ID: 1106388499

View in Genome Browser
Species Human (GRCh38)
Location 13:29312044-29312066
Sequence CAGTGGGGTTGGAGGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 518}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106388499 Original CRISPR CAGTGGGGTTGGAGGGATGT GGG (reversed) Intronic
900125672 1:1068061-1068083 CAGTGGGGTTGGATGCAGGCAGG - Intergenic
900338285 1:2175532-2175554 GAGTGGGGTTGGGTGGATATTGG - Intronic
900402619 1:2478781-2478803 CTGTGGGGTAGGAGGGATCCAGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901804822 1:11731877-11731899 TGGTGGGGTTGGGGGGATGCGGG - Intergenic
901855040 1:12039146-12039168 CAGGGAGGGAGGAGGGATGTGGG + Intergenic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902699744 1:18163661-18163683 CAATGGGGTTGCAGGGAAGTTGG - Intronic
902788654 1:18749974-18749996 CAGTGGGGTGAGAGAGTTGTTGG + Intergenic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903969474 1:27109484-27109506 CAGTGGGCTTGGCGGGGTGGGGG - Intronic
904595413 1:31641538-31641560 CAGTGTAGTTGTAGTGATGTGGG - Intronic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
905029523 1:34872308-34872330 GAGTGGGTTTGGTGGAATGTGGG + Intronic
905441680 1:38000140-38000162 CAGCGGGGGTGGGGGGATGAGGG - Intronic
905939760 1:41853777-41853799 CAGTGGGGTTTGAGGCACTTGGG + Intronic
906036253 1:42751870-42751892 CAGTGGGGGTGTGGGGACGTGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907325901 1:53638532-53638554 CAGTGGGGTTGGGGGGCAGTGGG - Intronic
908267473 1:62393586-62393608 CAGAGGGGTTGGAGCAATGCAGG - Intergenic
908550697 1:65206150-65206172 CACTGGGGGTGGAGGGATAGGGG - Intronic
909421261 1:75468681-75468703 CAATGGGGTTTGGGGGATGTGGG + Intronic
910748963 1:90606816-90606838 CTGTGAGGTTGGAGGTATATAGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917934008 1:179846610-179846632 CAGTGGGGTTGGAAGCATTGAGG + Exonic
918081852 1:181213925-181213947 CAGTGGGGTTTGAGGCATCAAGG + Intergenic
918093277 1:181315371-181315393 CAGCGCGGGTGGAGGGATGGAGG + Intergenic
918691290 1:187483359-187483381 CAGTGGAGATGGAGGGGTTTGGG - Intergenic
919625807 1:199909109-199909131 CAGTGAGGTTGGAGGTCTGGAGG + Intergenic
919780589 1:201218393-201218415 CACAGCGGGTGGAGGGATGTAGG + Intronic
920003415 1:202814822-202814844 CCCTGGGGTTGAAGGGCTGTGGG - Intergenic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
921415630 1:214883501-214883523 CAATGAGGTTGGTGGGATCTTGG - Intergenic
922794943 1:228335301-228335323 GAGTGGGGGTGGGGGGATGGGGG + Intronic
924176179 1:241393539-241393561 AAGTTGGGTTGGATGGATGTAGG + Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
1062832729 10:616947-616969 CAGTGGGGATGGGGGGTGGTTGG - Intronic
1062873210 10:924691-924713 CACCGAGGTTGGAGGGATGGTGG - Intronic
1062885223 10:1011064-1011086 CAGTCAGGATGGAGGGATGCAGG - Intronic
1062885246 10:1011150-1011172 CAGTCAGGATGGAGGGATGCAGG - Intronic
1067563672 10:47321706-47321728 CAGCTGGGATGCAGGGATGTGGG + Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067761969 10:49055191-49055213 CAGGGGGCCTGGAAGGATGTTGG - Intronic
1067838487 10:49656685-49656707 CAGTGGGGCAGGGGAGATGTTGG + Intronic
1068538020 10:58262090-58262112 TCGTGGGGTTGGGGGGATGGGGG + Intronic
1068815198 10:61302002-61302024 CAGTGTGGTTGGAGAAATTTTGG - Intergenic
1069229933 10:65996459-65996481 CAGTGGGGTTCTAGGGATGTAGG + Intronic
1069285132 10:66704564-66704586 TAGTGGGGGTGGAGGAATCTGGG + Intronic
1070219588 10:74426607-74426629 GAGTGAGGTGGAAGGGATGTGGG + Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070757370 10:79001691-79001713 CAGTGGAGTGGGAAGGAAGTGGG + Intergenic
1071067263 10:81650741-81650763 TTGTGGGGTTAGAGAGATGTTGG - Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1072197699 10:93130722-93130744 CAGTGAGGTTGTTGGGCTGTGGG - Intergenic
1072341818 10:94459587-94459609 CAGGGGGGTTGGGGGGAGCTCGG + Intronic
1073170580 10:101504525-101504547 CAGTGGGGTTGGTGAGAGATGGG - Intronic
1073895270 10:108148977-108148999 TTGTGGGGTTGAATGGATGTAGG + Intergenic
1074270908 10:111952612-111952634 CACTGGGGTGGGAGGGCTGGTGG - Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075864596 10:125706768-125706790 GAGTGGGGTTGGGGGGATCGAGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076726072 10:132413900-132413922 CAGTGGGGTGGGAGAGAGGTAGG + Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078936084 11:15951324-15951346 CAGTGGGGTTGGAATTATGGTGG + Intergenic
1079949339 11:26782934-26782956 CAATGGGGTGGGAGGGATGAAGG - Intergenic
1080750447 11:35145709-35145731 CATGGGGGTTGGAGGAGTGTGGG - Intronic
1081040582 11:38205499-38205521 CAGAGTGGTTGAATGGATGTGGG + Intergenic
1081604179 11:44517064-44517086 CAGTGGAGTGGGAGTGATGGGGG + Intergenic
1081732856 11:45383863-45383885 GAGTGGGGTTGGAGGGGGCTAGG - Intergenic
1081806768 11:45895141-45895163 AAGTGGGGCGGGAGGGATGATGG + Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083026078 11:59552152-59552174 CACTGGGGTTGTGGTGATGTAGG + Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083136867 11:60687211-60687233 CCCTGTGGTTGAAGGGATGTAGG + Intergenic
1083250079 11:61460747-61460769 CAGTGGGGGTGGATGGATCTTGG - Intronic
1084006556 11:66326403-66326425 CAGTGGGGGTGGAGGGGTGGAGG + Intergenic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085774203 11:79350959-79350981 CAGTGAGGTCTGAGGGAGGTAGG - Intronic
1086206187 11:84260818-84260840 CAGTGGGGTTTGAGGCATTATGG - Intronic
1086568893 11:88260427-88260449 CAGTGTGTTTGGTAGGATGTTGG + Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087513027 11:99122128-99122150 AAGTGGAGTTGGGGGGAGGTTGG - Intronic
1088090493 11:106033165-106033187 AAGAGGGGTTGAAGGGAGGTAGG + Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088724596 11:112622914-112622936 CAGTGGGGTTGGAAATATCTTGG - Intergenic
1089311438 11:117560788-117560810 CAGTGGGGGAGAAGGGGTGTGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090718885 11:129454755-129454777 GAGGGAGGTTGGAGAGATGTTGG - Intergenic
1091251158 11:134145450-134145472 CAGTGGTGGTGGTGGGAGGTGGG + Intronic
1091300480 11:134504065-134504087 GAGTGGGCTTGGAGGGATGCTGG + Intergenic
1091669788 12:2444817-2444839 TAGTGGGATTGGTGAGATGTAGG - Intronic
1091964724 12:4729407-4729429 AAGAGGGGTTAGAGAGATGTTGG - Intronic
1092138675 12:6167680-6167702 CACTGGGGATGGGTGGATGTGGG - Intergenic
1092999173 12:13979689-13979711 CAGTGGGGGTGGATGTATGCAGG - Intronic
1093887684 12:24481273-24481295 GTGGGGGGTTGGAAGGATGTAGG + Intergenic
1095907356 12:47391776-47391798 CAGTGACGTTCAAGGGATGTGGG + Intergenic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097190612 12:57217673-57217695 GAGTGGGGTTGGAGGCAGGGAGG - Intronic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097731202 12:63130559-63130581 AAGTGGGGTAGGAGGTATTTTGG + Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1098556113 12:71820885-71820907 GGGTGGGGTTGGAGAGATATTGG - Intergenic
1099693789 12:85993530-85993552 CAGTGGGGCTGGAGGGGCCTTGG + Intronic
1099940875 12:89186873-89186895 GAATGGGGATGGAGGCATGTTGG - Intergenic
1100141060 12:91619384-91619406 AAGTAGGGTTGGAGGGTTGTGGG + Intergenic
1100946881 12:99794710-99794732 CACAGGGGTTAGAGGGAGGTGGG + Intronic
1101212326 12:102546878-102546900 CTGAGGGGTTCCAGGGATGTGGG + Intergenic
1101347922 12:103903645-103903667 CAGTGGAGGTGGAGGGTTTTGGG - Intergenic
1101662140 12:106775003-106775025 CAGTGGGGGTAGTGGGATGCAGG - Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1102880723 12:116482622-116482644 GAGTGGGGGTGAAGGGATGGGGG - Intergenic
1103980830 12:124736129-124736151 CAGTGGGGTGGGAAGCATTTGGG - Intergenic
1104143315 12:126008828-126008850 CAGTGAGCTTGGAGGTTTGTTGG + Intergenic
1104534544 12:129606591-129606613 TATTGGGGTTGGAGTGATGGAGG - Intronic
1104546069 12:129714057-129714079 CAGTGTGGTTGGAGGGAGGTAGG - Intronic
1104576924 12:129974438-129974460 CATTCTGGTTGGAGGGATGGAGG - Intergenic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105829148 13:24148987-24149009 GACTGGGCTTGGAGGAATGTAGG + Intronic
1106346666 13:28886130-28886152 GAGTGAGGTCAGAGGGATGTAGG + Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1108007225 13:45961540-45961562 TAGTGGGGGTGGGGAGATGTGGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1111266988 13:85829143-85829165 CAGTGAGGCTGGGGAGATGTTGG + Intergenic
1112130081 13:96513960-96513982 CAGTGTGGTTGTAGCGTTGTGGG + Intronic
1112904705 13:104402539-104402561 GAGGGGGGTTGAAGAGATGTTGG + Intergenic
1114756845 14:25269360-25269382 CTGTGGGGATGGAGGGATTGTGG + Intergenic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1115555280 14:34540366-34540388 AGGCGAGGTTGGAGGGATGTGGG - Intergenic
1115658638 14:35468093-35468115 CAGTGGGGGTGGGGGGGAGTGGG + Intergenic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116043456 14:39714318-39714340 CCATGGGGATAGAGGGATGTGGG + Intergenic
1116216694 14:42025582-42025604 AACAGGGGTTGGAGGGATGCAGG - Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1116629107 14:47306376-47306398 CATTGGGGGTGGAGGGTTGTTGG + Intronic
1117108384 14:52422255-52422277 AATTGGAGTTGGAGGGAAGTGGG + Intergenic
1117232384 14:53733966-53733988 CAGGGGTGTTGGTAGGATGTTGG + Intergenic
1117252045 14:53947938-53947960 CTGGGGGGTTGGAGGGGTGGGGG + Intergenic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118476313 14:66120710-66120732 CAGAGGGGTGGGTGGGATGGGGG + Intergenic
1118687535 14:68306046-68306068 CAGAGGGGAGGGACGGATGTGGG - Intronic
1119691329 14:76675003-76675025 CAGTGGGGTAGAAGAGATGGTGG + Intergenic
1119974597 14:79011385-79011407 GGGTGGGGTTGGGGGGAGGTGGG - Intronic
1121453257 14:94022862-94022884 CAGTGGGATTGGGGGGATTAGGG - Intergenic
1122438204 14:101713002-101713024 CAGTGGGTTGGGAGAGATGACGG - Intergenic
1122650342 14:103222548-103222570 AGGTGGGGCAGGAGGGATGTGGG + Intergenic
1122984616 14:105206434-105206456 CAGTTGGGGTGCAGGGGTGTGGG + Intergenic
1122984675 14:105206650-105206672 CAGTTGGGGTGCAGGGGTGTGGG + Intergenic
1123509361 15:20981081-20981103 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123566583 15:21554821-21554843 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123602844 15:21992114-21992136 CAGTGGGGATGGGGAGATATTGG - Intergenic
1123627329 15:22236769-22236791 CAATGGTGTTGGAAGGATGAAGG + Intergenic
1124655456 15:31503375-31503397 CAGGGCTGTTGGAGGGGTGTGGG + Intronic
1124720860 15:32109855-32109877 CAGTGGGGTGTGCGGGGTGTGGG + Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1124957044 15:34366706-34366728 CCCTGGGGTTGGAGAGATGAAGG - Intronic
1125537896 15:40453080-40453102 CTGTCGGGTTGGAAGGATGGGGG + Intronic
1125756643 15:42069714-42069736 CAGAGGGCCTGCAGGGATGTGGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127165615 15:56243291-56243313 CAGAGGGGTGGGAGGGAGGGAGG + Intergenic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1129246403 15:74281647-74281669 CAGGAGGGTGGGAGGGAGGTGGG - Intronic
1129265709 15:74392103-74392125 CAGTGGCCTCGGTGGGATGTTGG - Intergenic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129532314 15:76278299-76278321 CAGTGGGGTCAGAGGAATGTTGG - Intronic
1129551198 15:76451381-76451403 GAGTGGGATTGCTGGGATGTAGG + Intronic
1129714612 15:77839866-77839888 TAGTGGGGTTGGAGAGAAATGGG - Intergenic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1129953146 15:79609654-79609676 CAGTGGCGTTTGAGGCATGCAGG - Intergenic
1130274440 15:82469180-82469202 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130466787 15:84196554-84196576 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130497477 15:84476982-84477004 CAGTGGGGTTGGAGCCCTGGTGG - Intergenic
1130589082 15:85201147-85201169 CAGTGGGGTTGGAGCCCTGGTGG + Intergenic
1130854276 15:87827111-87827133 CAGTGGGGTTGGATGGGAATTGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131647611 15:94362055-94362077 CACTGGGGTTGGTGAGATGAAGG + Intronic
1132008437 15:98252559-98252581 CAGTGGGCTTGGAGGTGTGAAGG - Intergenic
1132193536 15:99891205-99891227 CAGTGGATTTGTAGGGATGAAGG - Intergenic
1202974944 15_KI270727v1_random:281916-281938 CAGTGGGGATGGGGAGATATTGG - Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133169531 16:3972784-3972806 CGGTGGGGTTGGAGGGCTTCTGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134849427 16:17468844-17468866 AGGTGGGGTGGGAGGGTTGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135839200 16:25859023-25859045 GTGTGGGGTGGGAGGGATGTTGG - Intronic
1136272963 16:29159238-29159260 CAGTGGGGTGGGGGGGTGGTGGG + Intergenic
1136409719 16:30069232-30069254 CAGTGGCTGTGGAGAGATGTAGG + Intronic
1136518912 16:30784088-30784110 CAGTGGGGTTGGGGGGTTCTGGG + Exonic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137849045 16:51720360-51720382 CACTGGGGTTTCAGGGAAGTGGG + Intergenic
1137914269 16:52411835-52411857 CAGTTGGGTTTGAGGGATTCTGG - Intergenic
1138008372 16:53357374-53357396 CAGTGGGACTTGAGAGATGTGGG + Intergenic
1138198761 16:55073696-55073718 CAGTGGGGGGGGGGGGGTGTAGG + Intergenic
1138339805 16:56281349-56281371 GAGTGGGGTGGGACAGATGTGGG - Intronic
1138761403 16:59548822-59548844 TAGTGAGGTTGGAGGTAGGTGGG + Intergenic
1139361493 16:66402575-66402597 CAGTGGGGATGGGGGCATGGGGG + Intronic
1139689563 16:68631578-68631600 CAGGGGGGCTGGAGGGTTGGTGG + Intergenic
1141265562 16:82493861-82493883 AAGAGGGGTTGGAGGGTTGCAGG - Intergenic
1141976626 16:87520609-87520631 CAATCGTGTTGGAGGGATGAAGG - Intergenic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142679179 17:1535535-1535557 AATTGGGGTTGGAGGGGAGTGGG + Intronic
1143645759 17:8228954-8228976 CAGCGGGGAGGGAGGCATGTTGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144086403 17:11812885-11812907 CTTTGGGGTAGGAGGGAAGTTGG - Intronic
1145916328 17:28576166-28576188 CAGTGGGGCTGCAGTGATGTAGG + Intronic
1146056283 17:29582900-29582922 GAGTGGGGCTGGAGGGGTGGTGG - Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1147286564 17:39407192-39407214 GAGGGGGGTGGGAGGGGTGTAGG - Exonic
1147626892 17:41906377-41906399 CAGAGGGCTTCGAGGGATGTTGG - Intronic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1148105069 17:45114626-45114648 CAGTGGAGCTGGAGGGCCGTGGG - Intronic
1148251318 17:46083578-46083600 TAGTGGGGTTGGCGGGGTGGGGG - Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148741020 17:49892657-49892679 CAGAAGGCTTGGTGGGATGTGGG + Intergenic
1148837335 17:50472320-50472342 CAGTTGGGTTGGGGGGTTGGGGG + Intronic
1149272182 17:54991934-54991956 CAGTGGTGGGGGAGGGATATGGG - Intronic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149663072 17:58346054-58346076 AGGTGGGGTGGGAGGGATTTGGG - Exonic
1150895514 17:69205776-69205798 CAGTGGGGCTGGGGGAATATTGG + Intronic
1151885800 17:76922759-76922781 CAGGAAGGTTGGAGGGATGGAGG + Intronic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152175045 17:78782003-78782025 CAGGGGGTTTTGAGGGATGAGGG - Intronic
1153167084 18:2274250-2274272 CAGTGGCATTGGATGGATGGGGG + Intergenic
1153966807 18:10189926-10189948 CAGTGGGCTTGGAGGCCTGATGG + Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1158130662 18:54149181-54149203 CACTGGGGGTGGAGGGCTGGGGG - Intergenic
1158308786 18:56136935-56136957 GAATGGGTTTGGTGGGATGTTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158824751 18:61204489-61204511 CAGATGGGTAGGTGGGATGTGGG - Intergenic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1160969724 19:1762240-1762262 CAGGAGGGTTGGAGGGCTGGCGG - Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161569511 19:5022827-5022849 GGGGGGGCTTGGAGGGATGTGGG + Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163099045 19:15082423-15082445 GGGTGGGGGTGGAGGGTTGTGGG + Intergenic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1163842211 19:19618447-19618469 CAGTGAGGTTGGCGGGCTGAGGG - Intronic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1165782373 19:38441934-38441956 CTTTGGGGTTGGAGGGATGTGGG + Intronic
1166960040 19:46491802-46491824 CAGTGGGGCAGGCGGGGTGTGGG - Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167513594 19:49909954-49909976 CAGTCGGTTTGGAGGGTGGTGGG + Intronic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167685330 19:50952552-50952574 CTCTGGGGTGGGAGGGTTGTGGG - Intronic
1167918144 19:52759227-52759249 CAGTGAGGTTGGAAGGAGGGTGG + Intergenic
1168072849 19:53962380-53962402 GAGTGGGGTTAGTGGGATGGTGG + Intergenic
1168072868 19:53962485-53962507 GAGTGGGGTTAGTGGGATGGTGG + Intergenic
1168072887 19:53962590-53962612 GAGTGGGGTTAGTGGGATGGTGG + Intergenic
1168072906 19:53962695-53962717 GAGTGGGGTTAGTGGGATGGTGG + Intergenic
1168316506 19:55486854-55486876 CTGGGGGGTGGGAGGGATGCTGG + Exonic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925445539 2:3923862-3923884 TGGTGGGGGTGGAGGGATCTGGG + Intergenic
926314711 2:11700839-11700861 CTGGGGAGGTGGAGGGATGTGGG - Intronic
927400285 2:22703403-22703425 CAGTGGGGGTCTAGGGATGTAGG - Intergenic
927622873 2:24680576-24680598 TGGGGGGATTGGAGGGATGTTGG + Intronic
928083307 2:28328702-28328724 CACTGGGGTTGGAGTGACATTGG + Intronic
928599688 2:32892032-32892054 GAGTGGGGGTGGGGAGATGTTGG + Intergenic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929257114 2:39824259-39824281 GATTGGGATTGGAGAGATGTTGG - Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
932220688 2:69996770-69996792 CATGGGGGCTGCAGGGATGTCGG + Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932706778 2:74032159-74032181 CAGTGGGTTTTGAGGGATTGGGG + Intronic
932840075 2:75073652-75073674 CAGTGGGTCTGGGGGGAGGTGGG + Intronic
933769226 2:85732709-85732731 CAGTGGGGTGGCAGGGCTGCTGG + Intergenic
933775763 2:85770329-85770351 GAGTGGGGTTGAGGGGAGGTTGG + Intronic
934705436 2:96474680-96474702 TGTTGGGGTTGTAGGGATGTAGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935221381 2:101016921-101016943 GTGTGGGGTTGGGGGGATGGGGG + Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936812006 2:116413636-116413658 CAGGGAGGTTGCAGGGAGGTTGG - Intergenic
937246804 2:120498985-120499007 CCATGGGGTTGGAGGGGTGAAGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937724288 2:125143126-125143148 CAGTGGGGTAGAAAGGATGGAGG + Intergenic
938716477 2:134026890-134026912 CACTGGGGGTTGAGGGCTGTGGG - Intergenic
939356911 2:141114425-141114447 CAGTGGGGTGGAAGGGAAGCTGG + Intronic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
940962075 2:159797696-159797718 GAGTGGGGTTGCTGGGATGGGGG - Intronic
942271632 2:174281497-174281519 GAGTGAAGTTGGAGGAATGTGGG + Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
943046460 2:182867000-182867022 CAGAGGGGTTGGGGGGAAGGAGG + Exonic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
945162462 2:206906471-206906493 CGGGTGGGTCGGAGGGATGTAGG + Intergenic
946180671 2:217947158-217947180 CATTGGGGTGGGAGGGAGGGAGG - Intronic
946188813 2:217996459-217996481 AAGTGGGGTTGGAGGAAGCTGGG - Intronic
946385917 2:219384470-219384492 GAGTGGGGGTGGAGGGTTGAAGG - Intronic
948153673 2:235764771-235764793 CCGTGGGGTTGGGGGCATCTGGG + Intronic
948153683 2:235764799-235764821 CCGTGGGGTTGGGGGCATCTGGG + Intronic
948153703 2:235764854-235764876 CCGTGGGGTTGGGGGCATCTGGG + Intronic
948153723 2:235764909-235764931 CCGTGGGGTTGGGGGCATCTGGG + Intronic
948153733 2:235764937-235764959 CCGTGGGGTTGGGGGCATCTGGG + Intronic
948153753 2:235764992-235765014 CCGTGGGGTTGGGGGTATCTGGG + Intronic
948153781 2:235765074-235765096 CCGTGGGGTTGGGGGTATCTGGG + Intronic
948153809 2:235765156-235765178 CCGTGGGGTTGGGGGTATCTGGG + Intronic
948153827 2:235765211-235765233 CCGTGGGGTTGGGGGTATCTGGG + Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948547970 2:238746073-238746095 CAGTGGGCTTGGAGGATGGTGGG - Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
948760477 2:240187238-240187260 AAGTGGGGTGGGAGGGAGGAAGG + Intergenic
948781451 2:240324221-240324243 CACTGCTGTTTGAGGGATGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169723163 20:8700876-8700898 CAGTGGGTGAGGATGGATGTGGG + Intronic
1170249253 20:14262142-14262164 CAGAGGGGTTGAAGGAATGGAGG + Intronic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1170783836 20:19450444-19450466 GAGGGAGGTTGGAGGGGTGTGGG + Intronic
1171816777 20:29792725-29792747 CAGTGAGGATGGATGGATTTTGG - Intergenic
1172993006 20:39049877-39049899 GAGTAGGGTAGGAGGAATGTTGG + Intergenic
1173800917 20:45893893-45893915 CAGGGAGGTTGGTGGGAGGTGGG + Intronic
1173861684 20:46287917-46287939 CAGTGAGGTTGGAGAGGAGTGGG + Intronic
1173964055 20:47098551-47098573 CAGTTTGGTTTGAGGAATGTTGG - Intronic
1174406002 20:50303844-50303866 CAATTGGGTTGGAGGCATGGCGG + Intergenic
1174888993 20:54369290-54369312 CTGTGGGATTGGATGGATCTCGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175905745 20:62378537-62378559 CAGTGGGAATGGCGGGATTTCGG - Intergenic
1176316733 21:5252954-5252976 TTGTGGGGTTGGGGGGATGGGGG - Intergenic
1176727214 21:10448062-10448084 TGGTGGGGTTGGTGGTATGTGGG + Intergenic
1178354620 21:31900234-31900256 CAGTGGGGCTGGAAGGAGCTAGG - Intronic
1179252752 21:39686759-39686781 CAGTGAGATTGGTGAGATGTAGG + Intergenic
1179907012 21:44427673-44427695 CTGGGGGGTTGCCGGGATGTGGG + Intronic
1180148511 21:45935411-45935433 CAGTGGGGTTGGGGTGGTGAAGG - Intronic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181082055 22:20422705-20422727 CAATGGAGTGGGAGGAATGTGGG - Intergenic
1181101133 22:20540078-20540100 CAGTGGAAGTGGAGGGATGCAGG + Intronic
1182201351 22:28573832-28573854 TAGTGGGGGTGGGGGGAAGTGGG - Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182741329 22:32570144-32570166 CAGTGTGTGTGGAGGGAGGTTGG - Intronic
1182989182 22:34750714-34750736 CAGCAGGGTTGGAGGAAAGTGGG + Intergenic
1183083383 22:35471613-35471635 CAGTGGGGGTGGGGGTGTGTGGG - Intergenic
1183101389 22:35586211-35586233 CTATGGGGTTGGAGGGATTAAGG - Intergenic
1183338071 22:37262321-37262343 GAATGGGGTTGGTGGGAAGTGGG - Intergenic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184115441 22:42419209-42419231 CTGTTGAGTTGGAGGGATGGGGG - Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185323950 22:50216540-50216562 CAGTGGGGTTCCAGGGACCTCGG + Intronic
949325516 3:2859043-2859065 CAGGGAGGTTGGAGGAATGTTGG - Intronic
950119772 3:10474097-10474119 CAGTGGTGTTGGAGAGGTGTGGG + Intronic
950631603 3:14285680-14285702 CAGTGGGGGTGGGGGGATTGAGG - Intergenic
951565601 3:24009867-24009889 TAGGGGGATTGGGGGGATGTTGG - Intergenic
951621878 3:24610920-24610942 CAGTGGGGTTGTAGGATTATAGG + Intergenic
952478875 3:33739249-33739271 GGGCTGGGTTGGAGGGATGTGGG + Intergenic
952777707 3:37061935-37061957 CAGTGTGGTTGAAGGGTTGTTGG - Intronic
953018768 3:39100719-39100741 TCGTGGGGTTGGAGGGCTGCAGG - Intronic
953304563 3:41815647-41815669 CAGTGGGGTAGCAGGGAGATGGG + Intronic
953922416 3:46961174-46961196 GAGGTGGGTTGGAGGTATGTGGG + Intronic
954569144 3:51626060-51626082 CGGCGGGGTTGGAGGGCTGGTGG - Intronic
954763800 3:52896900-52896922 CACTGGGGATTGAGGGATGTGGG + Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
958847125 3:99278405-99278427 CAGTGGACTTGGGGGGATGGGGG + Intergenic
959905158 3:111703201-111703223 AAAGGGGGTTGGAGGGATGCAGG + Intronic
959917501 3:111832453-111832475 GAATGGGGATGGAAGGATGTGGG - Intronic
959979382 3:112498194-112498216 CAGTTGGGTAGGACAGATGTTGG + Intronic
960529100 3:118743298-118743320 CAGTGGGGGTGAAGGGATAGTGG - Intergenic
960944878 3:122958944-122958966 CATTGCAGCTGGAGGGATGTGGG - Intronic
961208313 3:125105214-125105236 GAGGGGGGATGGAGGGATGGGGG + Intronic
961961040 3:130855394-130855416 CCGTGGGGTTGGAGGGTTCACGG + Intronic
962436544 3:135372220-135372242 CTGTGGGGTATGATGGATGTGGG - Intergenic
962958512 3:140288665-140288687 CAGTGGTGTTGGTGGGAAGCAGG - Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964751577 3:160058688-160058710 GAGTGGGGTTGGTGGGGAGTGGG + Intergenic
965614224 3:170576706-170576728 CAGTGGGGGTGGAGTGCTATTGG + Intronic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966026294 3:175286973-175286995 TGGTGGGGGTGGAGGGGTGTGGG + Intronic
967950505 3:194836760-194836782 CAGAGCGGTTGGAGGGATATAGG + Intergenic
968458993 4:714446-714468 CAGTGGGGTTGTAGCGGTGTGGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969658022 4:8509217-8509239 GAGTGGGGTGGGAGGGAGGGAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971418930 4:26457871-26457893 CAGTTGGGTTGAGGGGATGAGGG + Intergenic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
972801826 4:42483803-42483825 CAGTTTGGTTGGAAAGATGTGGG - Intronic
973298345 4:48552160-48552182 CAGTGGGGTAAGAAGGATGTTGG - Intronic
974351697 4:60755843-60755865 CAGTGGGGGAGGAAGGAGGTGGG + Intergenic
974928319 4:68329244-68329266 CTATGGGGTTGCAGGGTTGTGGG - Intronic
975068021 4:70094237-70094259 CATTGGGGAGGGAGGGATATGGG - Intergenic
975302718 4:72809622-72809644 GAGTGAGGTGGGAGGGAAGTGGG + Intergenic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
978417972 4:108498699-108498721 AAGTGGGTTTGGGGAGATGTTGG + Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978833013 4:113112402-113112424 GAGTGGGGTTGGGAGGATGCAGG + Intronic
979615087 4:122733206-122733228 CAGTGTCGTTGGAGGGACGTGGG + Intronic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
981334198 4:143550573-143550595 CAGTGGGGGTGGGGGAAAGTGGG - Intronic
981657126 4:147124576-147124598 CAGAGAGGTAGGAGGGATGAGGG - Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981729753 4:147885013-147885035 CAGTGGGGGTGGAGCCAAGTGGG + Intronic
983086560 4:163452401-163452423 AAGTGGGTTTGCAGGGATGCAGG + Intergenic
983153939 4:164320803-164320825 GAGTGGGGCTGGGGGGTTGTAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985849121 5:2375574-2375596 CAGTGGGGTTGGGGTGTTCTGGG + Intergenic
987612766 5:20228606-20228628 GAGAGGGGTTGGTGAGATGTTGG - Intronic
988137170 5:27188827-27188849 CAGTGGGGCAAGAGAGATGTGGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
989601289 5:43203085-43203107 CGGTGGGGCTGGGGGGATGGTGG - Intronic
990864751 5:60368407-60368429 CAGGGAGGTTGGCAGGATGTGGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991422607 5:66456370-66456392 GAGTGGGGTTGGGGGGTAGTGGG - Intergenic
991683649 5:69162366-69162388 CAGTGGGGTTGGAGGGCTGAAGG + Intergenic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
994145391 5:96389085-96389107 CAGTGGGGTGGGAGAGGTGGGGG + Intergenic
994881967 5:105509581-105509603 CAGTGGGGTAGGAGGAAGTTAGG + Intergenic
995019309 5:107349038-107349060 TAGTGGGGTTAGGGGGAAGTGGG - Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996906028 5:128601403-128601425 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
996906040 5:128601432-128601454 GAGTGGGGCTGGGGGGAAGTGGG - Intronic
997530805 5:134580069-134580091 CAGTGCAGGTGGAGGGCTGTAGG + Exonic
997887797 5:137647278-137647300 CTGTGGGATTGAAGGCATGTTGG + Intronic
1001332866 5:170774360-170774382 TAGTGGGGTTGGGGGGATGTAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002064755 5:176646515-176646537 AAGTGGAGGTGGAGGGATGCTGG + Exonic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003563251 6:7201508-7201530 CAGTGGGGAGGGTGGGATGGGGG - Intronic
1003860660 6:10319358-10319380 CCATGGGGATAGAGGGATGTGGG + Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860690 6:10319449-10319471 CGGTGGGGATGGCGGGACGTGGG + Intergenic
1003860699 6:10319479-10319501 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860708 6:10319509-10319531 CCGTGGGGATGGCGGGACGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1006751594 6:36381268-36381290 CTGTGGGGTCTGAGGGATGCCGG + Intronic
1007115980 6:39343622-39343644 CAGTGAGGTGGGAGGGGAGTAGG - Intronic
1007581704 6:42963811-42963833 CAGCTGGGGTGCAGGGATGTGGG + Exonic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009245382 6:61231208-61231230 GACTGGGGCGGGAGGGATGTGGG + Intergenic
1010766377 6:79780742-79780764 GAGTTGAGTTGGAGGGATCTGGG + Intergenic
1011547101 6:88493572-88493594 CATTGGGGAGGGAGGGGTGTTGG - Intergenic
1011704349 6:89985952-89985974 GTGTGGGGCTGGAGGGATGCGGG + Intronic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1012990691 6:105922777-105922799 CCATGGGATTGGAGTGATGTGGG + Intergenic
1013526887 6:110982325-110982347 CCGTGGGATGGGAGGGATGTGGG + Intronic
1014265334 6:119270515-119270537 AAGAGGGGTTGGAGGGAAATGGG - Intronic
1014390732 6:120859524-120859546 GGGTGGTGTTGGGGGGATGTTGG - Intergenic
1014779403 6:125546337-125546359 CATTTGAGTTGGAGGCATGTAGG - Intergenic
1015569305 6:134604777-134604799 CTGTGGAGTTGGATGGATGGGGG - Intergenic
1015828722 6:137344659-137344681 CAGTGGGGTTGGGGGTATGTTGG + Intergenic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1017523265 6:155220534-155220556 CAGTGAGGTTGGAAGGATGCAGG + Intronic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017859696 6:158384047-158384069 CAGTCAGGTTGGTGGGATGGGGG + Intronic
1018857239 6:167683475-167683497 CACAGGGGATGGAGGGATGGGGG + Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1019049135 6:169169966-169169988 CTGTGGGGTAGGAGGGGTGGGGG - Intergenic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019285791 7:222306-222328 CAGTGAGGATGGAGGGACTTGGG + Intronic
1019797484 7:3062500-3062522 CAGCTGAGTTGGGGGGATGTTGG + Intergenic
1020010628 7:4804004-4804026 CAGTGGGGCTGGAGGGTTCCTGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020650953 7:10875658-10875680 AGGTGGGGTTGGGGAGATGTTGG - Intergenic
1022153661 7:27637037-27637059 CAGTGGTGTTTGGGGTATGTTGG + Intronic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1022854347 7:34300688-34300710 AAGTGGGATTGGGGCGATGTGGG + Intergenic
1023932087 7:44712253-44712275 CAGAGGTGTTGGAGGGAAATGGG + Intergenic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1028057150 7:86260070-86260092 AAGGTGGGTTGGAGAGATGTTGG + Intergenic
1028948122 7:96603734-96603756 AGGTGGGGTTGGAGGGAGGGAGG - Intronic
1029491087 7:100870475-100870497 CTGTGGGGTGGGTGGGACGTGGG + Intronic
1030054588 7:105572194-105572216 CAGGGGGATTGGGGAGATGTTGG - Intronic
1032058875 7:128706892-128706914 CAATGGGGTTGGAAGGCTGCAGG + Intergenic
1032089513 7:128904233-128904255 CCTTGGGGTTGAAGGGATGGCGG + Intronic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032338461 7:131048498-131048520 CAGAGGGGTGGGAGGGATCGGGG - Intergenic
1032488625 7:132307142-132307164 GTGTGGGGTTGTAGGGATATTGG - Intronic
1032626310 7:133595078-133595100 CAGTGTGGATGGAGGAGTGTAGG + Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034749784 7:153557963-153557985 GTCTGGGGTTGGAGGGATATGGG - Intergenic
1035180032 7:157082625-157082647 CAGTGTGATTGAAGGGATGCAGG + Intergenic
1035437064 7:158867196-158867218 TTGTGGGGTTGTAGGGTTGTGGG + Intronic
1036496848 8:9277505-9277527 TAGTGGGGTTGGAGGCAGGGAGG + Intergenic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1038069087 8:23993373-23993395 CAGTGGGTTTGGAAGGCTGCAGG - Intergenic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038727416 8:30094215-30094237 GACTGGGGATGGAGGGATGGAGG + Intergenic
1039609098 8:38904766-38904788 CACTGGAGTTAGAGGGATGGAGG + Intronic
1040067886 8:43163111-43163133 CAGTGAGGTGGGAGGGAGGTTGG + Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1041347048 8:56910194-56910216 GAGAGGGGTTGGGGGGATGGGGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1042120620 8:65484068-65484090 CAGTTGGATGGGAGGGATGGAGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1042927824 8:73984464-73984486 CTCTGGGGTTGCAGGGATGCGGG - Intergenic
1043007541 8:74838555-74838577 GAGAGGGGTGGGAGGGAGGTGGG - Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1045301403 8:100913827-100913849 CACTGGGGTTGCAGTGAGGTGGG + Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045365461 8:101471610-101471632 CAGTGAGGTGGGGGGGTTGTGGG + Intergenic
1045464339 8:102455718-102455740 CTGTGTGATTGGAGAGATGTTGG + Intergenic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1046332063 8:112730681-112730703 CAGTCAGGTTGAAGGGGTGTTGG - Intronic
1047693149 8:127377079-127377101 TAGTGAGGTTGGACGGGTGTGGG + Intergenic
1047927260 8:129693760-129693782 GAGTGGGGTTGGGGGAATGGGGG - Intergenic
1048107861 8:131430967-131430989 CAGTGAGGTTGGAGGGTGGGAGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048505837 8:135020519-135020541 CAGGAGTGTTGGAGGGAAGTGGG - Intergenic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049140364 8:140949333-140949355 CAGTGGGGCTGGCAGGAGGTGGG + Intronic
1049310521 8:141931484-141931506 CAGTGGGGGTGGAGGTGTGTTGG + Intergenic
1049710931 8:144063002-144063024 CAGTGGGGTAGGAGGCAGGTGGG - Intronic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050948579 9:11558806-11558828 CTGTGGAGTTGAAGGGATTTGGG + Intergenic
1051088286 9:13377513-13377535 CAGTTGGGTTGGGGGGAGGAAGG + Intergenic
1051917976 9:22230356-22230378 CAGTGGGGAGGGATGGATGCAGG - Intergenic
1052865381 9:33461882-33461904 CAGTGGGGTTGCAGAGATGGGGG - Exonic
1053463904 9:38291016-38291038 GAGTGGAATTGGAGTGATGTGGG + Intergenic
1055661952 9:78512703-78512725 CAGTGGGTATGGATGGGTGTGGG - Intergenic
1055903376 9:81266108-81266130 CAGTTGGGTTGGATGGTGGTTGG - Intergenic
1056526541 9:87447833-87447855 CAGGGAGGTTGGAGGAATGCAGG - Intergenic
1056914069 9:90729778-90729800 CAGCGGGGTTGGGGGGTTGAGGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057786460 9:98091853-98091875 CGGTGGAGATGGTGGGATGTTGG - Intronic
1057802111 9:98196999-98197021 GCCTGGGGTTGGGGGGATGTGGG + Intergenic
1058638882 9:107064027-107064049 AAGTGGGGGTGGAGGGGTGGTGG - Intergenic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059671178 9:116493784-116493806 CAGTGGGAGTGGGGGGATGTGGG + Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060702671 9:125772000-125772022 CAGTGGGGTGGGAGGTAGGTAGG + Intronic
1060864866 9:126987701-126987723 CAGTGGGGATGGAACAATGTTGG - Intronic
1060868133 9:127016098-127016120 CAGTGGGGTGGCAGGGAAGGAGG - Intronic
1062127372 9:134870803-134870825 AGGTGGGGTGGGAGGGAGGTGGG + Intergenic
1062243172 9:135550476-135550498 CACTGGGGCTGCAGGGATGCGGG + Intergenic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1186273296 X:7913396-7913418 CAGTGCTGTTGGTGGCATGTTGG + Intronic
1186568983 X:10694594-10694616 TAGTTGGGTGGGAGGGATGGTGG + Intronic
1187295252 X:17993184-17993206 CACTGGGGATGCAGGGATGGGGG - Intergenic
1187337482 X:18393833-18393855 GAGGGGGGTGGGATGGATGTGGG - Intergenic
1187407834 X:19020080-19020102 CAGAGGGATTGGGGAGATGTTGG + Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1188632721 X:32387249-32387271 AAGTGGTGTTGGAGTGGTGTTGG - Intronic
1189301123 X:39953066-39953088 CAGTGGGGTTGTGGGGGTGGGGG - Intergenic
1190080431 X:47352968-47352990 GAAGGGGGTTGGAGAGATGTTGG - Intergenic
1190432833 X:50394232-50394254 CAGTGGGGGTGGGAGGAGGTGGG + Intronic
1190909327 X:54757416-54757438 TAGTGGGGTTTGAGGCATATGGG + Exonic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1195791426 X:108591867-108591889 CAGTGGGGTTGGAGTATTGCTGG - Intronic
1195990761 X:110679844-110679866 CAGTGGGATTGCAGGCAGGTTGG + Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1199705534 X:150421862-150421884 CAGTGGGGTTGGGTGGAGCTTGG - Intronic
1200909909 Y:8522706-8522728 AACTGGGTTTGCAGGGATGTGGG + Intergenic
1201604755 Y:15772445-15772467 GAGTGGGATTGGGGCGATGTGGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic
1202367802 Y:24178858-24178880 CAGAAGGGTGGGAGGGATGGCGG + Intergenic
1202502981 Y:25491265-25491287 CAGAAGGGTGGGAGGGATGGCGG - Intergenic