGGAATATCTTGAGGGGAAAGG - Intronic
1079218916 11:18541657-18541679 TTGAAATAGCTTTAGCTCAAAGG + Intronic
1079408876 11:20168037-20168059 TTGAAAGAACCAGTGGTGAAGGG - Intergenic
1079564700 11:21867024-21867046 CTGAAATAGCATGTGGTAATGGG - Intergenic
1080112829 11:28588101-28588123 TTGAAATTGCTCTTGGTGAAGGG + Intergenic
1080142755 11:28942406-28942428 TTGAAAATGTTTGTGGTAAAAGG + Intergenic
1080236797 11:30079428-30079450 GTGAATTAGCTTTTGGAGAAGGG + Intergenic
1085915296 11:80880103-80880125 TTAAAATACCTTATTGTGAATGG - Intergenic
1086066872 11:82754887-82754909 TTGAATTTGATGGTGGTGAAGGG - Intergenic
1087163753 11:94977112-94977134 TTGAAATTGCTTTTTCTGAATGG - Intronic
1087210763 11:95444513-95444535 TTGTACTAGCTTGTGGGAAATGG + Intergenic
1088003117 11:104906690-104906712 TTTAAATGGTGTGTGGTGAATGG + Intergenic
1088053696 11:105550581-105550603 TTGAATTAACTTGTGGTGTCTGG - Intergenic
1088249863 11:107853075-107853097 TTCAAGTAGCTTGGTGTGAAGGG - Intronic
1090515646 11:127423699-127423721 TTCAGTCAGCTTGTGGTGAATGG + Intergenic
1092477056 12:8828446-8828468 TTTCACCAGCTTGTGGTGAATGG + Intronic
1092655363 12:10678175-10678197 TTGGAAGAGCTTGCGGTGTAAGG + Intergenic
1093809313 12:23472840-23472862 TGGACATAGATTGTGGTGTAGGG + Intergenic
1098226041 12:68325971-68325993 TTGAAAAAGCTGGGGGTGAAAGG - Intronic
1098656120 12:73031990-73032012 TTGCAATAGCTTCAGGAGAAGGG + Intergenic
1099156776 12:79187116-79187138 TTGAGATACCTTGTGCTGTAAGG - Intronic
1099322745 12:81171476-81171498 TTGAATTATCTTCTGGGGAATGG + Intronic
1100480175 12:94970345-94970367 TTGAAATTCCTTGTGGACAAAGG - Intronic
1101638629 12:106568630-106568652 ATGAAATAGATTGCTGTGAAGGG - Intronic
1102906878 12:116683254-116683276 TTGAAATTTATTTTGGTGAAAGG - Intergenic
1105556986 13:21456712-21456734 TTAAAATATTTGGTGGTGAAAGG - Intronic
1105647060 13:22332317-22332339 ATGTAATAGATTCTGGTGAATGG + Intergenic
1106119914 13:26851620-26851642 TTGCAATAGCTTGCTGAGAATGG + Intergenic
1106380749 13:29236506-29236528 TTGAAATAGCTTGTGGTGAAAGG + Intronic
1106965340 13:35057993-35058015 GTGAAATAGCCTGTGGGGATAGG + Intronic
1109175403 13:59149255-59149277 TTGAAATGTTTTGTTGTGAAGGG - Intergenic
1109654474 13:65371392-65371414 GTGACACAGCTAGTGGTGAAAGG - Intergenic
1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG + Intergenic
1110214546 13:73011487-73011509 TTAAAATAGCTTCTCCTGAAGGG - Intronic
1112420170 13:99241641-99241663 TGGAAATAGATAGTGGTGATGGG + Intronic
1114042506 14:18692041-18692063 GGGAAAAAGCTTGTGGTGAATGG + Intergenic
1114294187 14:21314578-21314600 TTAAAATAATTTGTGGAGAAGGG - Intronic
1114489836 14:23093234-23093256 TTGAAATGGCATGTGTAGAAAGG - Intronic
1114926545 14:27407768-27407790 CTAAAATAACTTGGGGTGAAGGG + Intergenic
1117566639 14:57000162-57000184 TTGGAATAGCTAGTGGTTAAGGG + Intergenic
1117699595 14:58399602-58399624 TTGAAATCACTTTTGGAGAAGGG - Intronic
1118825479 14:69376457-69376479 TTGAAAGAGTTTGTGTTAAATGG - Intergenic
1119720492 14:76886719-76886741 GTGAAAAAGCTTGTGGCGAAGGG - Intergenic
1120396917 14:83979628-83979650 TTGCAATAGCTGGTGGTTCAGGG - Intergenic
1122283770 14:100639076-100639098 TGGAATGACCTTGTGGTGAAGGG - Intergenic
1202894615 14_KI270722v1_random:193527-193549 CTGAAATAGATTGTGGGGAATGG + Intergenic
1125115845 15:36090729-36090751 TTACAATAGATTGTGGTGAAGGG + Intergenic
1129482905 15:75842571-75842593 TTGAAATGGGTTGTGGTGGGGGG + Intergenic
1133889665 16:9867305-9867327 TTGAAATAGTTTCTAGGGAATGG - Intronic
1134330441 16:13245965-13245987 TGGAGAGAGCTTGTGTTGAAGGG - Intergenic
1137449425 16:48556984-48557006 TGGAAATTGTTTGTGGTGTATGG - Intronic
1139134111 16:64180496-64180518 TTTCAATAGCTTTTGGTGTACGG - Intergenic
1141116228 16:81312207-81312229 TTGAAGTAACTGGAGGTGAATGG - Intergenic
1144813898 17:18019733-18019755 TTCAAATAGCTTGTGTAGCATGG - Intronic
1145893580 17:28436943-28436965 TTCTAATAGCTTGTCGAGAAAGG + Intergenic
1153909476 18:9694474-9694496 GTGAAAGAGCTTCTGGGGAAAGG - Intergenic
1155506393 18:26537789-26537811 TTGGAATGGCTTGAGATGAAGGG - Intronic
1156824682 18:41416552-41416574 TTGAAATAGAGTGTGGAGCAAGG + Intergenic
1157390397 18:47297532-47297554 TGGAAATAGATGGTGGTGATGGG - Intergenic
1158813507 18:61066095-61066117 AAGAAATAGCTTATGGTAAAGGG - Intergenic
1159083826 18:63764710-63764732 TTAAAACAGCTTGTGATGCATGG + Intronic
1159391353 18:67796446-67796468 TTTGAAGAGCTTGTTGTGAAAGG + Intergenic
1160046875 18:75394524-75394546 ATTAAATAGCTGGTGGTGAGAGG + Intergenic
1160298069 18:77655730-77655752 ATAAAATAGTTTGTGGTGAATGG + Intergenic
1164822489 19:31260875-31260897 TTAAAAATGCATGTGGTGAATGG - Intergenic
1165680616 19:37771492-37771514 TTGAAATTCATTGTGTTGAAAGG + Intronic
928914623 2:36457890-36457912 ATGAAATAGCTTGTCGGGAATGG - Intronic
932988905 2:76762468-76762490 TTGAAGTAGTTTGGGGTGAAGGG - Intronic
935054909 2:99557204-99557226 TAAAAATAGCTTTTGATGAAGGG + Intronic
936983515 2:118286628-118286650 TTAAAATTGGTTGTGCTGAATGG - Intergenic
937193674 2:120130448-120130470 CTAAAATAGCTTGTGCTGCATGG + Intronic
938267654 2:129940186-129940208 GGGAAAAAGCTTGTGGTGAATGG - Intergenic
938582615 2:132660922-132660944 TTGAGAGAGGTTGTGGAGAAAGG - Intronic
940336968 2:152539397-152539419 GTGAAAAAGCTTGTGGCAAATGG - Intronic
940779807 2:157920653-157920675 GAGAAATTGGTTGTGGTGAAGGG - Intronic
941085374 2:161111416-161111438 TTGAAATAGCTTGCATTAAAAGG - Intergenic
941992294 2:171569215-171569237 TAGAATTAGCTTGGAGTGAAAGG + Intergenic
942370873 2:175283253-175283275 TTGTAAAAGCTTTTGCTGAAAGG + Intergenic
942927807 2:181455175-181455197 TTGTAAAAGATTTTGGTGAAGGG + Intergenic
942987354 2:182159336-182159358 TGGAATTAGCTTGTTCTGAATGG - Intronic
943237209 2:185337881-185337903 TTCAGTCAGCTTGTGGTGAATGG + Intergenic
945772438 2:214061008-214061030 TTGAGATAGCTTTTGGGAAATGG + Intronic
946466540 2:219917006-219917028 TTCAATGAGCTTGTTGTGAAAGG + Intergenic
1170433991 20:16305203-16305225 TTGAAATTGTTTGTGGTCCACGG - Intronic
1172346187 20:34202448-34202470 TTTAAATGAATTGTGGTGAATGG + Intronic
1175490730 20:59379625-59379647 TTGAAATCTATTGTGGTGACAGG + Intergenic
1177325673 21:19585474-19585496 TTGAAATTGCTTTTGCAGAATGG + Intergenic
1179478048 21:41660289-41660311 TTGCAATAGCTGGTGGGGAGTGG - Intergenic
1183284743 22:36954782-36954804 GTGAAATAGCTTCTTGGGAAGGG - Intergenic
1185012806 22:48325069-48325091 TTGAAATATCCTGTGGTGTGAGG - Intergenic
949155913 3:827160-827182 TTAAGTTAGCTTGTGGTGAATGG - Intergenic
950046890 3:9953774-9953796 GTGACACAGCTTGTGGTCAATGG - Intergenic
951212581 3:19991933-19991955 TTGAAATAGTTACTGGGGAAAGG + Intronic
952352814 3:32556910-32556932 TTTTAATAGATTGTGGTAAATGG - Intronic
955037141 3:55279796-55279818 TAGAAATCGTGTGTGGTGAAGGG + Intergenic
955522129 3:59785178-59785200 TTGTAATACCTAGTGTTGAAGGG - Intronic
956823496 3:72974981-72975003 TTGAAAGAGATTGTCTTGAAAGG - Exonic
957416525 3:79913069-79913091 TTGCATTAACTTGTGATGAATGG + Intergenic
962856290 3:139348359-139348381 TTGAAATACTATGTGGAGAAGGG + Intronic
963486775 3:145944511-145944533 ATGGAATAGCATGTGTTGAAAGG - Intergenic
963525207 3:146408055-146408077 TTCAAAGTGCTTCTGGTGAATGG - Intronic
964358211 3:155869956-155869978 TTGGAATTGTTTGTGGGGAAGGG - Intergenic
964381660 3:156103812-156103834 TTGAATTAGCTCCAGGTGAAAGG + Intronic
965157452 3:165082415-165082437 TTGAATTATTTTGTGGTGAGAGG - Intergenic
965248911 3:166316052-166316074 TGAATATAGCCTGTGGTGAAAGG + Intergenic
965503490 3:169483807-169483829 TTCAAATACCTTTTGGAGAAAGG + Intronic
967092291 3:186145315-186145337 TTTAAATAGCTTTTGGGGCAAGG + Intronic
967222526 3:187259524-187259546 TTAAAAAAGCTCCTGGTGAAGGG + Intronic
970390949 4:15613253-15613275 TTGAATTAGTCTGTGGTGGATGG + Intronic
970944448 4:21673713-21673735 TTGAACTAGCTAGTGGTGGTGGG + Intronic
970973442 4:22013756-22013778 TTGACATAGCATGTGGTCCAAGG + Intergenic
971516701 4:27496279-27496301 TTCAAAAAGCTTGTGGAAAATGG + Intergenic
973324210 4:48841328-48841350 TTAAAATAACTTGCAGTGAAAGG + Intronic
974682678 4:65183420-65183442 TTGAAAATGCTTGCAGTGAAGGG - Intergenic
974865962 4:67581016-67581038 TTGAATTAGCTTTTAGTGCAAGG + Intronic
975108830 4:70600669-70600691 TAGAAATTACTTTTGGTGAATGG - Intronic
976541008 4:86276276-86276298 TTGAAACAGCTAGTGGTCAGGGG - Intronic
978805363 4:112794702-112794724 TTAAAATAGTTTGGGGAGAAGGG - Intergenic
981632277 4:146833654-146833676 TTAAAATAACTTATGATGAAAGG + Intronic
981786917 4:148489969-148489991 TTCAAAAAGCTTGTGGAAAATGG - Intergenic
982321731 4:154083917-154083939 TTGAAACAGCATGAGGAGAATGG - Intergenic
984870315 4:184319219-184319241 TTGAACTTGCTTGTTGTGCAAGG - Intergenic
987131731 5:14866720-14866742 TTGGCATAGCTTTTGGTCAAGGG - Intronic
987869971 5:23603371-23603393 CACAAATAGCTTGTTGTGAAGGG - Intergenic
988830206 5:34979571-34979593 TTGAAATGGCTTGTGTCAAAAGG + Intergenic
988948083 5:36227552-36227574 TTGATATAGCTTGCATTGAAAGG - Exonic
989607009 5:43254177-43254199 TTGAAAAACCTTGTGATCAATGG + Intronic
990223009 5:53616960-53616982 TTGAAATTGCTTTTTGAGAAAGG + Intronic
991661790 5:68958146-68958168 TTTTAATAGCTTGTGCTGACTGG - Intergenic
991774419 5:70071026-70071048 TTGAAATTGATTGTAGGGAATGG + Intronic
991853714 5:70946451-70946473 TTGAAATTGATTGTAGGGAATGG + Intronic
992909800 5:81384845-81384867 TTGCTATAGCTAGGGGTGAAGGG + Intronic
993784235 5:92108957-92108979 GTGAAGTAGCTTGTAGTGACAGG + Intergenic
996382506 5:122876707-122876729 TGGTAATAGCTTGTTTTGAATGG + Intronic
997533954 5:134601710-134601732 TTTAAATATTTTGGGGTGAAAGG - Exonic
997741673 5:136260377-136260399 TTTAAATAGCTTGGGTTGAAAGG + Intronic
998966703 5:147549003-147549025 CTGAAATTGATTGTGGTGATGGG - Intergenic
999109151 5:149102263-149102285 TTGGAATAGTTTGAGGAGAATGG - Intergenic
999606164 5:153318647-153318669 TTGAAATAGCTACTGATGTAGGG + Intergenic
1000142272 5:158417026-158417048 TTGGAATGGCTTATGGTGAGGGG - Intergenic
1001784735 5:174402499-174402521 TTCAAAGAGCTTAAGGTGAAGGG - Intergenic
1003700151 6:8455401-8455423 TTCAAATTGATTGTGGGGAAGGG + Intergenic
1007952372 6:45883903-45883925 TTGAAGTAGCTTGTAGTGGCTGG + Intergenic
1008190032 6:48444393-48444415 TTTAAACATCTTGTGGTGATTGG + Intergenic
1009633877 6:66237990-66238012 GTTTAATAGCTTTTGGTGAATGG + Intergenic
1009634048 6:66240692-66240714 TTGAAATAGCTTTAGGACAAAGG - Intergenic
1013676552 6:112470101-112470123 TTCAAAAAGCTTGTGGAAAATGG - Intergenic
1014857833 6:126424498-126424520 TTGAAATAATTTGTGGAGAAGGG + Intergenic
1014928026 6:127297985-127298007 TTGAAATGGTCTGGGGTGAATGG - Intronic
1020020665 7:4865771-4865793 GTGAAAAACCTTGTGGTGAAGGG - Intronic
1020330929 7:7016170-7016192 TTGAAATTGCTTTTGGTGTTGGG - Intergenic
1020436485 7:8167936-8167958 TTTAAATTTCTTGTGGTGTAAGG + Intronic
1022291235 7:29005614-29005636 TTGGCATTGCATGTGGTGAAAGG - Intronic
1022565864 7:31401262-31401284 CTAAAATAGATTGTGGTGATGGG - Intergenic
1023857957 7:44196801-44196823 TTTAAATAATCTGTGGTGAAAGG - Intronic
1027962581 7:84965388-84965410 GTCAAATTACTTGTGGTGAATGG + Intergenic
1034550021 7:151814584-151814606 TAGAAATTGCCTGTGCTGAAGGG - Intronic
1037204009 8:16292402-16292424 TTGAAATTGCTTTTGGTGTTTGG + Intronic
1040356982 8:46628060-46628082 TTGAAATTGCTTTTGGTGTTGGG - Intergenic
1041456062 8:58061497-58061519 TTAAAATAGCTTCTCCTGAAAGG + Intronic
1042577707 8:70239173-70239195 TTGAAATATCTGGAGGTGATGGG + Intronic
1045178490 8:99753919-99753941 TTGTAATACACTGTGGTGAAGGG - Intronic
1045659515 8:104422737-104422759 TTGAAATAACTTGTGGCTTAAGG - Intronic
1046852408 8:118989681-118989703 TGTTAGTAGCTTGTGGTGAAAGG + Intergenic
1048149906 8:131884144-131884166 TTGAAATGCCTTATGGTTAAGGG + Intergenic
1048343269 8:133556798-133556820 TTGAAATATGGTGTGGTGGAGGG + Intronic
1049965867 9:779155-779177 CTGAAATAGTTTGAGGAGAATGG - Intergenic
1049969675 9:810851-810873 TTTAAGTAGCTTGTGTTTAAAGG - Intergenic
1050058098 9:1676904-1676926 CTGAAATAGATAGTGGAGAAGGG - Intergenic
1050570840 9:6937312-6937334 TAAAAATAGCCAGTGGTGAAAGG + Intronic
1050576169 9:6997801-6997823 CTGAAATAGCATGTGGTGACAGG + Intronic
1051451213 9:17199873-17199895 TTGCAATTGCTTTTGGTGTATGG + Intronic
1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG + Intronic
1055054469 9:72011066-72011088 TGGAAATTCCTTGTGGAGAAAGG - Intergenic
1056254083 9:84780463-84780485 TTGTAATAGGTTGTGGAGATGGG + Intronic
1059134847 9:111795174-111795196 TAGAAAGAGCTGGTTGTGAAGGG + Intergenic
1060064207 9:120488904-120488926 TTCACATGGCATGTGGTGAAGGG - Intronic
1060132214 9:121114171-121114193 TTGAATTAGATTGTGGGGCATGG - Intronic
1187137429 X:16561544-16561566 GTGAAATGAGTTGTGGTGAATGG - Intergenic
1188864666 X:35300212-35300234 TTCAGTCAGCTTGTGGTGAATGG - Intergenic
1188947061 X:36318068-36318090 TTGGAATAGCTTGTGATGGCAGG - Intronic
1192153284 X:68724964-68724986 ATGAAACAGCTCGTGGTGACTGG - Exonic
1192164865 X:68821681-68821703 TGGAAATGGCATGTGGTGAGGGG + Intergenic
1193519061 X:82506781-82506803 GTGAAAAAGCTTGTGATGAAGGG - Intergenic
1193577226 X:83214429-83214451 CTGAAGTGGCTTGTGGGGAATGG + Intergenic
1194695985 X:97051537-97051559 TTAAAATTGCTTGAGGTGAGTGG - Intronic
1195502124 X:105613636-105613658 TTTAATGAGCTTGTGGTGGATGG - Intronic
1198644315 X:138789574-138789596 TGGAAGAAGCTGGTGGTGAAGGG - Intronic