ID: 1106388077

View in Genome Browser
Species Human (GRCh38)
Location 13:29307570-29307592
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 1, 2: 6, 3: 15, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106388070_1106388077 12 Left 1106388070 13:29307535-29307557 CCAAATATGATGACATCAAGAAG 0: 10
1: 16
2: 16
3: 43
4: 339
Right 1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG 0: 2
1: 1
2: 6
3: 15
4: 87
1106388069_1106388077 16 Left 1106388069 13:29307531-29307553 CCTGCCAAATATGATGACATCAA 0: 11
1: 12
2: 12
3: 18
4: 178
Right 1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG 0: 2
1: 1
2: 6
3: 15
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900600783 1:3501854-3501876 GTGGCAGGGGGCCCCCCCACAGG + Exonic
900994444 1:6112846-6112868 GGTCCAGAGGGCACCCTCAAGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
905184756 1:36188259-36188281 GTGCCCGTGGGCCCTCTCAAAGG + Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
909063882 1:70909494-70909516 GTCTCAGAAGGCCCCATAAAAGG + Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911170743 1:94768801-94768823 CTGCCAGAGGGGCCCCTGAAGGG + Intergenic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
911233210 1:95382345-95382367 GGGTCAGATGACCCCCTGAAGGG + Intergenic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
1065603570 10:27393496-27393518 GAGTCAGAGGGCCCCCTGTCTGG + Intergenic
1067090621 10:43264364-43264386 GTGTCAGAGGCCCTCCCCTATGG - Intronic
1067090632 10:43264407-43264429 GTATCAGAGGCCCTCCTCTATGG + Intronic
1067758991 10:49029104-49029126 TTGACAGAGGGTCTCCTCAATGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070447834 10:76525032-76525054 GTGTCTGAGGGCACATTCAATGG + Intronic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1076521880 10:131086422-131086444 GTGTCAGAAGGTGCCTTCAAGGG + Intergenic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094844191 12:34354269-34354291 GTGGCAGAGGTCCCCCCCATGGG - Intergenic
1094848519 12:34372040-34372062 GTGGCAGAGGTCCCCCGCCACGG - Intergenic
1094850865 12:34381780-34381802 GTGGCAGAGGTCCCCCCCAAGGG - Intergenic
1094851517 12:34384371-34384393 GAGGCAGAGGTCCCCCTCACGGG - Intergenic
1094852697 12:34389361-34389383 ATGGCAGAGGTCCCCCCCAACGG + Intergenic
1094854073 12:34395160-34395182 GAGTCAGAGGTCCCCCACCACGG + Intergenic
1094856442 12:34404992-34405014 GTGGCAGAGGTCCCCCACTATGG + Intergenic
1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG + Exonic
1096941910 12:55355882-55355904 GGGTCAGATTGCCTCCTCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1114055551 14:18964828-18964850 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1114106995 14:19436935-19436957 GTGTCCCAGGGCACCCTCAGTGG + Intergenic
1119084840 14:71730256-71730278 GTGTAAGAAGGCCTCCTCAACGG - Exonic
1119423504 14:74522007-74522029 GTGTCTGAGGGACCCCTGCAAGG - Exonic
1121100085 14:91244540-91244562 GTTTCAGAGTCCCCCCTCAGAGG - Intronic
1123054505 14:105562619-105562641 CTGTCAGAGGGGTCCCTCAGAGG - Intergenic
1123079091 14:105683038-105683060 CTGTCAGAGGGGTCCCTCAGAGG - Intergenic
1124632909 15:31347454-31347476 GCGTCAAAGGGCACCCTCAGGGG + Intronic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1127756687 15:62099300-62099322 GTGTCAGTGGGACTCCTCAGAGG - Intergenic
1132518098 16:375265-375287 GAGCCAGAGGGCCCCATCAGAGG + Intronic
1134249041 16:12561658-12561680 GTGTGTGAGGGCACCCTCAGAGG - Intronic
1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG + Intronic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG + Intronic
1155384999 18:25267431-25267453 GGGTCAGACTGCCTCCTCAAGGG + Intronic
1159604718 18:70463184-70463206 ATGTCTGAGGTCCCCCTAAACGG - Intergenic
1161370680 19:3909272-3909294 GTGTCAGCGGGCATCCTCATAGG - Intronic
1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
926119952 2:10236385-10236407 GTGGAAGACGGGCCCCTCAATGG - Intergenic
926620644 2:15043827-15043849 GAGTCAGAAGGCACCCTCCAAGG - Intergenic
927241235 2:20921023-20921045 GTGCCAGAAGGCTCCCTCGATGG - Intergenic
927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG + Intronic
927973664 2:27322091-27322113 ATGGCATAGGGCCCCCACAAAGG - Intronic
946963478 2:225010317-225010339 GTGTGGGAGGGCACCCCCAAAGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170410351 20:16082424-16082446 GTGTCAGAGGGCTGCCTCACTGG - Intergenic
1175193450 20:57226381-57226403 GGGTCAGAGGGCCCACACATGGG - Intronic
1179681606 21:43025417-43025439 GTGGCAGAGGGTCCCCTCATGGG - Intronic
1180190933 21:46162119-46162141 GTGGCCGAGGGCACCCTCGAGGG - Intronic
1180474028 22:15687380-15687402 GTGTCCCAGGGCACCCTCAGTGG - Intergenic
1182555382 22:31126008-31126030 TTGGGAGAGGGCCCCCTCACCGG - Exonic
1185362089 22:50414396-50414418 TTGTAAGAAAGCCCCCTCAAGGG - Intronic
952963547 3:38607615-38607637 GTCACAGAGGGCCACCTCAAAGG - Intronic
954408276 3:50357626-50357648 GTGTCAGCAGGCTCCCTCAGTGG + Intronic
954520286 3:51219078-51219100 GAGTCAGAGGGTCCTCTAAAAGG - Intronic
954622140 3:52002379-52002401 CTGTCACAAGGCCCCCTCCATGG - Intergenic
955069073 3:55557228-55557250 GTGGCAGATGGCCCCCCCAGTGG + Intronic
958172551 3:89956114-89956136 GTGTCATAAGGCCACCTCATGGG - Intergenic
963525423 3:146409471-146409493 TGGTCAGAAGGCCCCCTCCATGG - Intronic
965360715 3:167735200-167735222 CTGTCAGCCCGCCCCCTCAATGG - Intergenic
966826720 3:183971054-183971076 GTCTCAGAGGGCCTCCTATAGGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
975416954 4:74115549-74115571 CTGACAGAGCACCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977464553 4:97367546-97367568 ATGTCAGAGAGCCACCTGAAAGG + Intronic
986903771 5:12468470-12468492 GTGGCAGAGTGCACACTCAATGG - Intergenic
988984420 5:36602928-36602950 GTGTCAGCCGACCCCTTCAAGGG + Intergenic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
997727462 5:136133264-136133286 GGGTCAGGGGGTCCCCTCCAGGG - Intronic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009395038 6:63189845-63189867 ATGTGAGAGGGCCCCCACGATGG - Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1016560654 6:145392281-145392303 GTCTCCGATGGCCTCCTCAAAGG + Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1019414754 7:922134-922156 GTGTCAGTGCGGCCCCTCCAGGG - Intronic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG + Intergenic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1026598558 7:71754310-71754332 TTTTCAGACAGCCCCCTCAAAGG + Intergenic
1028538273 7:91913791-91913813 GAGTCAGAGGGCCTCCAAAAAGG + Intergenic
1030811321 7:113975630-113975652 GTCACTGAGGGCCCCCACAATGG - Intronic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1040329413 8:46378316-46378338 CTTTCAGAGGGCACCCACAAGGG + Intergenic
1044523513 8:93225911-93225933 GTGTCAGAGAGCCGTCTCAGAGG + Intergenic
1048026996 8:130596264-130596286 ATGGCAGAGGGCCCCCGCAATGG - Intergenic
1048279075 8:133091385-133091407 GTGTCAGAGGGTCCTCTGGATGG - Intronic
1057140206 9:92722199-92722221 GTCTCAGAGGGACCCCTGACAGG - Intronic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic