ID: 1106388070

View in Genome Browser
Species Human (GRCh38)
Location 13:29307535-29307557
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 10, 1: 16, 2: 16, 3: 43, 4: 339}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106388070_1106388076 11 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388076 13:29307569-29307591 GGTGTCAGAGGGCCCCCTCAAGG 0: 2
1: 1
2: 3
3: 20
4: 174
1106388070_1106388079 21 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388079 13:29307579-29307601 GGCCCCCTCAAGGGCATCCTGGG 0: 5
1: 17
2: 8
3: 12
4: 148
1106388070_1106388073 -10 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388073 13:29307548-29307570 CATCAAGAAGGTGGTAAAGCAGG 0: 2
1: 7
2: 19
3: 39
4: 286
1106388070_1106388078 20 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388078 13:29307578-29307600 GGGCCCCCTCAAGGGCATCCTGG 0: 8
1: 10
2: 12
3: 20
4: 150
1106388070_1106388077 12 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG 0: 2
1: 1
2: 6
3: 15
4: 87
1106388070_1106388074 -1 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388074 13:29307557-29307579 GGTGGTAAAGCAGGTGTCAGAGG 0: 1
1: 1
2: 4
3: 24
4: 235
1106388070_1106388075 0 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388075 13:29307558-29307580 GTGGTAAAGCAGGTGTCAGAGGG 0: 1
1: 1
2: 3
3: 32
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106388070 Original CRISPR CTTCTTGATGTCATCATATT TGG (reversed) Intronic
900426544 1:2582791-2582813 CCTCATAATGTCATCACATTAGG - Intergenic
901171758 1:7263924-7263946 ATTCTTAATATTATCATATTAGG - Intronic
903651955 1:24927899-24927921 CTTCTTGTTTTCGTGATATTTGG - Intronic
904707490 1:32402338-32402360 CTTCTTGATGTCATCATATTTGG + Intergenic
905076757 1:35278749-35278771 CTTTTTGAGGTTATAATATTTGG - Intronic
907089023 1:51707367-51707389 CTTCTTAATGTCATCGTATTTGG + Intronic
907821564 1:57975045-57975067 CCTCTTAATGCCATCATATTGGG - Intronic
907932581 1:59014483-59014505 AATCTTGATGTCTGCATATTTGG + Intergenic
910149127 1:84120353-84120375 CTGACTGATGTCATCATTTTAGG - Intronic
910442688 1:87268799-87268821 CCTCTTAATATTATCATATTGGG - Intergenic
910585573 1:88875679-88875701 CTTCAGGATGTCACCATACTCGG + Intronic
910612988 1:89165188-89165210 CTTCTTAATATCATCACCTTGGG - Intronic
910900467 1:92115025-92115047 CACCTTGATGTCATCATATTTGG + Intronic
910984014 1:92986885-92986907 CCTCCTGATACCATCATATTGGG + Intergenic
911121676 1:94302776-94302798 CTCCTTGATGTCATCATATTTGG - Intergenic
911564448 1:99446688-99446710 TTTCTTGATGTCTTAATTTTTGG - Intergenic
911569588 1:99507373-99507395 CTTTTTGATGTGATCTCATTCGG - Intergenic
913227662 1:116714060-116714082 CTTCTTGATGTCATCATATGTGG + Intergenic
913503675 1:119496063-119496085 CTTCTTGATGTCATCATATTTGG + Intergenic
913507770 1:119533977-119533999 TTTCTTGATGTCATCATTTTTGG + Intergenic
913510695 1:119558979-119559001 CTTCTTGATGTTATCATATTTGG + Intergenic
913514911 1:119596394-119596416 CTGCTTGATGTTATCATATTTGG + Intergenic
914325520 1:146611656-146611678 CGTCTTAATGCCATCATCTTGGG + Intergenic
915612381 1:157004784-157004806 CTTCCTGATGTCATCTTTGTGGG - Intronic
916142841 1:161714089-161714111 CTTCTTAATGCCATCACCTTGGG - Exonic
916191803 1:162186548-162186570 CCTCTTGATATCATCCCATTGGG - Intronic
916263328 1:162864188-162864210 CTTCTGGTTTTCATCATTTTTGG - Intronic
916565643 1:165974445-165974467 CTTCTTTATGTCATCAAGTTAGG + Intergenic
918007837 1:180558690-180558712 CTTCTTGATTTAATAAAATTTGG + Intergenic
918811839 1:189132535-189132557 CTTCTTGATGTTATCATATTTGG + Intergenic
918905735 1:190490387-190490409 CTTCTTTAGGTTATCATGTTGGG + Intergenic
919064864 1:192681767-192681789 TTTCTTGATGTCATTGTTTTAGG + Intergenic
919209179 1:194456580-194456602 CATATTGTTGTCATCATTTTGGG + Intergenic
919588453 1:199469051-199469073 CTCCTTCATGTGATGATATTAGG - Intergenic
919975977 1:202612932-202612954 CTTTTTGATGTCATTATAAATGG + Intronic
920515899 1:206584475-206584497 CTCCTTGATGGCATCATAGATGG - Exonic
920617466 1:207507585-207507607 CTTATTAATGTGATCTTATTTGG - Intronic
920618090 1:207514398-207514420 CTTCCTAATGTCATCACTTTAGG - Intronic
921414616 1:214871473-214871495 CTTGTTGGTGTCATCATATTTGG - Intergenic
921422653 1:214966343-214966365 CTTCTTGATATCAGTATATGTGG - Intergenic
924163413 1:241257360-241257382 CTTCTTAATATTATCATATTGGG + Intronic
1064409611 10:15093480-15093502 CTTCCTGATGTCATCCTATTTGG + Intergenic
1064710470 10:18118718-18118740 CCTCTTAATGTCATCACATTGGG + Intergenic
1064730920 10:18330322-18330344 CTTGTTGATGTCATGAGTTTTGG - Intronic
1064878123 10:20018205-20018227 CTTCCTGATGTAATCTTACTAGG + Intronic
1065784185 10:29198320-29198342 CTTCTTCACGTCATGGTATTTGG + Intergenic
1065808672 10:29420746-29420768 TTTCTTGATGTCTTCATTTGTGG - Intergenic
1065911777 10:30312891-30312913 TCTATTGATGTCATCATATTTGG + Exonic
1066258819 10:33708631-33708653 CAGCTTGATTTCTTCATATTTGG - Intergenic
1067659471 10:48223730-48223752 CTTCCTAATGCCATCAGATTGGG - Intronic
1068338358 10:55667575-55667597 CTTCTCGATGCCATCATATTTGG + Intergenic
1071995067 10:91139904-91139926 CCTCTTCATATCATCATCTTGGG - Intergenic
1072046998 10:91667006-91667028 CTTCTTGATGTCATCATATTTGG + Intergenic
1074671909 10:115800671-115800693 CTTCTTAATACCATCACATTGGG - Intronic
1075098708 10:119490675-119490697 CCTCTTGATATCATCACACTGGG - Intergenic
1075552222 10:123400960-123400982 CTTCTTGGTGTCTCCATATCAGG + Intergenic
1076502395 10:130947711-130947733 CCTCATGATGTCCTCACATTTGG - Intergenic
1076634689 10:131874490-131874512 CTTATTGATGTCACCAAATCCGG - Intergenic
1078604549 11:12763607-12763629 CATCTTGATGATCTCATATTGGG + Intronic
1080762511 11:35265596-35265618 GTTCTTCATGTCATCATAAATGG + Exonic
1080785303 11:35469934-35469956 ACTCTTGCTGTGATCATATTAGG - Intronic
1081136366 11:39444517-39444539 CTTCTTTTTATCATGATATTTGG - Intergenic
1081256631 11:40904803-40904825 CTTCTTTATGTCTTGATTTTAGG + Intronic
1081515485 11:43824655-43824677 CCTCTTAATGTCACCATATTGGG + Intronic
1082113600 11:48304612-48304634 CTTATTGATGTCTGCACATTTGG + Intergenic
1083244464 11:61415724-61415746 CTTCATGATATCTTCAAATTCGG + Exonic
1084221962 11:67687642-67687664 CCTCTTAATACCATCATATTGGG - Intergenic
1085494763 11:76958575-76958597 CTTGTTGATGCCATTGTATTTGG - Intronic
1086244692 11:84738463-84738485 CTTCTTGATTTCAATATACTAGG + Intronic
1086581799 11:88408405-88408427 CTTCTTGATGTCATCATATTTGG + Intergenic
1086978691 11:93168514-93168536 CTTTTTGAGATCATCAAATTTGG + Intronic
1087022141 11:93614431-93614453 CTGCTTAATGTCATCACAATGGG + Intergenic
1087358302 11:97123288-97123310 CCTCATGATGTAACCATATTTGG + Intergenic
1087361691 11:97168343-97168365 CTTGTTGATGGTAGCATATTGGG - Intergenic
1087461024 11:98447500-98447522 CGTCTTGAAGTAATCTTATTTGG + Intergenic
1087515103 11:99149635-99149657 CTTCTTGATCTCCTTAAATTTGG + Intronic
1087739234 11:101868819-101868841 CTTCCTCATACCATCATATTGGG + Intronic
1088550004 11:111003155-111003177 CTTCTTAATGTGATTTTATTAGG + Intergenic
1088722239 11:112604300-112604322 CTTCTTAAGGTCACCATCTTTGG + Intergenic
1089835825 11:121369793-121369815 CATCTTGTAGTCATCTTATTTGG + Intergenic
1090694656 11:129226781-129226803 TGTCTTAATTTCATCATATTTGG - Intronic
1090756531 11:129796719-129796741 TTTCTGGAAGTCATTATATTAGG - Intergenic
1091854281 12:3726569-3726591 CTTCTTCCTGTTATCATATACGG - Intronic
1091924644 12:4335431-4335453 CCTCCTAATGTCATCATATTGGG - Intronic
1092193920 12:6537816-6537838 CTTCTTGATGTCATCATATTTGG - Exonic
1092555645 12:9558311-9558333 CTTCTTTATATCAGCAGATTTGG - Intergenic
1093831973 12:23772221-23772243 TTTTTTGATGTCTTCATCTTTGG + Intronic
1094137197 12:27140542-27140564 CTTTTTGAGGTCATCTAATTTGG + Intergenic
1094257028 12:28443621-28443643 TTTCTTTTTTTCATCATATTAGG - Intronic
1094516455 12:31132364-31132386 CTTCTTTATATCAGCAGATTTGG + Intergenic
1095856891 12:46870082-46870104 CTTAATGATGTAATCTTATTTGG - Intergenic
1097693508 12:62755984-62756006 CTTCTTGATGTCATCATATTTGG - Intronic
1097912642 12:64987006-64987028 TTTCTTGTTGTCATGATCTTTGG + Intergenic
1098538000 12:71617502-71617524 CTTCTTGATGCCAGCTTAATTGG - Intronic
1099009552 12:77275871-77275893 CCTATTGATGTCATCACTTTGGG + Intergenic
1100284153 12:93148929-93148951 ATTCTTTATCTAATCATATTAGG + Intergenic
1100576583 12:95897278-95897300 CTTCCTTCTGTCATCATTTTTGG - Intronic
1100606297 12:96154609-96154631 CCTCCTGATGCCATCACATTAGG - Intergenic
1100984918 12:100194537-100194559 CTTCTAAATATCATCACATTGGG + Intergenic
1102838919 12:116096752-116096774 ATTCTTGATGTAATTATTTTAGG - Exonic
1102991433 12:117318999-117319021 CTTCTAGATTTCATCATGCTTGG + Intronic
1106125486 13:26897250-26897272 CCTCTTCATGTCATCACATTGGG + Intergenic
1106388070 13:29307535-29307557 CTTCTTGATGTCATCATATTTGG - Intronic
1106392692 13:29350916-29350938 CTTACAGATGTCATCACATTAGG + Intronic
1107115364 13:36740697-36740719 ATTCTTGATGTCATTGTACTTGG - Intergenic
1107300783 13:38963765-38963787 CTTCCTAATATCATCACATTGGG - Intergenic
1107348402 13:39488035-39488057 CTTCTTAATACCATCTTATTGGG - Intronic
1107625054 13:42273279-42273301 TTTTTTAATGTCATCATTTTAGG + Intronic
1108111540 13:47079271-47079293 CCTCTAAATATCATCATATTGGG - Intergenic
1108496638 13:51031867-51031889 CTTCTTGATGCCATAAGAGTAGG - Intergenic
1109776754 13:67051295-67051317 CTTTGTGATGTCATCTTTTTGGG + Intronic
1111461269 13:88545569-88545591 CCTCCTAATGTCATCATACTGGG - Intergenic
1111699334 13:91666069-91666091 CCTCTTATTGTCTTCATATTTGG + Intronic
1111823628 13:93243050-93243072 CTTCTCGAGGGCATTATATTGGG - Intronic
1113308040 13:109099561-109099583 CCTCTTAATATCATCATATTGGG + Intronic
1114962463 14:27910997-27911019 CCTCCTGATATCATCATCTTGGG - Intergenic
1115208520 14:30940929-30940951 CCTCTTAATACCATCATATTGGG - Intronic
1115854360 14:37614066-37614088 CTTTTTGATTTCATCATTTAGGG + Intronic
1117094928 14:52287116-52287138 CTTTTTGAAGTCATCCCATTTGG - Intergenic
1117995521 14:61474201-61474223 GTTCTTGGTGTCACCATCTTAGG + Intronic
1118167211 14:63348397-63348419 CTTCTTGATGTACTGATATGAGG + Intergenic
1118171603 14:63394682-63394704 CTTCTTTTTCTCTTCATATTAGG + Intronic
1119863633 14:77955318-77955340 CTTCTTAATGCCATCATTTTGGG + Intergenic
1120825142 14:88948229-88948251 CTTCTTGATGTTGTAATATTTGG + Intergenic
1120956107 14:90083667-90083689 CTTCTTGCTGTCATCACAGGAGG - Intronic
1122001280 14:98656596-98656618 CTTCTCTCTGTCATCATGTTTGG - Intergenic
1124378707 15:29146051-29146073 CTTCTTGATGCTATCATAAATGG - Intronic
1124491626 15:30161262-30161284 CTTTTTGATGTCATTATAAGTGG + Intergenic
1124751911 15:32377044-32377066 CTTTTTGATGTCATTATAAGTGG - Intergenic
1124928443 15:34095657-34095679 TTTCTTTATGTAATCATATTAGG + Intronic
1126016400 15:44355443-44355465 CTTCTTGAAGCCATCATATTTGG - Intronic
1126644627 15:50862579-50862601 CTTCTTAATACCATCATATTGGG - Intergenic
1127045648 15:55022616-55022638 CTTCTTGATTTCATTTTCTTTGG + Intergenic
1127706939 15:61556725-61556747 CTTCTTAATATCATCACACTGGG - Intergenic
1128364675 15:66989699-66989721 TGTCTTGAGGTCATCTTATTTGG - Intergenic
1128469832 15:67942997-67943019 CTTCCTAATATCATCACATTGGG - Intergenic
1128860760 15:71069711-71069733 CCTCCTAATCTCATCATATTGGG + Intergenic
1129490773 15:75923353-75923375 CTGCTTGATGTCAGCAGTTTTGG + Intronic
1130210987 15:81921416-81921438 CTTTTTGAGTTCATCTTATTTGG - Intergenic
1131342357 15:91614314-91614336 CTTCTTGAAGTCTTCATTTTGGG + Intergenic
1132149375 15:99448522-99448544 CTTCCAAATGTCACCATATTTGG - Intergenic
1133128899 16:3664286-3664308 CTTCTTCATGGCCTCATAGTAGG + Exonic
1133581701 16:7150500-7150522 CTTCATGGTGTCATCATTTATGG - Intronic
1134557484 16:15177952-15177974 CTTCTAAATAGCATCATATTGGG + Intergenic
1134918053 16:18089631-18089653 CTTCTAAATAGCATCATATTGGG + Intergenic
1135104439 16:19635630-19635652 CCACTTGCTGTCATCAAATTGGG - Intronic
1137813601 16:51376663-51376685 CATCTTAATGTCTTCATGTTAGG - Intergenic
1138253633 16:55530613-55530635 CATCTTCATGTCATCATGTGTGG - Intronic
1140008042 16:71099291-71099313 CGTCTTAATGCCATCATCTTGGG - Intronic
1140313484 16:73871640-73871662 CATCTTGATGTCATCTTTTCAGG - Intergenic
1143213146 17:5204257-5204279 CTTCTTAATACCATCATCTTGGG - Intergenic
1144528774 17:16015600-16015622 ATTTTTGATGACATAATATTTGG + Intronic
1146429434 17:32777267-32777289 TTTCTTCTTTTCATCATATTGGG - Intronic
1146510360 17:33442511-33442533 CTTTTTGATGACATCATAAATGG + Intronic
1146590551 17:34124860-34124882 CCTCCTTATATCATCATATTGGG + Intronic
1146851248 17:36223520-36223542 CTTCTTAACATCATCACATTAGG + Intronic
1146867162 17:36347387-36347409 CTTCTTAACATCATCACATTAGG + Intronic
1147070035 17:37947996-37948018 CTTCTTAACATCATCACATTAGG + Intergenic
1147081556 17:38027516-38027538 CTTCTTAACATCATCACATTAGG + Intronic
1147097507 17:38151491-38151513 CTTCTTAACATCATCACATTAGG + Intergenic
1148964414 17:51422646-51422668 GTTCTTGATGTCATCAGTTGGGG + Intergenic
1149326586 17:55537021-55537043 CTTCTTGATATTATAATTTTTGG - Intergenic
1150079213 17:62221614-62221636 CTTCTTAACATCATCACATTAGG + Intergenic
1152508408 17:80769034-80769056 CCTCTTGATGGCATCATTGTTGG + Intronic
1153341313 18:3977871-3977893 CTTCCTGATGTCATCATATCTGG + Intronic
1153364954 18:4245811-4245833 CTTGTAGGTGTGATCATATTAGG - Intronic
1155833026 18:30541949-30541971 CTTCCTGATAACATCACATTGGG + Intergenic
1157004485 18:43565616-43565638 CTTCTTTATAGCATCATATCAGG - Intergenic
1157703866 18:49784475-49784497 TTTCTCGAAGTCATCATATTAGG - Intronic
1159560550 18:69988340-69988362 CTTCTTTGGGTCATCCTATTTGG - Intergenic
1159585076 18:70276349-70276371 TTTAATGATGTCATCGTATTTGG - Intergenic
1160353491 18:78205882-78205904 CTTCCTGATAACAACATATTGGG + Intergenic
1162590223 19:11586588-11586610 CTTCTTGAGGTCATCATATTTGG - Intronic
1164065550 19:21712598-21712620 ATAGTTGATGTCATTATATTGGG - Intergenic
1165817584 19:38651522-38651544 CTTCTTGCTGTAATGAGATTTGG - Intronic
1166969914 19:46559392-46559414 TTTCTTGACATCATCATATTTGG - Intronic
1167806460 19:51789635-51789657 TCTCTTAATGCCATCATATTGGG + Intronic
927202053 2:20583955-20583977 TTTCTGAATGTCACCATATTTGG + Intronic
927326518 2:21811529-21811551 CCTCTTAATGCCATCATCTTAGG - Intergenic
927474328 2:23400953-23400975 ATTCTTGATGCTATCATATGAGG - Intronic
929072001 2:38040343-38040365 CTTCTTAATACCATCATATCGGG - Intronic
929098449 2:38286168-38286190 CTTCTTGATGTCATCATATTTGG - Intergenic
929349249 2:40928833-40928855 CTTCTTGATATGATGACATTTGG + Intergenic
929547599 2:42865887-42865909 CTTCCTAATATCATCACATTGGG - Intergenic
930476410 2:51888112-51888134 CTTCTTAATATCATCACATTGGG + Intergenic
930505733 2:52281108-52281130 CTTCCTAATATCATCATCTTTGG + Intergenic
930723116 2:54656958-54656980 CTTCTTCATGTAGTCATGTTGGG + Intronic
935099414 2:99978662-99978684 CTTCTTGATATCATCACCTTGGG - Intronic
935422494 2:102884420-102884442 CTTGTTGAAATGATCATATTTGG - Intergenic
935967212 2:108492211-108492233 CTTCTTCACATCATCATATGTGG - Intronic
936596821 2:113856042-113856064 CATCTTCATCTCATCTTATTTGG + Intergenic
938394577 2:130933676-130933698 CTTTTTGATGACATCATAAATGG + Intronic
938903080 2:135815040-135815062 CTTCTTGCTGTCCTCATATAGGG - Intronic
939018088 2:136924917-136924939 CTTTTTGATGCCATAGTATTTGG + Intronic
939198247 2:139000499-139000521 CTTTGTGATTTCATCAAATTAGG + Intergenic
940362282 2:152808954-152808976 CTTCTTGATTAAATCTTATTGGG + Intergenic
940831413 2:158470513-158470535 GTTCTTGTTGTCATCAGAGTAGG - Intronic
941086970 2:161129225-161129247 CTTTTTAATTTGATCATATTTGG - Intergenic
941408995 2:165129178-165129200 TTTCTTTATGCCATCATATTGGG - Intronic
941777647 2:169410139-169410161 CTCCTTGATGTCATTATAAAGGG + Intergenic
943401367 2:187415598-187415620 CTTCTTGACGTCATCATAATTGG - Intronic
945731224 2:213537856-213537878 CTTCCTGATGTTAACATACTTGG + Intronic
946710886 2:222504093-222504115 CTCCTTGATGTCATTATATTTGG + Intronic
946878658 2:224156173-224156195 CTTCATGATGTCATCCAGTTTGG + Intergenic
947700946 2:232233454-232233476 CCTCCTGATGCCATCACATTGGG + Intronic
948035364 2:234854008-234854030 CTTCCTAATATCATCATATTGGG + Intergenic
1169070592 20:2726757-2726779 CTTCTTGGTGTCATTTTTTTAGG + Intronic
1169518823 20:6349333-6349355 ATTGTTGATAGCATCATATTTGG - Intergenic
1169533448 20:6510479-6510501 CTTTTTGATGCTATCATATATGG + Intergenic
1170169310 20:13393430-13393452 CTTCTTGATATCATCATATTTGG - Intronic
1170349513 20:15423729-15423751 CCTCCTAATGCCATCATATTGGG + Intronic
1170349787 20:15426242-15426264 CTGCTTGATATCAACATGTTGGG + Intronic
1170782072 20:19434862-19434884 CTTCTTGCTGGCATCATACAGGG + Intronic
1172588052 20:36098667-36098689 CTTCATAATGTGACCATATTTGG - Intronic
1173450561 20:43159892-43159914 GTGCTGGATGTCATCAGATTAGG - Intronic
1176928128 21:14775039-14775061 TTTCTTGATGCCATCACAATTGG - Intergenic
1177100146 21:16891035-16891057 CATTTTGATATCATAATATTTGG - Intergenic
1177508637 21:22052958-22052980 ATTCCTGATGTGATGATATTAGG - Intergenic
1177709014 21:24746730-24746752 CTTCCTAATACCATCATATTGGG - Intergenic
1177865036 21:26502118-26502140 CTGCTTGATTTCATTAGATTTGG - Intronic
1178096700 21:29223035-29223057 CTTCTTGATGTAATCATATTTGG - Intronic
1178097025 21:29226911-29226933 CTTCCTAATATCATCATGTTGGG + Intronic
1179423918 21:41257751-41257773 CTCCTTGGTCTCATTATATTAGG - Intronic
1182743251 22:32584252-32584274 CGTCATGATGTCATCATAATAGG - Intronic
1183861516 22:40673691-40673713 CCTCTTGATGTCACTGTATTTGG + Intergenic
1185012112 22:48320014-48320036 GTTCTTAATGTGATCATAGTGGG + Intergenic
950853890 3:16087762-16087784 CTTCTTTATTTCATCGTCTTTGG - Intergenic
950990525 3:17433426-17433448 CTCCTTCATGCCATCATATGAGG - Intronic
952963116 3:38605033-38605055 CTCCATGATGTCCTCATTTTGGG - Intronic
953729259 3:45430957-45430979 CTTCCTAGTGTCATCACATTGGG - Intronic
953932367 3:47011983-47012005 CTTCTTGATCTCTTCCTTTTTGG - Intergenic
954521297 3:51228926-51228948 CTTCTTGATGCCATAATAATGGG + Intronic
954948361 3:54446623-54446645 CTTTTTGATCAAATCATATTTGG + Intronic
955581293 3:60425873-60425895 CTTCTTCATGGCATCTTATATGG - Intronic
955613847 3:60784744-60784766 CTTCCTCATGCCATCACATTGGG - Intronic
956429437 3:69170185-69170207 CTACTTCAAGTAATCATATTGGG - Exonic
956441545 3:69285443-69285465 CTTATAGTTGTCATCAAATTCGG - Intronic
957901576 3:86500793-86500815 CTACTTGATGTCATTAGTTTGGG + Intergenic
958103775 3:89047671-89047693 CTTTTTGATGTTATCATATTTGG + Intergenic
958626614 3:96633169-96633191 CCTCCTAATGTCATCACATTGGG - Intergenic
959264861 3:104124460-104124482 CTTCCTAATATCATCATTTTGGG - Intergenic
959776961 3:110176934-110176956 CTTCTTAATATCATTACATTGGG + Intergenic
959900414 3:111654669-111654691 CTTCTTTATGTTGTGATATTGGG - Intronic
960652481 3:119966877-119966899 CTTTTTGATGTTATTATATTTGG - Intronic
960851521 3:122059738-122059760 CTTCAGGATTTGATCATATTTGG + Intronic
961995776 3:131240609-131240631 TCTATCGATGTCATCATATTTGG + Intronic
962038589 3:131681590-131681612 TGTCTTGAAGTCATCTTATTTGG + Intronic
962374331 3:134847617-134847639 CTTCTTCTTGTCCTCATCTTGGG - Intronic
962489279 3:135876443-135876465 CTTCTTGATTTAATCTTAGTAGG - Intergenic
962787094 3:138778572-138778594 CTTCATGATGTCATTGTATTTGG - Intronic
963190108 3:142461056-142461078 CTCCTTAATGTCATCAAATCTGG + Intronic
963292204 3:143503496-143503518 CTTCATGATGTCATCATATTTGG + Intronic
963398312 3:144761895-144761917 CTTAATTATTTCATCATATTTGG - Intergenic
963969111 3:151409655-151409677 AGTTTTGAAGTCATCATATTTGG + Intronic
964273274 3:154981561-154981583 CATCTTGATGTCATCTGATGAGG + Intergenic
965923453 3:173947997-173948019 CTTCTTAATGGCCTGATATTTGG + Intronic
966312259 3:178606753-178606775 CCTCTTAATACCATCATATTAGG - Intronic
966464306 3:180212865-180212887 CTTCTTGGAGTCATCACATTTGG - Intergenic
967469264 3:189843335-189843357 CTGCTTGATGTCAACATTTGTGG + Intronic
967622867 3:191654371-191654393 CTTCTCAATGTCATCAGGTTTGG - Intergenic
969133819 4:5013494-5013516 CTTGTAGATGTTATCAGATTAGG + Intergenic
970115546 4:12690910-12690932 GTTCTTTATGTGATCATCTTTGG - Intergenic
971077608 4:23168008-23168030 CTTCTTGATATTATCACATTAGG + Intergenic
971783639 4:31072176-31072198 TTTCTGGGTTTCATCATATTTGG + Intronic
972139082 4:35933872-35933894 ATTCTTGATGTCACCACCTTGGG - Intergenic
972160741 4:36223756-36223778 CTTCTTGATGTCTGCTTATATGG - Intronic
972897112 4:43637112-43637134 GGTCTTCATGTCAGCATATTCGG + Intergenic
973185754 4:47325888-47325910 TTTCTTAATATCATTATATTGGG - Intronic
973537167 4:51895102-51895124 CTTTTTGATACCATCATCTTGGG + Intronic
973739855 4:53909339-53909361 GCCCTGGATGTCATCATATTGGG + Intronic
973910702 4:55577277-55577299 CCTCTTAATGCCATCACATTGGG + Intronic
974660358 4:64880686-64880708 CTTCTTAATATCAACATATTGGG - Intergenic
974684408 4:65206698-65206720 CTTCCTAATGCCATCAAATTAGG + Intergenic
975251147 4:72179438-72179460 CTTCTTGATGGTATGATACTTGG - Intergenic
975706827 4:77120180-77120202 ATTCCTAATATCATCATATTGGG - Intergenic
975929229 4:79498213-79498235 CTTCTTAAAGTTATCACATTGGG + Intergenic
976628044 4:87207842-87207864 CTTCTTGATGTCATCATATTTGG - Intronic
977049177 4:92104873-92104895 ATTCTTAATGTGATCTTATTAGG - Intergenic
977286419 4:95112960-95112982 CTTCCTGATATCATAAAATTAGG + Intronic
977801105 4:101232950-101232972 CTTCTTCATTTCTACATATTAGG + Intronic
977996225 4:103499986-103500008 CTTCCTGATACCATCATATTGGG - Intergenic
978227883 4:106360610-106360632 CTTCCGGATGTGATCTTATTTGG + Intergenic
979803663 4:124943617-124943639 TTTCTTGATGACATGATGTTAGG + Intergenic
980101137 4:128542665-128542687 CCTCTTAATATGATCATATTGGG + Intergenic
980264986 4:130503587-130503609 CTTCTTGATGCTATTATATTTGG + Intergenic
980967752 4:139539718-139539740 CCTCTTAATACCATCATATTGGG - Intronic
981157865 4:141461239-141461261 CCTCTTAATATCATCACATTGGG - Intergenic
981372729 4:143978246-143978268 CTTCTAGCTGGCATAATATTAGG + Intergenic
981649635 4:147041285-147041307 TTTCTTGATCTCATCATGTTTGG - Intergenic
981884537 4:149658014-149658036 CAATTTGATGTAATCATATTTGG + Intergenic
983769093 4:171525830-171525852 CTTCTTCATTACATCATATCAGG + Intergenic
984058405 4:174959292-174959314 CTTCTTGTTTTCATTATTTTAGG + Intronic
986862191 5:11939618-11939640 CCTCTTAATTTCATCACATTAGG + Intergenic
986865341 5:11980456-11980478 CTTCCTGATATCATCACCTTGGG - Intergenic
987345497 5:16975319-16975341 CCTCCTAATGTCATCACATTTGG - Intergenic
988239867 5:28596030-28596052 CCTTTTAATGTCATCATTTTGGG + Intergenic
988437938 5:31197334-31197356 CTGCTGGATGTTATCTTATTTGG - Intronic
988840937 5:35083254-35083276 CCTCTTGATGTCATCATATTTGG + Intronic
989166121 5:38435189-38435211 CTTCTTCACATCATCATAATTGG - Exonic
989458396 5:41668403-41668425 CTTCTTAATACCATCATCTTGGG + Intergenic
990277166 5:54210037-54210059 CTTCTTTGTGTCCTAATATTTGG + Intronic
990904043 5:60783904-60783926 CTTCTTTTTGGCATCAGATTTGG + Intronic
991259903 5:64655667-64655689 CTTCTTAATATCATCACCTTGGG + Intergenic
992264587 5:75005771-75005793 CTTCATTATATCCTCATATTTGG - Intergenic
993390512 5:87314990-87315012 CTTTTTGAGGGCATTATATTTGG + Intronic
993489310 5:88526779-88526801 CTGCTTCATGCAATCATATTGGG - Intergenic
993562547 5:89428847-89428869 CTTCCTGATCACATCATATCAGG - Intergenic
993768682 5:91895527-91895549 CCTCATGATATCATCACATTGGG - Intergenic
994527533 5:100925594-100925616 CTTCCTAATATCATCATATTGGG - Intergenic
994568983 5:101488801-101488823 CTTCTGGATTTCATTACATTTGG + Intergenic
994913600 5:105944608-105944630 CTTCTTAGTATCATCATCTTGGG - Intergenic
996160933 5:120163714-120163736 TTCCTTAATGTCATAATATTTGG + Intergenic
996305655 5:122044194-122044216 CTTTTTAATGGCATCATATGGGG + Intronic
1000300317 5:159950721-159950743 CTTCTTAATGTCATCATATTTGG + Intronic
1000824852 5:166032381-166032403 TTTCTTGAACTCATCATATCTGG - Intergenic
1000841557 5:166225458-166225480 CTTTCTTATATCATCATATTTGG - Intergenic
1001188971 5:169608692-169608714 CTTCCTAATGCCATCACATTGGG + Intergenic
1001797430 5:174514053-174514075 CTTCTTGATGTCATTGTATTTGG - Intergenic
1002492579 5:179589563-179589585 CTTCTTGAAGTGAGCAAATTCGG - Exonic
1003946193 6:11078166-11078188 CTTCCTAATGCCATCACATTGGG - Intergenic
1004422344 6:15482222-15482244 CTTCTTGAAATCATCATGTAAGG + Intronic
1004792207 6:19038982-19039004 CCTCCTAATGTCGTCATATTGGG + Intergenic
1004826340 6:19425439-19425461 CTTCCTAATACCATCATATTGGG + Intergenic
1009023230 6:57967915-57967937 CTTCTTGGTGTTACCATATTTGG + Intergenic
1009198798 6:60719449-60719471 CTTCTTGGTGTTACCATATTTGG + Intergenic
1009403538 6:63285070-63285092 TTTCTTGATATCATCATTTTTGG + Intronic
1009489740 6:64274543-64274565 ATTCTTAATGTGATCATACTTGG - Intronic
1009895731 6:69746601-69746623 CTTCTTTATGTCATCATATTTGG - Intronic
1010781835 6:79953233-79953255 CTTCTTGATGTCATCATATTTGG + Intergenic
1011071803 6:83393160-83393182 CTTCTTGGTGTCATCATATTTGG - Intronic
1012026835 6:94006023-94006045 CTTCTGCATGTCATCACATGAGG - Intergenic
1012181602 6:96161182-96161204 CCTCTTAATATCATCACATTTGG - Intronic
1013096359 6:106948850-106948872 CCTCCTCATGCCATCATATTGGG + Intergenic
1013626753 6:111945535-111945557 CCTCCTGATGCCATCACATTAGG + Intergenic
1014350060 6:120330463-120330485 CCTCTTACTATCATCATATTGGG - Intergenic
1015032837 6:128616499-128616521 CTCCTTGAGTTCATCATATTTGG + Intergenic
1015278810 6:131410245-131410267 CTTCCTGATCTTATCACATTAGG + Intergenic
1015665069 6:135619393-135619415 CTTCTTGATGTCATAATATTTGG + Intergenic
1016198263 6:141374077-141374099 CTTTTTAATGCCATCATATTAGG - Intergenic
1016253969 6:142081232-142081254 CCTCTTAATGCCATCATCTTGGG + Intronic
1017193905 6:151680631-151680653 CTTCCTGTCGCCATCATATTGGG + Intronic
1017459491 6:154635594-154635616 CCTCTTAATATCATCATCTTGGG + Intergenic
1017615297 6:156240840-156240862 CTTCTTGCTGTGTTCTTATTTGG - Intergenic
1017673049 6:156785434-156785456 CTTCTGGATTTCATCAAATATGG - Intronic
1017806585 6:157951821-157951843 CTTCTTAATACCATCACATTGGG - Intergenic
1018658683 6:166065047-166065069 CTTCTTGATGCCATGATATTTGG - Intergenic
1020551772 7:9615735-9615757 CTACTTGATGTCATCATATTTGG - Intergenic
1021220939 7:17974580-17974602 CTTCATGGTGTCATCAACTTAGG + Intergenic
1022728776 7:33003937-33003959 CTGCTTGATGTCCTCATTTATGG + Intronic
1023235950 7:38087435-38087457 CTTCTTAATATTATCACATTGGG - Intergenic
1023886696 7:44362061-44362083 CTTCTTAATATTATCACATTGGG + Intergenic
1024377931 7:48659997-48660019 CCTCTTGATGTCTTCCTAGTTGG - Intergenic
1024557930 7:50619718-50619740 CTTTTTGATGACATCAAACTTGG + Intronic
1024755404 7:52524457-52524479 CTTCTTGATTTCATTTTCTTTGG - Intergenic
1025044872 7:55684052-55684074 CTGCTTGATGTCCTCATTTACGG - Intergenic
1028219723 7:88182916-88182938 CTTCTTCATGCCTTAATATTTGG + Intronic
1028736092 7:94214033-94214055 TTTCTTAATGCTATCATATTGGG - Intergenic
1028786904 7:94805486-94805508 CCTCTTAATATCATCATATTGGG - Intergenic
1029020308 7:97358079-97358101 CTTTTTTGTGTCATCATTTTTGG - Intergenic
1030150433 7:106398999-106399021 CTTGTTAATGTGGTCATATTTGG + Intergenic
1030808768 7:113949271-113949293 CCTCTTGAAGACAACATATTTGG - Intronic
1032320106 7:130878283-130878305 GTTCTTGGTATCATCTTATTAGG + Intergenic
1033320555 7:140335826-140335848 CTTTCTGATGTGATCATACTAGG - Intronic
1034325554 7:150228437-150228459 ATTCTTAATGTAATTATATTGGG - Intergenic
1035788495 8:2281886-2281908 CTAATTGATGTCATAATCTTTGG - Intergenic
1035804310 8:2439819-2439841 CTAATTGATGTCATAATCTTTGG + Intergenic
1037031343 8:14109376-14109398 TTTCTCAATGTCATCTTATTTGG - Intronic
1038121382 8:24620077-24620099 ATTCTAGATGCCATCATTTTAGG - Intergenic
1038283048 8:26182877-26182899 CTTCTTAATACCATCATGTTGGG - Intergenic
1038316659 8:26490171-26490193 TTTCTTGCTGTCCTCATATGTGG + Intronic
1040807760 8:51412620-51412642 ATTGTTGATTTCATCATAATCGG - Intronic
1042210232 8:66372591-66372613 CCTCTTAATGTCACCAAATTGGG + Intergenic
1042691414 8:71503542-71503564 CTCCTTGAGGTCTACATATTTGG + Intronic
1043914688 8:85907733-85907755 CTTTTTAATGTCAGCATTTTGGG - Intergenic
1044811570 8:96068964-96068986 CTTATTGATATCATCATATCTGG + Intergenic
1045258536 8:100550942-100550964 CTTTTTGATGTCATCATATTTGG + Intronic
1045790671 8:105979634-105979656 TATGTTGATGTCATCTTATTTGG - Intergenic
1046543890 8:115622137-115622159 CATCTTGGTGTCATTCTATTAGG + Intronic
1046566312 8:115905605-115905627 CTTCTAGATTTCCTCATGTTTGG - Intergenic
1047065033 8:121272308-121272330 CTTCTTGATGTCAGGAAATCAGG + Intergenic
1047437173 8:124844381-124844403 CTTCAGAATGTGATCATATTTGG + Intergenic
1048431352 8:134374498-134374520 CTTCTTAATGCCATCAACTTGGG - Intergenic
1049031407 8:140040756-140040778 CTTCTTGAGGTCATGATAATTGG - Intronic
1050014813 9:1222327-1222349 CTTCTTAATACCATCACATTGGG - Intergenic
1050172281 9:2834126-2834148 CTTTTTGAAGTCATCCCATTTGG + Exonic
1050330758 9:4543303-4543325 CTGTTGGATGTCATGATATTTGG - Intronic
1051063393 9:13072221-13072243 CTTATAGATTTCATCAAATTTGG - Intergenic
1052273490 9:26652226-26652248 CCTCCTGATATCATTATATTAGG - Intergenic
1055616848 9:78082074-78082096 CCTCTTAATATCATCATCTTGGG - Intergenic
1056878551 9:90364667-90364689 CTACTTTATGTCTTCAAATTTGG + Intergenic
1057987587 9:99732860-99732882 CTTCCTGTTTTCATCATATTTGG + Intergenic
1058141013 9:101356907-101356929 CCTCTTAATGTCATCACCTTGGG + Intergenic
1059294550 9:113258413-113258435 CTGCTTGATATCATTAAATTAGG - Intronic
1059564719 9:115372265-115372287 CCTCTTAATGCCACCATATTGGG + Intronic
1060251422 9:121989312-121989334 CTTCTTGATGTCAACGCCTTTGG + Exonic
1060500453 9:124149689-124149711 CCTCTTAATGCCATCACATTGGG + Intergenic
1061692974 9:132349442-132349464 CTTCTTGATGTCATCTTTTCTGG - Intronic
1061979846 9:134095827-134095849 CTTCTTAATGCCATCGTCTTGGG - Intergenic
1185497255 X:565068-565090 CTTCTTAACGTCATCATCTTGGG - Intergenic
1185721803 X:2388313-2388335 CTTCAGAATGTGATCATATTTGG + Intronic
1186109322 X:6239129-6239151 CTTCTTAATATTATCATATGGGG + Intergenic
1186726610 X:12365193-12365215 CTTCTTGATGCCAGGATGTTTGG + Intronic
1187207399 X:17196390-17196412 CCTCTTAATACCATCATATTAGG - Intergenic
1187221775 X:17334211-17334233 CTTCTTAATACCATCACATTGGG + Intergenic
1187831257 X:23383850-23383872 CTACTTGATATCAATATATTTGG - Intronic
1188258751 X:27996837-27996859 CTTCTTTATTTCATAAGATTGGG + Intergenic
1188699500 X:33240738-33240760 CTTCTTGATGTCATTCTAACAGG + Intronic
1188867673 X:35333647-35333669 CTTCTTGATGCTATCATAAATGG + Intergenic
1189206437 X:39243251-39243273 CTCCTTCAGGTCATCATATGGGG + Intergenic
1189276123 X:39787360-39787382 CTTCTTGGTGTCATCATATTTGG + Intergenic
1189490135 X:41464722-41464744 CTTCTTGTTTTAATCAAATTTGG + Intronic
1189941943 X:46133505-46133527 CATCTTCATGTCAACATATCTGG + Intergenic
1189973400 X:46439934-46439956 CTTCTTGATGTTGTCATATTTGG + Intergenic
1192252469 X:69423997-69424019 CCTTTTAATGTCATCATCTTGGG - Intergenic
1192272155 X:69591230-69591252 CCTCTTAATGTTATCACATTGGG - Intergenic
1193533013 X:82678992-82679014 CTTCTAAATATCATCACATTGGG - Intergenic
1194843168 X:98770253-98770275 CTTCACAATGTCATCTTATTTGG - Intergenic
1196609845 X:117699502-117699524 CTTCTTGATGAAATCTTAGTAGG - Intergenic
1197830465 X:130637105-130637127 CTTCTTGATGTAATATTATCTGG - Intronic
1197983160 X:132239485-132239507 TTTCTTGAGGTCCTCATAATTGG + Intergenic
1198381865 X:136091467-136091489 CCTTTTCATGTCATCATCTTGGG + Intergenic
1199706155 X:150427211-150427233 CTTCATAATGTGATCTTATTTGG - Intronic
1201929645 Y:19328314-19328336 CTTGTTGATGTTATCATATTTGG - Intergenic
1202067275 Y:20952981-20953003 CTTGCTGATGTGATAATATTGGG + Intergenic