ID: 1106385569

View in Genome Browser
Species Human (GRCh38)
Location 13:29282234-29282256
Sequence CAGAGGCAGCACTTCTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106385569_1106385574 8 Left 1106385569 13:29282234-29282256 CCCAGAGAGAAGTGCTGCCTCTG 0: 1
1: 0
2: 3
3: 26
4: 276
Right 1106385574 13:29282265-29282287 CAGGAGTGCCATGCTCCTGCTGG 0: 1
1: 0
2: 2
3: 18
4: 215
1106385569_1106385575 15 Left 1106385569 13:29282234-29282256 CCCAGAGAGAAGTGCTGCCTCTG 0: 1
1: 0
2: 3
3: 26
4: 276
Right 1106385575 13:29282272-29282294 GCCATGCTCCTGCTGGCTCTAGG 0: 1
1: 1
2: 1
3: 41
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106385569 Original CRISPR CAGAGGCAGCACTTCTCTCT GGG (reversed) Intronic
900199425 1:1397233-1397255 CAGAGGCAGCGGTTCTCTGCTGG + Intronic
900586783 1:3436545-3436567 CAAAGGCAGCACTTATTTCCTGG + Exonic
901138550 1:7013136-7013158 CCGTGCCAGCACTTCTCGCTGGG + Intronic
901328222 1:8382681-8382703 CAGTGGCAGCTGTTCTCACTCGG - Intronic
901441692 1:9282049-9282071 AGGAGGCAGAGCTTCTCTCTTGG + Intergenic
903116461 1:21182517-21182539 CAGAGGCTGCACTGGGCTCTGGG - Intergenic
903137486 1:21318838-21318860 CAGAGGCCGCACTTCTGTCGGGG + Intronic
904353246 1:29922493-29922515 CCAAGGCTGCAGTTCTCTCTGGG - Intergenic
904594185 1:31632710-31632732 TTGAGGCAGCCCTTCTCTCCAGG + Intronic
905246763 1:36620325-36620347 CCGAGTCAGCACTTCTTTCAAGG - Intergenic
905290852 1:36920835-36920857 AAGAGGCTCCATTTCTCTCTGGG + Intronic
905344070 1:37299559-37299581 CACAGGCAATACTTCTCTGTAGG + Intergenic
906325291 1:44841969-44841991 CAGGGCCTGCTCTTCTCTCTGGG - Exonic
907282709 1:53361610-53361632 CAGACTCAGCACTTCCTTCTGGG - Intergenic
907753182 1:57283391-57283413 GAGAGGCAGCACATCTCTAGTGG - Intronic
907783005 1:57584426-57584448 AAGATGCAGCAGATCTCTCTGGG + Intronic
908984355 1:69998937-69998959 CAGAGGCAGGAACTCACTCTGGG - Intronic
909360215 1:74750741-74750763 CAGAGGCACCACTTATCTGTGGG - Intronic
911473691 1:98349958-98349980 CAAAAGCAGCACCTCTTTCTTGG + Intergenic
912525369 1:110278829-110278851 CAGAGGTATCACTTGTCACTGGG + Intronic
915516819 1:156418240-156418262 CACAGGCAGGGCTTTTCTCTTGG + Intronic
916106898 1:161439776-161439798 CTGAGGGGCCACTTCTCTCTCGG - Intergenic
918181238 1:182087280-182087302 CAGAGGCAGAACTTCTGGTTGGG + Intergenic
922154724 1:223031908-223031930 CACTGGCAGCAGTCCTCTCTTGG + Intergenic
923501318 1:234567302-234567324 CAGATGCAGCCCTTCAGTCTTGG + Intergenic
923870676 1:237990859-237990881 CAGAAGCACTAGTTCTCTCTAGG - Intergenic
924090538 1:240496634-240496656 AACAGGCAGGTCTTCTCTCTTGG - Intronic
1065110701 10:22437220-22437242 CAGAGGCCGCTCTTCCCGCTCGG - Intronic
1065454652 10:25894362-25894384 CAGAGGTAACACTTCTGTTTTGG + Intergenic
1067079330 10:43204466-43204488 CAGAACCAGCACATCTCTCAGGG + Intronic
1069598003 10:69685115-69685137 CAGAGCCAGCACTTCTCACCTGG - Exonic
1069701722 10:70431669-70431691 CAAAGGCAGCAATTCTGGCTGGG - Intergenic
1069773579 10:70914295-70914317 CTAAAGCATCACTTCTCTCTGGG + Intergenic
1069913327 10:71772802-71772824 CAGAGGCAGCACTGCCCACCTGG - Intronic
1070034023 10:72704553-72704575 CAGAGGAAGACCTTGTCTCTAGG - Intronic
1070352969 10:75611120-75611142 AAGAGGCAGGGCTTCTCTCTAGG - Intronic
1070571403 10:77641658-77641680 CAGAGGCTGCCCTTCTCTCTGGG - Intergenic
1071836287 10:89421218-89421240 GAGAGGCAGCACTTCTTTTCCGG - Intergenic
1072579637 10:96729540-96729562 CAGAGGCAGCACTATTAACTGGG - Intergenic
1072758783 10:98038939-98038961 AAGATGTGGCACTTCTCTCTGGG - Intergenic
1072991103 10:100194825-100194847 CAGAGGCTGCATTTGTGTCTAGG - Intronic
1073885747 10:108037659-108037681 CAGAGGCCGAACTTTCCTCTAGG + Intergenic
1074619871 10:115107600-115107622 CAGAGGCAGCCCTGCTCCCATGG + Intronic
1075324343 10:121518788-121518810 CAGAGCCAGCACTTCTGCATTGG + Exonic
1075753240 10:124791348-124791370 CAGGCCCAGCACTTCTCCCTCGG + Intronic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1076098705 10:127756080-127756102 TAGAAGAGGCACTTCTCTCTGGG + Intergenic
1076385988 10:130056265-130056287 GAGGGGCAGCGCTTCCCTCTGGG - Intergenic
1076873552 10:133205100-133205122 CAGAGACGGCCCTTCCCTCTAGG - Intronic
1078778413 11:14414818-14414840 TAGAGACAGCACATCTCTATGGG - Intergenic
1078875713 11:15394083-15394105 CACATGCAGTACTTTTCTCTAGG + Intergenic
1080274379 11:30487299-30487321 CACTGCCAGCACTTCCCTCTTGG + Intronic
1080372535 11:31668506-31668528 CATAGCCAGCCCTTGTCTCTTGG - Intronic
1080744779 11:35098994-35099016 CAGAGCAAGCACCTCTGTCTGGG - Intergenic
1080897518 11:36458897-36458919 CAGAGGGAACACCTTTCTCTTGG + Intronic
1081331619 11:41807970-41807992 CAGAAGCAGCACATCTCTCAAGG + Intergenic
1081758381 11:45560446-45560468 CAACTGCAGCCCTTCTCTCTGGG + Intergenic
1082968712 11:58996006-58996028 CAGAGGCACAGCTTGTCTCTTGG - Intronic
1085216654 11:74838753-74838775 CAGAGCCAGCTCTTCTGTTTTGG - Exonic
1085458234 11:76677879-76677901 CAGAGGCAGCACCTGCCTCCTGG + Intergenic
1086880658 11:92149779-92149801 CAGAAACAGCAGTTCTCTCTTGG + Intergenic
1091170179 11:133513078-133513100 TAGAGGTAGCAATTCTCCCTGGG + Intronic
1091317521 11:134624912-134624934 CAGAGGCTGCTCATCTCTCAGGG + Intergenic
1091742639 12:2970990-2971012 CACAGCCAGCTCTCCTCTCTTGG + Intronic
1099208542 12:79756916-79756938 CAGAGGCAGGAAACCTCTCTTGG + Intergenic
1099659145 12:85533323-85533345 CAGAGACAGCACTTCTCCATGGG + Intergenic
1100909683 12:99344899-99344921 AATAGGCTGCACTTCTCTCATGG + Intronic
1103029051 12:117597513-117597535 CAGAGGCAGCGCTTCTTCCTTGG - Intronic
1104607798 12:130202781-130202803 GAGAGGAGGGACTTCTCTCTGGG + Intergenic
1104856070 12:131903095-131903117 CACAGGCAGCGACTCTCTCTAGG - Intronic
1104946120 12:132415579-132415601 CTGAGGCAGCAGCTCCCTCTCGG + Intergenic
1105306504 13:19172778-19172800 CACAGGCAGCACTGCCCTCGGGG + Intergenic
1106385569 13:29282234-29282256 CAGAGGCAGCACTTCTCTCTGGG - Intronic
1106690065 13:32105253-32105275 CAGAGGGAGCTCCTCTCTTTTGG + Intronic
1106789388 13:33139279-33139301 CAGAGGCAGTACTTGAATCTGGG - Intronic
1106874955 13:34061456-34061478 CAGGGGCAGCACCTTTCTCATGG - Intergenic
1108036396 13:46294450-46294472 CAGAGGCTGAGCTTCTTTCTGGG + Intergenic
1109372041 13:61435310-61435332 CAGGGACAGCATTCCTCTCTTGG + Intergenic
1110900124 13:80811687-80811709 AAGAGGCAGCACAGCTCTCTGGG - Intergenic
1113508040 13:110830722-110830744 CAGCGGAATCACTTCTCACTGGG + Intergenic
1114935274 14:27528561-27528583 CAGAGGCACCCCATTTCTCTTGG + Intergenic
1117296913 14:54388897-54388919 AGGAGGCAGCAATTGTCTCTCGG + Intergenic
1117317832 14:54591199-54591221 TAGAGTCAGCATTTCTCACTAGG - Intronic
1118355674 14:65011638-65011660 CAGAGGCTGCACTTCTTTCTTGG - Intronic
1119867753 14:77988308-77988330 CAGAGGCTGCCCTTCTTCCTTGG - Intergenic
1120721790 14:87897408-87897430 CAGAGGCAACCCTTCTCTCCGGG - Intronic
1121327980 14:93032890-93032912 CAAAGCCAGCCCTTTTCTCTAGG + Intronic
1121900471 14:97689141-97689163 CACAAGCATCACTTTTCTCTGGG + Intergenic
1121917930 14:97853318-97853340 CAGAGTCAGAATTTCTTTCTTGG + Intergenic
1122544209 14:102513292-102513314 AGGAGGCGGCACTTCTCTCCAGG - Intergenic
1122941543 14:104983587-104983609 CCGACGCAGCACTTCTCAGTGGG + Intergenic
1123201808 14:106673339-106673361 CAGCAGCTTCACTTCTCTCTGGG + Intergenic
1125300929 15:38252770-38252792 CAGAGGCGGCGCTTCCCTCAGGG - Exonic
1125375764 15:39027694-39027716 CAGATGCAGAAGTTATCTCTTGG + Intergenic
1127737028 15:61851247-61851269 CGGAGGGAGCACATTTCTCTTGG - Intergenic
1129461575 15:75702554-75702576 CAGAGGCAGCCCCTCCCACTGGG - Intronic
1130075196 15:80682802-80682824 GAGGGGCAGCACTTGGCTCTGGG + Intronic
1130101695 15:80899535-80899557 CTGTGGCAGTACTTCTCCCTAGG - Intronic
1131271561 15:90950396-90950418 CTGAGACAGCAGTACTCTCTTGG + Intronic
1132432853 15:101774846-101774868 CAGAGGCAGCACTAGCCTGTGGG - Intergenic
1133541593 16:6760839-6760861 CAGAGGCAGCGCCACTCCCTGGG - Intronic
1133828640 16:9301644-9301666 CAGTGGCAGCACTTATCTTACGG - Intergenic
1135267786 16:21042186-21042208 CACAGACAGCACTTCTACCTGGG + Exonic
1135862240 16:26067274-26067296 CTGATTCAGAACTTCTCTCTAGG - Intronic
1136387727 16:29940269-29940291 CAGAGGCAGCTCCTGTATCTTGG - Intergenic
1137559217 16:49492393-49492415 CAGAGGCACCGCGTCTCTCCTGG + Intronic
1138457976 16:57132227-57132249 CTGGGGCAGGAGTTCTCTCTGGG - Intronic
1140221338 16:73046822-73046844 CAGAGCCATCTGTTCTCTCTGGG + Intronic
1140778086 16:78268552-78268574 TAGAGGCAGAATTTCTCTCCAGG + Intronic
1141326669 16:83066479-83066501 AAGAGGCAGTTCTTCTCTTTGGG - Intronic
1142273924 16:89105779-89105801 CAGAGGCAGAACATCTCCCAGGG + Intronic
1142516905 17:437641-437663 CAGAGGCAGAACTGCTGTATCGG + Intergenic
1142882037 17:2889410-2889432 CAGAGGCCTCTGTTCTCTCTGGG + Intronic
1142886628 17:2916800-2916822 CACAGTCAGGGCTTCTCTCTAGG + Intronic
1144864966 17:18329686-18329708 CAGAGGCTGCATTTCTCTGTGGG - Intronic
1145273864 17:21418645-21418667 CCGAGGCAGCTCTTTCCTCTCGG + Exonic
1148804634 17:50257972-50257994 CTGAGGCAGGACTTCCCACTGGG - Intergenic
1149033339 17:52107654-52107676 CAGAGCCAGCTTTTCTCCCTTGG - Intronic
1150206827 17:63415383-63415405 CAGGGCCAGAACTCCTCTCTAGG + Intronic
1150507451 17:65713941-65713963 CAAAGCCACCTCTTCTCTCTCGG + Intronic
1151769001 17:76147451-76147473 CAGAGTCAGGACAGCTCTCTGGG - Intronic
1151967117 17:77437250-77437272 CAGAGGCCTCACTTCTCTCCAGG - Intronic
1152600375 17:81259266-81259288 CAGAGCCGGCACTGCTCACTGGG + Intronic
1152837894 17:82546578-82546600 GGGACGCAGCACTTCACTCTTGG - Intronic
1153277118 18:3378428-3378450 CAGAGGGAGGCCTTGTCTCTGGG - Intergenic
1154309464 18:13255804-13255826 CAGACGCACCACATCTCCCTCGG - Intronic
1155238450 18:23844064-23844086 CAGATGCAGCCCTTGTCTCCTGG - Intronic
1156700473 18:39818898-39818920 CAGAGGCAGGACTTCTGACAAGG + Intergenic
1157468938 18:47972875-47972897 AAAATACAGCACTTCTCTCTTGG - Intergenic
1157726202 18:49966033-49966055 CAGCTGCAACATTTCTCTCTGGG - Intronic
1157907116 18:51579061-51579083 CAGAGGCTGCAGTGGTCTCTGGG + Intergenic
1158505150 18:58041021-58041043 CAGAGCAAGAACTTGTCTCTCGG + Intergenic
1158607846 18:58911698-58911720 AAGAAGCAGCCCTTGTCTCTTGG + Intronic
1160076804 18:75685067-75685089 CAGGGCTAGCACTTCTCTCTGGG + Intergenic
1160329235 18:77977228-77977250 CAGGGCCACCCCTTCTCTCTGGG - Intergenic
1161498311 19:4599024-4599046 CAGAGGCTGCGCTGTTCTCTGGG + Intergenic
1164423923 19:28122997-28123019 CAGAGGCAGAATTGCTCTCAGGG + Intergenic
1166352082 19:42204027-42204049 CAGGAGCAGCTCTCCTCTCTAGG - Intronic
1166666127 19:44681488-44681510 CAGAAGCAGCATTTGTCTCCGGG + Intronic
1168256043 19:55165930-55165952 CAGAAGCAGCACATCTAGCTCGG + Exonic
924959406 2:20205-20227 CAGAGGAAGGTCTCCTCTCTCGG + Intergenic
925205235 2:2000357-2000379 CAGAGGCAGAAATTTCCTCTGGG + Intronic
925307736 2:2862006-2862028 CAGAGGGAGCACGGCTCACTAGG + Intergenic
926363849 2:12115181-12115203 CACAGGCAGCACTTCCTTATGGG - Intergenic
926440610 2:12884797-12884819 CAGAGGTCACACTTCTTTCTTGG - Intergenic
927271988 2:21221179-21221201 CAGAGGCAGCACAGCTATGTGGG + Intergenic
927927462 2:27023888-27023910 CAGAGGCATCCCTTCTCTACAGG - Intronic
928169564 2:28994779-28994801 CAGAGGCAGCAGCTATTTCTGGG - Exonic
928359905 2:30654669-30654691 CAGCGGCAGCACTTCACAGTTGG - Intergenic
929962152 2:46504895-46504917 CACAGGCACCCCTTCTCTGTGGG + Intronic
930205591 2:48584214-48584236 CAGAGGAAGCATTTTTCTTTGGG + Intronic
930515531 2:52402517-52402539 CAAAGGAAGGCCTTCTCTCTGGG - Intergenic
932054693 2:68432480-68432502 CAGAGGTAGCACCTCTCTGCAGG + Intergenic
932978188 2:76629889-76629911 CACAGGGAGCACTACTCCCTGGG - Intergenic
933158012 2:78995138-78995160 CAGAGCCAGCACCTTTCTCCTGG + Intergenic
935832035 2:107010533-107010555 CAGAGGCAACACTTGTCTATCGG - Intergenic
937956790 2:127426314-127426336 CAATGGCAGCGCTTCCCTCTCGG - Intronic
938291023 2:130150596-130150618 CAGGGGAAGCAGTTCTGTCTGGG - Intergenic
938465521 2:131522360-131522382 CAGGGGAAGCAGTTCTGTCTGGG + Intergenic
940321039 2:152376728-152376750 CAGAGGCAGCCCTGCTTTTTAGG + Intronic
940707983 2:157127327-157127349 CAGTGGCTCCACATCTCTCTAGG + Intergenic
944320569 2:198336889-198336911 CAGATGCAACTCTTCTCTGTAGG - Intronic
944581623 2:201137313-201137335 CAGAGTCAGGACTGCTCCCTGGG - Intronic
944937789 2:204587657-204587679 CAGAGCCTGCTCTTCTCCCTTGG - Intronic
948211923 2:236200526-236200548 CAGAAGCAGCAGTCCTCGCTTGG + Intronic
948523285 2:238554979-238555001 CAGGGGCAGCACCTCTCACAGGG - Intergenic
948534989 2:238639019-238639041 CAGAGGCAGCACTTGACTGCAGG - Intergenic
1168893628 20:1309493-1309515 CTGAGGCACCACTGCCCTCTTGG + Intergenic
1168986609 20:2054425-2054447 CAGAGGGAGCACTTGACTCAGGG - Intergenic
1171425249 20:25044790-25044812 CTGAGGCAGCCCTTCTCCCCTGG - Intronic
1172110451 20:32541628-32541650 CAGAGGCCCAGCTTCTCTCTGGG + Intronic
1172202744 20:33138396-33138418 CAGAAGCAGCCATTCTCACTGGG - Intergenic
1172519696 20:35558760-35558782 CAGAGGAAGCACTAGACTCTGGG + Intergenic
1172991095 20:39037527-39037549 CAGGGCCTGCAGTTCTCTCTGGG + Intronic
1174115175 20:48221972-48221994 CAGAGGCAGCCCCTCAGTCTTGG - Intergenic
1175960748 20:62635075-62635097 AAGAAACAGCGCTTCTCTCTCGG + Intergenic
1177920209 21:27143294-27143316 CAGTTGCAGCGCTGCTCTCTGGG - Intergenic
1178190425 21:30273648-30273670 CATAGGTAGCATTTCCCTCTGGG - Intergenic
1178920503 21:36735428-36735450 CAGAGGCCACGCCTCTCTCTGGG + Intronic
1179887031 21:44318652-44318674 CACAGGCCCCACTGCTCTCTGGG + Intronic
1180796800 22:18609818-18609840 CAGGCGCAGCACTTCCCGCTGGG + Exonic
1180859070 22:19066789-19066811 AACAGGCAGCACTTCTGCCTGGG - Intronic
1181224924 22:21385453-21385475 CAGGCGCAGCACTTCCCGCTGGG - Exonic
1181253708 22:21549360-21549382 CAGGCGCAGCACTTCCCGCTGGG + Exonic
1181542110 22:23579191-23579213 CAGGGGCAGAACCTCCCTCTCGG - Intronic
1181577119 22:23802197-23802219 CAGAAGCAGGAGTTCTCACTGGG + Intronic
1182097410 22:27635383-27635405 CAGAGGCAGGATTTGTCTCAGGG - Intergenic
1182268367 22:29137025-29137047 CAGGGGCCGCACTTCACTCGCGG - Intronic
1182279445 22:29209341-29209363 AAGAGGCGGCACTTCCCTCCTGG - Intronic
1183248170 22:36709943-36709965 CAGGGCCTGCTCTTCTCTCTCGG + Intergenic
1183751571 22:39723895-39723917 CAGATGCAGCTGTTCTTTCTGGG - Intergenic
950113177 3:10433483-10433505 CAGAGTCAGGACTTATCTTTGGG - Intronic
950195688 3:11007697-11007719 TAGGGGCAGCACTCCCCTCTTGG - Intronic
950296521 3:11837214-11837236 CAGAAGCAGCACATCACTGTTGG + Intronic
950330208 3:12150238-12150260 CAGAGGAAACACATCTCTCTAGG - Intronic
953404120 3:42652135-42652157 CAGAGGCAGAATTTCTCTCTTGG - Intergenic
954202502 3:49032426-49032448 AAGAGGCAGCTATTCTGTCTGGG + Intronic
955100623 3:55845933-55845955 CAGAGGCTGCCCTTCTTTCTGGG - Intronic
955952204 3:64253641-64253663 CAGATCCAGCACTTGTCTCATGG - Intronic
957218950 3:77357451-77357473 CAGACGCAGCCCTTCTATCCTGG + Intronic
960568098 3:119156545-119156567 CAGAGGCAGGTCTTCTCTGCTGG + Intronic
961329641 3:126130989-126131011 CAGCGGCAGCAGGTCACTCTCGG - Intronic
961461441 3:127052713-127052735 GCCAGACAGCACTTCTCTCTGGG + Intergenic
962667532 3:137670135-137670157 CTCAGTCAACACTTCTCTCTTGG - Intergenic
963025574 3:140915633-140915655 GAAAGGCAGTACTTCTCTCTAGG + Intergenic
964037182 3:152213581-152213603 AAGAGGCAGTAGTTCTCTCAAGG + Intergenic
965648542 3:170909262-170909284 TAGAGTCAGCACTGCTCCCTGGG + Intergenic
966646350 3:182249873-182249895 CAGAGGAATCACTTCAATCTGGG + Intergenic
966872711 3:184301787-184301809 CAGGGGAAGCACTTCTCTGTGGG - Intronic
968560365 4:1277794-1277816 CACAGGCAGGGCTCCTCTCTGGG - Intergenic
968793605 4:2687143-2687165 GAGAGGAAGCACTCCCCTCTGGG - Intronic
969288777 4:6225338-6225360 CAGAGGCCCCACAACTCTCTGGG - Intergenic
969662254 4:8537127-8537149 CAGAGGCAGCACAGCTGCCTGGG + Intergenic
970235150 4:13951138-13951160 CAGAGGCAGAAATCCTTTCTAGG + Intergenic
970585468 4:17510790-17510812 CAGAGGCAGCACTTCTGCCAAGG - Intronic
970612152 4:17735806-17735828 CAAAGGCAGCAGGTCTCTTTAGG + Intronic
972246188 4:37247272-37247294 CAGAGGCAGCACTTGACCGTGGG + Intronic
979172943 4:117624957-117624979 CAGAGGCAACATTTCTGTCATGG - Intergenic
979763266 4:124433728-124433750 CAGATACAGCACTTCAATCTCGG - Intergenic
980838189 4:138223816-138223838 CTCAGGCAGCACTTTTCTTTTGG + Intronic
982281386 4:153685950-153685972 CAGATGCAGCCCTTCAATCTTGG - Intergenic
983219760 4:165032691-165032713 CAGCGCCAGCACTTCTCTGGCGG + Intronic
985123033 4:186662558-186662580 CAGATACAGCACTGCTCTATAGG + Intronic
985622603 5:963312-963334 CCGAGGCAGCACCTCTGGCTTGG + Intergenic
985864102 5:2498657-2498679 CAGGGTCAGCACTTGTATCTGGG - Intergenic
986121360 5:4839258-4839280 CATAGGCATGACTTCTCTCATGG + Intergenic
986407969 5:7445567-7445589 CAAAGTCACCACTTCTCTTTAGG - Intronic
986589097 5:9350288-9350310 CACAGGCAGAACTTTTTTCTCGG + Intronic
986794079 5:11192082-11192104 CAGAGGCAGCGCCTGTCTCCAGG - Intronic
989580745 5:43030909-43030931 CAGGGGCAGGACTTTCCTCTGGG + Intergenic
990772678 5:59267440-59267462 CAACGGGAGCACTTTTCTCTAGG + Intronic
991139499 5:63223999-63224021 GAGATGTAGAACTTCTCTCTGGG + Intergenic
992131007 5:73692889-73692911 CAGACACTGCCCTTCTCTCTTGG + Intronic
994225157 5:97243589-97243611 CATAGGCAACAATTTTCTCTTGG - Intergenic
996419779 5:123249596-123249618 AAGAGGCAGCATTTTTCTTTAGG - Intergenic
996700988 5:126450159-126450181 AAGAGGCAGCTCTTCTTTCAGGG + Intronic
996884076 5:128335214-128335236 CAGAGGCAGCGATACTCTCCAGG + Exonic
998176192 5:139903740-139903762 CAGCGGCTCCCCTTCTCTCTGGG + Intronic
999268330 5:150281430-150281452 CAGAGGCAGCACCACGCACTGGG + Intronic
999321163 5:150615969-150615991 CAGAAGCACCTCTTCTATCTTGG - Intronic
1001830844 5:174788157-174788179 CAGAGGCAGCCCCTTACTCTTGG - Intergenic
1002755798 6:158448-158470 CAGAGGAAGGTCTCCTCTCTCGG + Intergenic
1005648253 6:27862964-27862986 GGGAGACTGCACTTCTCTCTTGG + Intronic
1005874727 6:30002265-30002287 CACAGCCAGCACCACTCTCTGGG + Intergenic
1008954402 6:57199226-57199248 CAGAGGCATCACTTCCCCCTTGG - Intronic
1009650098 6:66464927-66464949 CAGAAACACCACTTCTCTCTTGG + Intergenic
1011001364 6:82591707-82591729 CAGAGGCAGCAGTTTTTCCTTGG - Intergenic
1011098423 6:83693712-83693734 GAGAGGAAGAACTTCTCCCTAGG + Intronic
1011506033 6:88045207-88045229 CAGAGGCAGGATTTCTCCCCTGG - Intergenic
1013743555 6:113318126-113318148 CAGCGGCAGCATTTTCCTCTCGG + Intergenic
1014465009 6:121745081-121745103 TAGAGGCCGCAGTACTCTCTGGG + Intergenic
1015115708 6:129647196-129647218 AAGGGGCAGAAGTTCTCTCTGGG + Intronic
1017315856 6:153030511-153030533 CAGTGACAGTAGTTCTCTCTTGG - Intronic
1019272686 7:159370-159392 CAGCAGCAGCCCTTCTTTCTGGG + Intergenic
1019321661 7:418811-418833 CAGAGAGAGCACTTCTGTCCTGG - Intergenic
1020366305 7:7384293-7384315 CAGAGGAAGCACTCCTCTTCTGG - Intronic
1024688787 7:51777315-51777337 CAGAGCCAGCACTTCTAGCTAGG + Intergenic
1029198447 7:98822855-98822877 CTGAGCCAGCACTGCTCTCCAGG + Intergenic
1029298599 7:99560702-99560724 CAGAGAAAGCACTTCCGTCTGGG + Intronic
1029601515 7:101566169-101566191 CAGATCCAGTACTACTCTCTTGG - Intergenic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1030636406 7:111954275-111954297 CAGAGGTAGCACTGGTTTCTTGG - Intronic
1031278039 7:119756853-119756875 CAGAGGCAGCCCCTCTGCCTTGG - Intergenic
1032467403 7:132154774-132154796 CAGAGCTAGCAATTTTCTCTTGG - Intronic
1032500187 7:132394219-132394241 CAGAGGCAGCTCTACTGGCTGGG - Intronic
1033097283 7:138442422-138442444 CAGAGTCAGGACTGCTCCCTGGG + Intergenic
1033151271 7:138916877-138916899 GAGGAGCAGCACTACTCTCTGGG + Exonic
1034946177 7:155263299-155263321 CAGGGTGAGCACTTCCCTCTGGG + Intergenic
1035342985 7:158176443-158176465 AAGATGCAGCCCTTCTCCCTAGG + Intronic
1036252240 8:7172297-7172319 CAGAGGCTCGACTTCGCTCTTGG - Intergenic
1036540155 8:9699704-9699726 CAGCGTCATCATTTCTCTCTTGG + Intronic
1037897767 8:22669415-22669437 CAGTGGCAGCAATTGTCTGTGGG + Intergenic
1038645055 8:29354006-29354028 TAGAAGCTGTACTTCTCTCTGGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1041760687 8:61362927-61362949 AAGAGACAGCTCTTTTCTCTGGG + Intronic
1045019568 8:98030257-98030279 CAGATGCCTCACTTCTCTCTTGG + Intronic
1045318730 8:101065258-101065280 CAGAGGCTTCACTCATCTCTTGG - Intergenic
1045741514 8:105365952-105365974 CAGAGGCTGAAATTTTCTCTGGG - Intronic
1046426595 8:114060290-114060312 CAGAGGCAACAGCTTTCTCTTGG - Intergenic
1047275534 8:123402285-123402307 CAGAGTCAGGACTGCTCCCTGGG + Intronic
1048313960 8:133348553-133348575 CCAGGGCAGCTCTTCTCTCTGGG + Intergenic
1050702345 9:8354863-8354885 CAGGAACAGCATTTCTCTCTTGG - Intronic
1052340590 9:27360834-27360856 CAGTGCCAGAACTTCTCCCTGGG - Intronic
1052473129 9:28925201-28925223 CAAAGGCAAGACTTTTCTCTGGG - Intergenic
1054866960 9:70012775-70012797 CAGGGGCAGCACTGTTCTATTGG - Intergenic
1056130804 9:83584707-83584729 AAGAGCCAGCACTCCTCTCAGGG + Intergenic
1056642430 9:88382850-88382872 CAGAGGCAGCTCTTCTGTGTTGG - Intergenic
1057948102 9:99347560-99347582 CAGAGGCAGCTCTTCCATCCTGG + Intergenic
1058116002 9:101084939-101084961 CATAAGCAGAACTCCTCTCTGGG + Intronic
1059625844 9:116065152-116065174 CAGAGGCAGGACAGCTATCTGGG + Intergenic
1060680380 9:125557777-125557799 CAGAGACAGCACTACCCTCATGG - Intronic
1061236730 9:129347576-129347598 GGGAGGCAGCACTTGTCTCCTGG - Intergenic
1062548351 9:137074036-137074058 CAGAGGAGGCACATGTCTCTTGG - Intergenic
1186833898 X:13418418-13418440 CAGAGTCAGCAGTTCTGACTAGG - Intergenic
1187574448 X:20539793-20539815 CAGAGGCAAGACCTCTTTCTGGG - Intergenic
1187826408 X:23335784-23335806 CAGAGACCACACTTCTTTCTGGG - Intronic
1188392213 X:29634593-29634615 CAAAGGCAGGTCTTTTCTCTTGG - Intronic
1190537170 X:51440829-51440851 AAGAGGAAACACATCTCTCTGGG - Intergenic
1191893911 X:65973055-65973077 CAGAGCCAGTATTTCTCTCCAGG - Intergenic
1192233101 X:69279214-69279236 CAGAGGCAGGACTGCTGTCCAGG + Intergenic
1194323466 X:92480941-92480963 CAGAGGCAGCATGGCTCTCTAGG + Intronic
1196338235 X:114564580-114564602 CAGAGGCAGCCCCTCAGTCTTGG - Intergenic
1197689569 X:129483317-129483339 CAGAGGCTGCATATCTGTCTTGG + Intronic
1198236283 X:134738539-134738561 CAGAAGCAATTCTTCTCTCTGGG - Intronic
1199510995 X:148622385-148622407 CGGAGGCAGAACTTCTTTCCTGG + Intronic
1200631567 Y:5594107-5594129 CAGAGGCAGCATGGCTCTCTAGG + Intronic