ID: 1106388077

View in Genome Browser
Species Human (GRCh38)
Location 13:29307570-29307592
Sequence GTGTCAGAGGGCCCCCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 1, 2: 6, 3: 15, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106388069_1106388077 16 Left 1106388069 13:29307531-29307553 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG 0: 2
1: 1
2: 6
3: 15
4: 87
1106388070_1106388077 12 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG 0: 2
1: 1
2: 6
3: 15
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106388077 Original CRISPR GTGTCAGAGGGCCCCCTCAA GGG Intronic