ID: 1106388678

View in Genome Browser
Species Human (GRCh38)
Location 13:29314072-29314094
Sequence AAGCAGACCAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 3, 3: 78, 4: 762}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106388674_1106388678 23 Left 1106388674 13:29314026-29314048 CCTTTCTTCAGGAACTTAAAAAA 0: 1
1: 0
2: 4
3: 48
4: 531
Right 1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG 0: 1
1: 0
2: 3
3: 78
4: 762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106388678 Original CRISPR AAGCAGACCAAGAAAGAGGA AGG Intronic
901175933 1:7299082-7299104 AAGCAGACCTAGAGAGGGGAAGG - Intronic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901298701 1:8182256-8182278 CCGCAGCCCTAGAAAGAGGAGGG - Intergenic
901944724 1:12692419-12692441 AACCACACCAACAGAGAGGAAGG - Intergenic
902196445 1:14802031-14802053 AAGCAGGGCATGACAGAGGAAGG - Intronic
902399688 1:16151132-16151154 AAACAGGCCCAGAAAAAGGATGG + Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903510796 1:23873628-23873650 AAGCAGAGCAAGTGGGAGGAGGG - Exonic
903593138 1:24472302-24472324 AACCAGCCCAAGACAGATGATGG - Intronic
903660648 1:24975435-24975457 GAGTAAACCAAGAAAGAGAAAGG - Intergenic
903711285 1:25326647-25326669 AGGCATTCCAAGCAAGAGGAGGG + Intronic
903715663 1:25364782-25364804 AGGCATTCCAAGCAAGAGGAGGG - Intronic
904441534 1:30535004-30535026 GGGCAGAGCAAGAAAGAGAAAGG - Intergenic
904560549 1:31394564-31394586 AAGCTGGCCCAGAGAGAGGAAGG + Intergenic
904969346 1:34406759-34406781 AAGCAGAACAATAAACAGGAAGG - Intergenic
905128246 1:35731305-35731327 AGTCAGACAAAGAAGGAGGATGG + Intronic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905290977 1:36921782-36921804 AAGCAGACCAAGGCAGGAGAAGG + Intronic
906124365 1:43418191-43418213 CAGCAGAGCAAGAGAGAGAATGG + Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906457061 1:46006174-46006196 GAGCAGTCCAAGAATGGGGAAGG - Intronic
906616872 1:47239519-47239541 ACAGAGACCAAAAAAGAGGAAGG - Intergenic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907413104 1:54296106-54296128 AAGCAGACAAATAAGGAAGAAGG - Intronic
907740751 1:57163434-57163456 CAGCAGAGCAAGCAAGGGGAAGG + Intronic
907787974 1:57632572-57632594 AGGCAGACACAGACAGAGGAAGG + Intronic
908722704 1:67143351-67143373 AAGCAGACCAAGCAAAAACAAGG + Intronic
909391950 1:75129804-75129826 TCGCTGATCAAGAAAGAGGATGG - Intronic
910005509 1:82391330-82391352 AAGTGGCCCAAAAAAGAGGATGG + Intergenic
910211766 1:84800732-84800754 GCGCAGACCAAGAAATAGCATGG + Intergenic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912631777 1:111252614-111252636 AAGGAGACCAAGAAACTTGATGG + Intergenic
912915160 1:113807345-113807367 AAGCAAACAAACAAAAAGGATGG + Intronic
913128516 1:115815772-115815794 AAGAATAACAAGAAAGGGGAGGG - Intergenic
913178780 1:116299128-116299150 AAGCAAAGAAAGAAAGAGAAAGG + Intergenic
915205512 1:154267863-154267885 AAAAAGACCAAATAAGAGGATGG - Intronic
915746307 1:158161722-158161744 CAGCAGAGCTAGAAAGAGAAAGG + Intergenic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916853221 1:168725179-168725201 AAGCAAAGGAAGAAAAAGGAAGG - Intronic
917635893 1:176935858-176935880 AAAGAGAGCAAGAAAGAGGGGGG - Intronic
917641786 1:176990011-176990033 AGGCAGTCCAAGAAAGCTGAAGG - Intronic
917811500 1:178662833-178662855 AAGTAGACCAAGCAAGATGTTGG + Intergenic
918232519 1:182549059-182549081 AAGCAAGCATAGAAAGAGGAGGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
919360397 1:196585649-196585671 TAACAGAGCAAGAAAGAGAATGG + Intronic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
919923514 1:202180159-202180181 AAGCAGACGAGGGATGAGGAAGG + Intergenic
919974991 1:202604504-202604526 AAGAAGAACAAGAAGGAGAAGGG - Exonic
920068469 1:203286055-203286077 AAGCAGACCTAGAAGTGGGATGG - Intergenic
920764090 1:208814750-208814772 AAGAATAACAAGAAAGAGAAGGG + Intergenic
920867588 1:209766086-209766108 GAGCAGAGAAAGAAAGATGATGG + Intronic
921364022 1:214356998-214357020 TAGCAGACCTAGAAAGAGAAAGG - Exonic
921541657 1:216423562-216423584 CATGAGAGCAAGAAAGAGGAGGG - Intergenic
922173946 1:223180187-223180209 AATCATACAAAGAAAGAGGCTGG - Intergenic
922240834 1:223754750-223754772 ACGCAGAACAAGAAAGAGTCTGG + Intronic
922724386 1:227915656-227915678 AAGGAGACGAGGGAAGAGGAAGG - Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923113463 1:230912145-230912167 AAGCAGACAACCAAAGAAGAAGG + Intronic
923171195 1:231419392-231419414 AAGCAGATCAAGAAAGATTTGGG + Intronic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923774633 1:236967406-236967428 AAGCAGACTACAAAAGATGAGGG + Intergenic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924721531 1:246627478-246627500 GAGTAAACCAAGAAACAGGAAGG + Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063464837 10:6236406-6236428 AATCAGACCAAGCAAGACGCTGG - Intergenic
1063552519 10:7046421-7046443 AAGTAGGCCAGGAAAGAGGAAGG - Intergenic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1064760166 10:18610806-18610828 AAGCAGACAAAGCAAGCGAAAGG + Intronic
1064768856 10:18702904-18702926 AAGCAAACCAAGACACAGAAGGG - Intergenic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1064927277 10:20582694-20582716 AAGCAGAGAAAGTAGGAGGAGGG - Intergenic
1065038593 10:21666064-21666086 CAGCAGACAGAGAAAGAGAAGGG - Intronic
1065052800 10:21813127-21813149 AAGTAACCCAAGAAAGAGCAAGG - Intronic
1065052805 10:21813260-21813282 AAGTAACCCAAGAAAGAGCAAGG - Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065416890 10:25498044-25498066 GAGCAGAAAGAGAAAGAGGAAGG + Intronic
1065569302 10:27053341-27053363 AAGAAGAGCAAGAAAGGGAAGGG - Exonic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334657 10:34463283-34463305 GAACAGAACAAGAAAGGGGAGGG + Intronic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1069124287 10:64609830-64609852 ATGAAAACAAAGAAAGAGGAAGG - Intergenic
1069247714 10:66227846-66227868 AACCAGACCAATAATGAGTAAGG - Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070091231 10:73287642-73287664 AAGCAAAGTATGAAAGAGGAAGG + Intronic
1070606160 10:77899823-77899845 AAAGAGACCATGAAAGAGGAAGG + Intronic
1070627452 10:78061486-78061508 AAGCAAACCCTGATAGAGGAGGG - Intergenic
1070628763 10:78069521-78069543 AAGCAGATCATCCAAGAGGATGG - Intergenic
1070707354 10:78650035-78650057 AAAAAGACCAAGAAAGAAGGGGG + Intergenic
1070723834 10:78774727-78774749 CAGCAGGCAAAGAAAGGGGAGGG - Intergenic
1070822194 10:79365042-79365064 ACCCAGAGCAAGAAAAAGGAAGG + Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071019742 10:81038473-81038495 AAGTAGACCAAGCAAGCAGAAGG + Intergenic
1071095902 10:81974465-81974487 AAGCAGAGCAACAAAGAGATGGG + Intronic
1071166171 10:82810177-82810199 AAGCACACAAAGAATTAGGATGG - Intronic
1071266164 10:83966752-83966774 AAACAGGCTAAGAAAGAGAAGGG - Intergenic
1071351414 10:84749815-84749837 AAGCAGAACATAAAAGAGAAGGG + Intergenic
1071728598 10:88224575-88224597 AAGTAGCCCAAGAAAGAAGGAGG - Intergenic
1071877817 10:89861504-89861526 AGGCAGAAGAAGAAAGAAGAAGG - Intergenic
1072718697 10:97767821-97767843 AAGGAGATCAAGATAGAGAATGG - Exonic
1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG + Intronic
1072781880 10:98257063-98257085 AAGGAGACCAAGGCAGAGAAGGG - Intronic
1073096387 10:100982813-100982835 AAGGCGAGCAAGAAAGAGAAGGG + Intronic
1073588637 10:104735095-104735117 AAGCACATCAAGAAAGAGAAGGG + Intronic
1074069909 10:110056862-110056884 AAGAAGACCAATAAAAAGAAAGG - Intronic
1074300638 10:112230561-112230583 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1075284458 10:121171711-121171733 AAAAAGAGAAAGAAAGAGGAAGG + Intergenic
1075545026 10:123348713-123348735 AAGCAGACAAAGAAGGTGGGTGG - Intergenic
1075950166 10:126470253-126470275 ATGGAGGCCATGAAAGAGGAAGG + Intronic
1076046704 10:127300063-127300085 AAGCAGACCCAGCAAAGGGAAGG + Intronic
1076075104 10:127527501-127527523 AGGCAGACAGAGGAAGAGGAAGG - Intergenic
1076232005 10:128827885-128827907 AAGCATGCCAAGAAGGATGAGGG + Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1077518573 11:3017293-3017315 AAGCTGAGCAACAAAGAGGAAGG + Exonic
1077599490 11:3564099-3564121 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1078080326 11:8199778-8199800 GAGCAGAACAAGGGAGAGGATGG - Intergenic
1078423670 11:11232480-11232502 AAGCAGACCCAGGAAGGGGGTGG - Intergenic
1080083590 11:28251903-28251925 TAGCAGAGGAAGAAAAAGGAAGG - Intronic
1080738101 11:35037112-35037134 GAGGAGCCCAACAAAGAGGATGG - Intergenic
1081057709 11:38431189-38431211 AAGCAGACAGAGGAACAGGAAGG + Intergenic
1081518516 11:43858331-43858353 AAGCAGAACATAAAAGAGAAGGG - Intergenic
1081653559 11:44841668-44841690 ACGCAGAGCTAGGAAGAGGAGGG + Intronic
1082972079 11:59033971-59033993 AAACAGACCAATAATGAGTAAGG - Intronic
1083097711 11:60268547-60268569 CAGTAGTCCAAGAGAGAGGATGG - Intergenic
1084255396 11:67938704-67938726 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1084817353 11:71656591-71656613 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1085008954 11:73122471-73122493 GAGCAGATCAAGAAAGAAGATGG - Intronic
1085316402 11:75547845-75547867 GAGCAGACAAAGAAAGACGTGGG + Intergenic
1085541059 11:77270165-77270187 AAGGAGACCCAGAGAGAAGAAGG + Intronic
1086003962 11:82013885-82013907 ATTCAGGCCAAGAAAAAGGATGG + Intergenic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086515198 11:87603940-87603962 ATGGAGCCCAAGACAGAGGAGGG + Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087162313 11:94960722-94960744 AAGCAAAGCAATAAAGTGGATGG + Intergenic
1087202282 11:95357805-95357827 AAGTAAACCAAGAAGGAGGAGGG - Intergenic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087920805 11:103864161-103864183 AACCAGACCAATAAAAAGGAAGG + Intergenic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088448351 11:109955570-109955592 AAGCAGGACAAAAAGGAGGAGGG + Intergenic
1088572049 11:111231737-111231759 ATTCAGACCAAGGCAGAGGATGG + Intergenic
1089612521 11:119677455-119677477 AAGCACCCCCAGAAAGAGAAAGG + Intronic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1090311978 11:125749064-125749086 AAGCAGCAGAGGAAAGAGGAAGG - Exonic
1090439825 11:126716203-126716225 AGGCGGAGGAAGAAAGAGGAAGG + Intronic
1090775759 11:129963949-129963971 TGGCAGACCAAGAAAGAGCAGGG - Intronic
1090864650 11:130688602-130688624 AAACAGAAAAAGAAAGAGAAAGG + Intronic
1090879737 11:130823159-130823181 AATCAGAACATGAAAGAGGGTGG + Intergenic
1091143339 11:133254936-133254958 AAACAGACCAAATAAGAGGCAGG + Intronic
1091272453 11:134327177-134327199 GTGCAGACCGAGAAAGGGGATGG - Intergenic
1091323185 11:134665809-134665831 AATAATGCCAAGAAAGAGGACGG + Intergenic
1092092322 12:5813038-5813060 AAACAAAGAAAGAAAGAGGAAGG + Intronic
1092225520 12:6745882-6745904 AAGCAGAATAACACAGAGGAGGG - Intergenic
1092425631 12:8373444-8373466 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1092449006 12:8584765-8584787 TAGCAGACCGGGAAAGTGGAGGG + Intergenic
1092508129 12:9124978-9125000 AGGCAGAGCAAGAGAGAGGATGG + Intergenic
1092571813 12:9733453-9733475 AAACAGAACAAGAAAAAGAAGGG + Intergenic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1093250528 12:16798017-16798039 TAGCAAACCCAGAAACAGGAAGG - Intergenic
1093687024 12:22068398-22068420 AAGAAGAGGAAGAAAGATGAGGG + Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095727522 12:45469571-45469593 AAGCAGAGCAGAACAGAGGATGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096322369 12:50626382-50626404 AAGAAGAGCAAGAGGGAGGAAGG + Intronic
1096456163 12:51788815-51788837 GAGCCCACCAAGAAAGAGGAAGG + Intronic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096989663 12:55789601-55789623 AAGGTTTCCAAGAAAGAGGAGGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098980531 12:76951107-76951129 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1099230972 12:80025107-80025129 AGGAAGACCAAAAGAGAGGAAGG - Intergenic
1099595278 12:84655063-84655085 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1099941660 12:89196388-89196410 TAGCAAACCAAGAAGAAGGAAGG + Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100190546 12:92186543-92186565 AAGCAAACAAAGAGACAGGATGG + Intergenic
1101326656 12:103721635-103721657 ATGCTGACCAAGAAAGACCAGGG + Intronic
1101751274 12:107584552-107584574 AAACAGCCCTAGAAAGGGGAAGG + Intronic
1101900786 12:108789754-108789776 AAGCAAAGCAGGAAGGAGGAGGG + Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102523866 12:113496954-113496976 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1102702373 12:114850560-114850582 ATCTAGACCAAAAAAGAGGAGGG - Intergenic
1102801929 12:115742784-115742806 AAACAGAACAAGAGAGAGGGAGG - Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1105605562 13:21923810-21923832 AAGCAGAGCTCAAAAGAGGATGG - Intergenic
1105617859 13:22036829-22036851 AAGCAGAAAAAAAAAAAGGATGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1107047326 13:36007554-36007576 AAGAAGAGCAACAAACAGGAAGG + Intronic
1107166191 13:37282786-37282808 AAGCAGACCAATAACAAGTAAGG - Intergenic
1108026905 13:46187511-46187533 AAGTAGACAAAGAAAGTGGATGG - Intronic
1108037816 13:46310024-46310046 GAGTAAGCCAAGAAAGAGGAAGG - Intergenic
1108278847 13:48840560-48840582 GAGCAGACCAAGGAGGTGGAGGG - Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1108861253 13:54862230-54862252 AAGAAGAGCAAGTAAGGGGAAGG + Intergenic
1108900403 13:55397591-55397613 AAGTAGACAAGGAAAGAGAATGG - Intergenic
1109243664 13:59925704-59925726 GAGCAGACCAATAATGAGTAAGG - Intronic
1109282827 13:60376809-60376831 ATGAAGACCAATAAAGAGGGGGG + Intergenic
1109428534 13:62200244-62200266 AACAAGAACAAAAAAGAGGATGG - Intergenic
1109946872 13:69445878-69445900 AAGCAATCCAATAAAGAAGAAGG - Intergenic
1110317190 13:74123453-74123475 AGGCAGATCAAGAAAGAAGCAGG - Intronic
1111178903 13:84636114-84636136 GGGCAGACCACCAAAGAGGATGG - Intergenic
1111216681 13:85152139-85152161 CAACAGAGCAAGAAAAAGGAAGG - Intergenic
1112048141 13:95617763-95617785 GAGCAGACTAAGGAAGGGGAAGG + Intronic
1112143256 13:96670111-96670133 AAGAAGACTAAGAAGGAGCAAGG + Intronic
1112170277 13:96965869-96965891 AATGAAATCAAGAAAGAGGAGGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112644167 13:101310550-101310572 AAGCAGACAAAGAGAGGGGAAGG - Intronic
1113585158 13:111459789-111459811 AAGGAGACGAAGAGAGAGAAGGG + Intergenic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1114042542 14:18692373-18692395 AACCAGGACGAGAAAGAGGAGGG + Intergenic
1114109722 14:19465362-19465384 AAGCACACAAGGAAAGAGGCTGG + Intergenic
1114932303 14:27488244-27488266 TATCAGACCAACAAAGAGCAAGG + Intergenic
1115700965 14:35952698-35952720 AAGAAGCCAAAGAAAGAGAAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1119036209 14:71231946-71231968 CAGCAGAGGAAGAAAGATGATGG + Intergenic
1119324892 14:73753951-73753973 AAGAAGAGCAATAAAGGGGAAGG + Intronic
1119560747 14:75587600-75587622 GAGCATACCAAGAAAAGGGAAGG - Intronic
1119752043 14:77085708-77085730 AAGTAGACAAAGAAAGACAAGGG + Intergenic
1119947792 14:78713245-78713267 AAGCAGACCCAGGAAGGGGTTGG - Intronic
1121232406 14:92367369-92367391 AAGCAAACCAAGGCAGAGGGAGG + Intronic
1121426830 14:93858393-93858415 AGACAGACCCAGAAAGAGCAGGG - Intergenic
1121488896 14:94343795-94343817 GAACTGACCAAGGAAGAGGAAGG - Intergenic
1121844946 14:97164706-97164728 AAGCTGAACAAGAAAGTGAAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122891826 14:104735588-104735610 CAGCAGCCCAGGCAAGAGGACGG - Intronic
1123503148 15:20910364-20910386 AAGCATACCCAGAAACATGAAGG - Intergenic
1123560396 15:21484029-21484051 AAGCATACCCAGAAACATGAAGG - Intergenic
1123596635 15:21921330-21921352 AAGCATACCCAGAAACATGAAGG - Intergenic
1123974673 15:25541947-25541969 ATGAAGACCAAGAAACAAGATGG - Intergenic
1124791439 15:32730988-32731010 AAGCAGACCATCCACGAGGAAGG + Exonic
1125757425 15:42072903-42072925 ATGCAAAGCAAGAAAGAAGAGGG - Intronic
1125848139 15:42877497-42877519 AAAAAGAGCAATAAAGAGGAAGG + Intronic
1126059309 15:44764112-44764134 AAGCAGAGTAACACAGAGGAGGG - Intronic
1126774696 15:52090384-52090406 GAGCAAACCAAGAAAGAGAAAGG + Intergenic
1127232107 15:57007909-57007931 AAAGAAACAAAGAAAGAGGAAGG - Intronic
1127623818 15:60760623-60760645 GAGCATACCAAGAAATAGGAAGG + Intronic
1127831509 15:62755367-62755389 AGTCACTCCAAGAAAGAGGAGGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128539035 15:68512159-68512181 AAGGAGCCCACGGAAGAGGAAGG + Intergenic
1128560943 15:68667308-68667330 AAGCAGAGGAAGAAGCAGGATGG - Intronic
1128913030 15:71533742-71533764 AAGAAGACCAAGGCAGATGAGGG + Intronic
1129220871 15:74131007-74131029 AAGTAGACCAAGCAGGAGGCGGG + Intronic
1130045399 15:80440392-80440414 AAACAGACCCAGCAAGAAGATGG - Intronic
1130293846 15:82628736-82628758 GAGCAGGCCGAGGAAGAGGAAGG - Intronic
1130419359 15:83728177-83728199 ATGGAAACCAAGAAAGAGCAGGG - Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1130814597 15:87418051-87418073 AAGCAGACAGAGAAGTAGGAAGG + Intergenic
1131132580 15:89909746-89909768 AAGCAGCCATGGAAAGAGGAAGG + Intronic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1202968744 15_KI270727v1_random:211193-211215 AAGCATACCCAGAAACATGAAGG - Intergenic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133010347 16:2907124-2907146 TAGCAGACCAGGAAAGGGGGGGG - Intergenic
1133014980 16:2935496-2935518 AAGAAAACCAAGAAAGAGAAAGG - Intronic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133119731 16:3598619-3598641 AAGCTGGGCAAGAAGGAGGAGGG + Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133209874 16:4257625-4257647 AAGAAAACCCAAAAAGAGGAAGG + Exonic
1133372707 16:5257471-5257493 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1133735372 16:8611035-8611057 AAGCAGACTAGGGAAGGGGAAGG - Intergenic
1133756057 16:8763376-8763398 AAGCAGAAAAAGCAAGAGGTAGG + Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1135430804 16:22381549-22381571 AGGCTAACCAAGCAAGAGGAAGG - Intronic
1135647339 16:24174636-24174658 AAGCAGCTGAAGAAAGAGGCAGG - Intronic
1135779027 16:25282716-25282738 AAGTGGACCATGATAGAGGAAGG - Intergenic
1135934964 16:26771760-26771782 AAGCAGAGCAAGGAGCAGGATGG - Intergenic
1136104313 16:28018627-28018649 AAGAATAACAAGAAAGAAGAGGG + Intronic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136229165 16:28876934-28876956 AAACAGGCCTAGACAGAGGACGG + Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136670177 16:31849519-31849541 CAGCAGACAGAGAAAGAGAAGGG + Intergenic
1136999517 16:35216786-35216808 CAGGAGCCCAGGAAAGAGGAAGG - Intergenic
1137003433 16:35251220-35251242 CAGGAGCCCAGGAAAGAGGAAGG + Intergenic
1137291495 16:47055059-47055081 AGCCAGAGCAAGAGAGAGGATGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1138778923 16:59758854-59758876 AAGCAGAGCAAATAAAAGGAGGG + Intergenic
1139367418 16:66441994-66442016 GAGAAGACCAAGGCAGAGGAAGG + Intronic
1139580486 16:67870750-67870772 AAGGGGATCAAGAAACAGGAAGG - Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139751846 16:69113703-69113725 AAGAAGAGCAAGAAAGGGGTTGG - Intronic
1140259056 16:73361634-73361656 AAGGAGACCAAGATTGGGGATGG - Intergenic
1140487092 16:75302081-75302103 AAGCAGAGCATAAAGGAGGATGG + Intronic
1140541984 16:75764638-75764660 AAGAAGACAAAGAATGAAGATGG + Intergenic
1140723644 16:77792454-77792476 AAGCAGGCTAGGGAAGAGGAAGG + Intronic
1140857344 16:78989701-78989723 AAGCAGAGCAGGAGAGAGAATGG + Intronic
1141020496 16:80491488-80491510 AAGCAGACCTAGGAGAAGGAGGG - Intergenic
1141066005 16:80914584-80914606 AAAGAGACCAAGCAAGAGGCCGG + Intergenic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141541315 16:84724625-84724647 AAGCAGACAAAGGAAGAAGGAGG - Intronic
1141685616 16:85568206-85568228 AAGCAGACCCTGGAAGAAGATGG - Intergenic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144091420 17:11860345-11860367 AAGCAGAATAAGAGAGAGAAAGG - Intronic
1145783019 17:27576098-27576120 AAGCAGACTTTGAAGGAGGAGGG - Intronic
1145981338 17:29013728-29013750 AAGGAAACCAAGAAACAGAAAGG - Intronic
1146017743 17:29247328-29247350 GGACAGAGCAAGAAAGAGGAAGG - Intronic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1147416092 17:40291108-40291130 AAGCAAGGCAAGAAAGAGAATGG + Exonic
1147452286 17:40513129-40513151 AAGGAAACCAAGAAAGGAGAAGG + Intergenic
1148339226 17:46863513-46863535 GAGAAGACAAAGAAAGAGGATGG + Intronic
1148356764 17:46980351-46980373 AAGAAGAGAAAGAAAGAAGAAGG - Intronic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148570332 17:48663143-48663165 AAACAGACCCAGAAAGAAGCTGG - Intergenic
1148768545 17:50053638-50053660 AAGCAGACCATGAGAGAGGCTGG + Intergenic
1148807081 17:50269357-50269379 AAGCAGAAAGAGTAAGAGGAGGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149154988 17:53618130-53618152 AATGAAACCAAGAAAAAGGATGG - Intergenic
1149299822 17:55294773-55294795 AACAAGAACAAGAAAGAGGATGG + Intronic
1149515283 17:57276539-57276561 ATGCAGAGAAAGATAGAGGAGGG + Intronic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150439868 17:65182431-65182453 AAGCAGGCCGAGAGAGAGGGTGG + Intronic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150922238 17:69495897-69495919 AAGCAGCCCATAAATGAGGAAGG + Intronic
1152846238 17:82601404-82601426 AAGCGGATCAAGACAGAAGACGG + Exonic
1153166462 18:2267188-2267210 AGGCAGAACAAGAAGGAGGGAGG + Intergenic
1153634656 18:7103462-7103484 AACCAGACTAAGAAAGAGAATGG - Intronic
1154326502 18:13395261-13395283 AAGAAGACTATGAAAGAAGACGG - Intronic
1156464286 18:37338947-37338969 AGGAAGACCAGGCAAGAGGATGG + Intronic
1156661620 18:39352778-39352800 AGGCAGAGCATGGAAGAGGAAGG - Intergenic
1156666810 18:39418544-39418566 AAGCAGAAGAAGAAAAAGAAGGG + Intergenic
1156683192 18:39616141-39616163 AAGCAGAAGAAGAGAGAGAAGGG + Intergenic
1156752709 18:40478901-40478923 GAGAAGACTAGGAAAGAGGAAGG - Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157049632 18:44147168-44147190 AAGTAGATGAAGAAAAAGGAAGG + Intergenic
1157330396 18:46699924-46699946 ACTGAGACCAAGAAAGAGGCTGG - Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158611100 18:58941849-58941871 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1159268188 18:66111643-66111665 AAGGAGACAGAGAGAGAGGAAGG + Intergenic
1159933083 18:74334305-74334327 AAGCAGAAGGGGAAAGAGGAAGG + Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1162056895 19:8069959-8069981 AAGTAGATCAAGACAGAGAAGGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1163011321 19:14428304-14428326 AAACAAACCAAGAAAGGGGGCGG - Intergenic
1163223861 19:15940900-15940922 CAGCAGTCCAGGAGAGAGGATGG + Intergenic
1163403783 19:17110216-17110238 ATGCTGACCAAAAAACAGGAAGG + Intronic
1164482877 19:28628441-28628463 AAACAGACCAATAATGAGTAAGG + Intergenic
1165085223 19:33340936-33340958 AAGCAGACAAATAAATAGCAGGG + Intergenic
1165239811 19:34456984-34457006 AAGCAGGCAAAGAAACCGGAAGG - Intronic
1165581668 19:36870487-36870509 AACCAAACCAAGAAACAGGAAGG - Intronic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1166076360 19:40415871-40415893 GAACAAACCCAGAAAGAGGAGGG + Intergenic
1166728318 19:45042351-45042373 CAGCAGACCAGGGAAGAGGCTGG + Intronic
1167429136 19:49444231-49444253 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1167429147 19:49444309-49444331 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1168495929 19:56850868-56850890 GAGCAGATCAATAAAGAGTAAGG - Intergenic
1168543568 19:57231933-57231955 AAGGATACAATGAAAGAGGAAGG + Intronic
925253406 2:2461800-2461822 AAACAGACCAAGTCAGATGATGG + Intergenic
925488531 2:4365321-4365343 GAACAGACCAATAAAGAGTAAGG - Intergenic
926283095 2:11466083-11466105 ACGCAGACGGAAAAAGAGGAGGG + Exonic
926906428 2:17809969-17809991 CAGCAGACACAGCAAGAGGATGG - Intergenic
926959718 2:18342796-18342818 AAGCAGACAGAAAAATAGGAAGG + Intronic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
927823311 2:26288381-26288403 AAGCAGACAAAAAAAGAGCAGGG - Intronic
928057746 2:28074969-28074991 ATATAGACCAAGAAAAAGGAGGG + Intronic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928208421 2:29304656-29304678 CAGCAGACAAGAAAAGAGGATGG - Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
928810747 2:35221859-35221881 CAAGAGACCAAGAAAGAGCAGGG + Intergenic
929239384 2:39638330-39638352 AAGCAAACAAAGCAAGAAGAGGG + Intergenic
929372081 2:41237672-41237694 AAGCAGACCAATAATGAATAAGG - Intergenic
929648434 2:43653548-43653570 AAGTAAACCAAGAACGAGGAAGG + Intronic
929744952 2:44647273-44647295 AAACTGACCAACAAAAAGGAAGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
929967605 2:46547432-46547454 TAGCAGACAAAGAGAGAGAATGG + Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930775356 2:55165353-55165375 AAGAAGACGAGGAAAGAGGGAGG + Intergenic
932170215 2:69548545-69548567 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
932187592 2:69712261-69712283 AAGCAAACCAAGAGACAGGAAGG + Intronic
932215723 2:69964725-69964747 AAGCAGGACAATAAACAGGAAGG + Intergenic
932439632 2:71725135-71725157 AAGTAAACCAAGGAAGAGAAAGG + Intergenic
932716959 2:74107944-74107966 AGGCAAACCAATAAAGTGGAAGG - Exonic
933769878 2:85736702-85736724 AAGTGGTCCAAGAAAGAGCAGGG - Intergenic
933855698 2:86412150-86412172 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
935499682 2:103823126-103823148 CAGCAGACCAAGAAAAAGACTGG + Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936034557 2:109100525-109100547 GAATAAACCAAGAAAGAGGAAGG + Intergenic
936225390 2:110644996-110645018 TAGCAGACAAAGAAAGAACAAGG + Intronic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936290528 2:111220377-111220399 AAGGAGACCAAGGAACAGGATGG - Intergenic
936521077 2:113212543-113212565 AAGAAGACCATGGAGGAGGAGGG + Intergenic
936727947 2:115344921-115344943 AAGTAGAGTAAGAGAGAGGAAGG - Intronic
938157295 2:128952295-128952317 GAGCAGGCCAAGAACCAGGAAGG - Intergenic
938926482 2:136047850-136047872 AAGCAGATGGAGAAAGAGGTGGG + Intergenic
939056486 2:137371209-137371231 GAGAAGACCAAGGAAGAGTAGGG - Intronic
939642706 2:144660181-144660203 AAGCAGCACAAGAGAGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
940924990 2:159354812-159354834 AAGCAGAAGAAAGAAGAGGAAGG + Intronic
941633004 2:167904911-167904933 AAGCAGCCCTAGAAAGAGAAAGG + Intergenic
941788563 2:169525087-169525109 AAACAGAACAATAAAGGGGAAGG + Intronic
942293364 2:174494280-174494302 AAGCAGTCTAAGAAAGAGCAGGG - Intergenic
943228040 2:185206300-185206322 AAGCAGACTAATAAAGATTATGG - Intergenic
943958168 2:194220834-194220856 TAGCAGAAAAAGAAACAGGAGGG - Intergenic
944848234 2:203690415-203690437 AGACAGACCAAGAAAGACAAAGG - Intergenic
945223543 2:207508595-207508617 CAGCAGAGCAACAAAGTGGAAGG + Intergenic
945815530 2:214601049-214601071 AAGTAGACCGAGAAACAGAAGGG - Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946374346 2:219299158-219299180 TGGCAGAGCAAGACAGAGGATGG - Intronic
946476711 2:220013162-220013184 AGACAGACAAAGAGAGAGGAAGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947089242 2:226492358-226492380 TAGCTTACCAAGAAAAAGGAAGG + Intergenic
947911828 2:233806263-233806285 AAAGAAACCAAGAAAGACGAGGG + Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169155731 20:3328079-3328101 GAGAAGACCAAGCAAGGGGAAGG - Intronic
1169180143 20:3557307-3557329 AAGCAAACCATGAAAAAAGAGGG + Intronic
1169285689 20:4305388-4305410 AAGGAGGCCAACAAAGAGGTGGG - Intergenic
1169311456 20:4544939-4544961 AAACAGACCAATAATGAGTAAGG - Intergenic
1169359926 20:4939397-4939419 ACACCGACCAAGAAAGATGAGGG + Intronic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169813272 20:9630435-9630457 AAGGAGGCCAAGGAACAGGAAGG + Intronic
1169863380 20:10174334-10174356 AAGTGGACCAAGAAAGAGTGGGG - Intergenic
1170371127 20:15649136-15649158 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1170667109 20:18395716-18395738 AAGCAGGTCAAGGAAGGGGAAGG - Intronic
1170667358 20:18398405-18398427 AAGCAGAGCAGGAAAGGGAAAGG + Intronic
1171972681 20:31573844-31573866 AAGAAAACCAAGGAAGAGAAGGG - Intronic
1172603456 20:36199234-36199256 ACCGAGACCCAGAAAGAGGAAGG + Intronic
1173225646 20:41161104-41161126 AAGCAGACCAAGAAAAGGGCAGG + Intronic
1173277187 20:41595450-41595472 AAGCGGCCCAAGAAGGATGAAGG + Intronic
1173404439 20:42752635-42752657 AAACAGACCAAAAAAGAAAAAGG - Intronic
1173920503 20:46741241-46741263 CAGCAGTCCAGGTAAGAGGATGG - Intergenic
1173931707 20:46826354-46826376 AAGCAGAAGAACAAACAGGAGGG + Intergenic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1174551359 20:51364523-51364545 AAGAAATCTAAGAAAGAGGATGG + Intergenic
1174576206 20:51539470-51539492 AACCAGACAAAAAAAGAGAAGGG - Intronic
1174620873 20:51873646-51873668 AGGCAGATTAAGAAAGATGAAGG - Intergenic
1174665459 20:52253863-52253885 AAGGACACCAACACAGAGGAGGG - Intergenic
1174676366 20:52360793-52360815 ATGCATACCAAAAAATAGGATGG - Intergenic
1174720873 20:52810934-52810956 ATGCAGACAAAGAGAGATGAGGG + Intergenic
1174769828 20:53288761-53288783 AAGAAGAGCAATAGAGAGGAAGG + Intronic
1174994878 20:55555172-55555194 AAGAAGACAGAGAAAGGGGATGG + Intergenic
1175014375 20:55773259-55773281 AAGCAGACAGAGAAAGAGACAGG + Intergenic
1175035828 20:56000969-56000991 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1175759407 20:61550698-61550720 AAGGAGCCCAAAGAAGAGGAGGG - Intronic
1177657810 21:24041861-24041883 AAAGAGATCAAGAGAGAGGATGG - Intergenic
1178131461 21:29577001-29577023 AAGCAAACCAAGATAGAATATGG - Exonic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178910766 21:36671564-36671586 AAGCTGAGCCTGAAAGAGGATGG + Intergenic
1178930998 21:36819114-36819136 AAGCACACCTAGAAACTGGAGGG + Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179277100 21:39901895-39901917 GAACAGCCCAAGAAAGATGAGGG + Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1181394083 22:22605975-22605997 AAGCAATGCAAGAAAGAAGACGG + Intergenic
1181827793 22:25533294-25533316 AAGCAGCCCAACGAATAGGAAGG + Intergenic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182547379 22:31084105-31084127 AAGAGGAACAAGAAAGGGGATGG - Intronic
1182792994 22:32968546-32968568 AAGCTGACAAAGAAGGTGGAGGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183352801 22:37343391-37343413 CAGCAGACCAAGAAATGGGAGGG - Intergenic
1183519587 22:38289053-38289075 AAATAAACCAAAAAAGAGGAGGG + Intergenic
1183548363 22:38467482-38467504 ATTGAGACCAAGAGAGAGGAAGG + Intergenic
1183615616 22:38943467-38943489 AAGGAGACCAGAAAAGGGGAAGG - Intergenic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184265040 22:43342317-43342339 GAGCAGACCCAGGAAGGGGAGGG - Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185336624 22:50273622-50273644 TAGCAGACCGGGAAAGAGGGGGG + Intergenic
949142860 3:655892-655914 AAGCAGAAGAAGCAAAAGGAAGG - Intergenic
949695888 3:6695094-6695116 AACCAAACCAAAAAAAAGGATGG - Intergenic
950281047 3:11708362-11708384 AATTAGACCCAGAAAGAGCAGGG + Intronic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950751135 3:15129043-15129065 AGGCAGAACAAGGAAAAGGATGG - Intergenic
950795946 3:15510801-15510823 AAAGAGACCAAGAGAGAGGAAGG + Intronic
950918609 3:16670099-16670121 AAGCAGAAGAAGAAAAAGAAGGG + Intronic
951064288 3:18246407-18246429 AAGCAGAACAAGAGAGGAGATGG - Intronic
951285360 3:20805655-20805677 AAGCAGACAAAGCATTAGGAAGG + Intergenic
951627765 3:24684924-24684946 AAACAGACCATGCAAGAGGAGGG + Intergenic
951808170 3:26669985-26670007 AAGCAGAGCAAGGTGGAGGAAGG - Intronic
951844775 3:27073493-27073515 CAGCAGACCAGGAAAGGAGAAGG + Intergenic
952045425 3:29313257-29313279 ATGCACAACAAGAAAGAGGTAGG + Intronic
952503078 3:33982291-33982313 GAGTAGGCCAAGAAAGAGGAAGG - Intergenic
952983133 3:38754653-38754675 GGGCAAAGCAAGAAAGAGGAGGG + Intronic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953428393 3:42815644-42815666 AAGCAGATCAAGGAAGAGTCTGG - Intronic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
953643781 3:44734242-44734264 AGGCTGAACAAGGAAGAGGAAGG + Exonic
953721803 3:45362833-45362855 AAACTTACCAAGAAAAAGGAAGG - Intergenic
953824728 3:46241197-46241219 CAAAAGACAAAGAAAGAGGAAGG - Intronic
953854089 3:46487487-46487509 TAGCCTACCCAGAAAGAGGATGG + Intergenic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955932377 3:64070404-64070426 GAGCAGACATAGAAAGAGAAAGG - Intergenic
955964717 3:64377122-64377144 AAGCAGACAGAGAAAGGGGGAGG + Intronic
956340041 3:68212195-68212217 AATCAGACCAGGAAAGAGACTGG + Intronic
957117534 3:76045816-76045838 AAGAAGAGGAAGAGAGAGGAAGG - Intronic
957129099 3:76200249-76200271 AAGGTGACCAAGAAAAAGTATGG + Intronic
957320651 3:78625899-78625921 AGGGAGGCCAAGGAAGAGGAAGG + Intronic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
958992615 3:100864666-100864688 AATCTGTCCAAGAAAGAGGAAGG + Intronic
959000829 3:100962275-100962297 ATGCAGAACAAGAAAGGAGAGGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959465461 3:106680985-106681007 AAGAAGACCAAGAAAGAAACAGG + Intergenic
960178574 3:114546981-114547003 AAGCAGAGCAGTAAAGAGTAGGG + Intronic
960233603 3:115256033-115256055 AAGTAGACCAAGCAGGAGAAAGG + Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960850738 3:122051224-122051246 GAGCAGTCCAAGAAAGAGAAGGG - Intergenic
961070715 3:123922676-123922698 GAGCAGACCAATAATGAGTAAGG + Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961660553 3:128466609-128466631 AAGGAGACCATGGAAGAGGTTGG - Exonic
962519245 3:136183148-136183170 AACCAGGCCAAGAAAGAAGCAGG + Intronic
962601321 3:136993060-136993082 AAGCATATAAAGTAAGAGGAGGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962916221 3:139906219-139906241 AATGAGAGCAAGAAAGTGGAAGG - Intergenic
963049498 3:141128908-141128930 AAGGAGCCCTAGAAACAGGATGG - Intronic
963155341 3:142090508-142090530 CAGAAGACAAAGAAAGAGAATGG - Intronic
963813728 3:149806672-149806694 AAACAGACCAATAACGAGGAAGG - Intronic
964207995 3:154195949-154195971 AAACATACCAGGGAAGAGGAAGG + Intronic
965454380 3:168879752-168879774 AAGAAGAGGAAGAAAGAGTAGGG - Intergenic
965498933 3:169433543-169433565 AAGAAAAGAAAGAAAGAGGAAGG + Intronic
965603876 3:170480921-170480943 GAGCACACCAAGAAGAAGGAGGG - Exonic
965863004 3:173169780-173169802 TTGGAGACCAAGAAAGAGCATGG + Intergenic
965954503 3:174352320-174352342 AAACAGAGAAGGAAAGAGGAAGG + Intergenic
967165003 3:186772657-186772679 GAGCAGACGAAGGAAGAGAAAGG + Intergenic
967647793 3:191947517-191947539 AAGAAGACAGGGAAAGAGGAGGG + Intergenic
967869027 3:194214424-194214446 AGGTAAACCAAGAAGGAGGAAGG + Intergenic
967931434 3:194693260-194693282 GAGCAGCTCAAGAAAGAGGAAGG - Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
968451615 4:678664-678686 AGGAAGACCAAGAAGAAGGAAGG + Exonic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969013925 4:4090420-4090442 AGGCAGAACAAGGAAAAGGATGG + Intergenic
969131783 4:4995534-4995556 AAGCAGGCAGAGAAGGAGGAAGG + Intergenic
969304227 4:6316646-6316668 AAGCAAACAAGCAAAGAGGAAGG - Intergenic
969417773 4:7072222-7072244 AAGCAGACCAAGAATAAGGCAGG - Intergenic
969740056 4:9018019-9018041 AGGCAGAACAAGGAAAAGGATGG - Intergenic
969799219 4:9549528-9549550 AGGCAGAACAAGGAAAAGGATGG - Intergenic
970698954 4:18711838-18711860 AACGAGACCAGGAAAGAGGGAGG - Intergenic
971914017 4:32843674-32843696 AAGAAGAGCAAGAAAAAGGATGG + Intergenic
972571645 4:40316699-40316721 AAGCAAGCAAAGAAAAAGGAAGG - Intergenic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
973147654 4:46847699-46847721 AAAAAGACCAAGGAAGAGAAAGG + Intronic
973595952 4:52490359-52490381 AAGTAAAGAAAGAAAGAGGAAGG + Intergenic
973919186 4:55667354-55667376 GAGGAGACAAGGAAAGAGGAAGG + Intergenic
974307218 4:60157246-60157268 AAGCAGAAAAAGTAAGAAGATGG - Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974668795 4:65001491-65001513 AAGCAGACCAATTAAGAGATAGG + Intergenic
975342976 4:73261590-73261612 AAGTTGACGAAGAAAGAGTAAGG - Intergenic
976375575 4:84342022-84342044 AAGGAGACCAAGGAAAAGCAGGG + Intergenic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
977179065 4:93851492-93851514 AAGCAAATGAAGAAAGATGAAGG + Intergenic
977581584 4:98730462-98730484 AATCAGACCCAGAAAGAGTTTGG - Intergenic
977791302 4:101106834-101106856 AATCAGAGCAAGAAAGCAGATGG + Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
977976305 4:103270733-103270755 GAGCAGACTAAGACAGAAGAGGG - Intergenic
977988090 4:103409156-103409178 AGGCAGAACAGGAAAGAGTAAGG + Intergenic
978317565 4:107456404-107456426 ATGCAGAACAAAAAAGAAGATGG + Intergenic
978588549 4:110299598-110299620 AAACAAAACGAGAAAGAGGAAGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979561305 4:122105055-122105077 AAATAAACCAAGAAAGAGAAAGG + Intergenic
979600290 4:122580191-122580213 TGGCAGATGAAGAAAGAGGAAGG + Intergenic
981910604 4:149977039-149977061 AAGCAGACCAGCCAAGAGCAAGG - Intergenic
982392228 4:154877192-154877214 AAGCAGACTAAGAAACTGTAAGG + Intergenic
982471174 4:155791853-155791875 AACCAGACTGAGAAAGAGGTAGG + Intronic
982649763 4:158073143-158073165 AAGAAAAGAAAGAAAGAGGAGGG + Intergenic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983155316 4:164340055-164340077 AAGCAAACCAATAATGAGTAAGG + Intronic
983226384 4:165089732-165089754 AAGAAGGACAAGAAACAGGAGGG + Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983967581 4:173831834-173831856 GAGCAGGGCAAGAAAGAGCAAGG + Intergenic
984174249 4:176396639-176396661 AAGCAGAGCAAAGAAGGGGAAGG - Intergenic
984647003 4:182231185-182231207 AGGAAAACAAAGAAAGAGGATGG - Intronic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985619043 5:944045-944067 AAGCAGACACAGAGAGAGGGAGG + Intergenic
986664854 5:10093030-10093052 AAGCAAATCAAGAAACATGAGGG + Intergenic
986839678 5:11681440-11681462 AGACAAACCAAGAAAGAGAAAGG - Intronic
987354666 5:17052762-17052784 AACCAGAAGAAGAAAGAAGAAGG - Intergenic
988038338 5:25857263-25857285 CAGCAGAGAAAGAGAGAGGAGGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988408315 5:30853023-30853045 AACAAGACCAACAAAGAGCATGG - Intergenic
988995699 5:36713077-36713099 AAGCAGACACAGAAAAAGCATGG + Intergenic
989109389 5:37892566-37892588 TGGCAGACCAAGAGACAGGAAGG - Intergenic
990427444 5:55700864-55700886 AAGGAGACAGAGAAGGAGGAGGG - Intronic
990505083 5:56435861-56435883 AAGCAGACCAAGAAGATAGAAGG + Intergenic
990522245 5:56591496-56591518 AAGGAGACCAAGAAAGAAAAAGG + Intronic
990561945 5:56992131-56992153 AAGCAGCCAAAGAAGTAGGATGG - Intergenic
990814242 5:59765614-59765636 AGAAAGACCATGAAAGAGGATGG - Intronic
991024676 5:62016825-62016847 AGGCAGAGCAACAAAGAGCATGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
991719887 5:69485519-69485541 AAGCAAAGGAAGGAAGAGGAAGG - Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
993254502 5:85571983-85572005 AAGCAGACCAAGAAAGGGTGGGG + Intergenic
993316631 5:86415202-86415224 AAGCAGGCAAAGAAATATGATGG + Intergenic
993384140 5:87243881-87243903 AAGCAGACCAAGGCAGCTGAAGG + Intergenic
993474919 5:88352632-88352654 GAACAAACCAAGAAAGAGGAAGG + Intergenic
993668958 5:90736641-90736663 AAGCAGATCAATAATGAGTAAGG - Intronic
995295658 5:110518231-110518253 AAGCAGATTAAGAAAAAGCAAGG - Intronic
995929553 5:117422272-117422294 AGGCATACAAAGAAACAGGAAGG - Intergenic
995994064 5:118278497-118278519 AAGAAGACCAAGAAAATTGAGGG - Intergenic
996378347 5:122839169-122839191 AAATATACCAAGAAAGAGGAAGG - Intergenic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
997048823 5:130353765-130353787 AAACTGACCAAGAAAAAGAAAGG - Intergenic
997804588 5:136904721-136904743 AAACAAACAAACAAAGAGGATGG - Intergenic
997952780 5:138255080-138255102 AAGAAGAGAAAGAGAGAGGAAGG + Intronic
998936720 5:147236795-147236817 AATCAGAAAGAGAAAGAGGAAGG - Intronic
999128821 5:149266995-149267017 AAGCAGGCCATGCAAGTGGAGGG - Intergenic
999219226 5:149960992-149961014 AAGCGGACCAGGGAAGAGGGAGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999702724 5:154242806-154242828 AAGGAGACCAATGAAAAGGAAGG - Intronic
999801553 5:155042884-155042906 AAGCAGAGCCAGGAAGAGTAGGG - Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1001315577 5:170638981-170639003 GAGCAGACACACAAAGAGGAGGG + Intronic
1001666260 5:173435894-173435916 AGGCAGAGCAAAAAAGAGGGTGG - Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002259421 5:177983519-177983541 AAGCAGCCCAAGGTGGAGGAGGG - Intergenic
1002590494 5:180288295-180288317 AAGAAAACAAAGAAATAGGAGGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003855895 6:10274201-10274223 CATCATACCAAGAAATAGGAAGG + Intergenic
1003953687 6:11142655-11142677 TAGCAGACCAGGAAACAGGGAGG - Intergenic
1004032633 6:11885615-11885637 ACTCATACCAAGAAACAGGAAGG + Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1005285005 6:24315867-24315889 AAGGAGACCAAAAAGGAGGCTGG + Intronic
1005368604 6:25106120-25106142 AAGGATCCCAGGAAAGAGGATGG - Intergenic
1007294749 6:40813567-40813589 AAGCAGACCATGAAAGATCTTGG + Intergenic
1007626751 6:43251039-43251061 AAGGAGACAGGGAAAGAGGAAGG - Intronic
1007630276 6:43269617-43269639 AAAGAGACCAAGAAAGTGGAGGG - Intronic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007821248 6:44561839-44561861 AAGCAGATCTATGAAGAGGAAGG - Intergenic
1007975415 6:46096114-46096136 AACAAGACCAAGAGAGAGTAGGG + Intergenic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008348937 6:50465134-50465156 AATCAGAGCAAGAAATATGAGGG + Intergenic
1008867722 6:56234727-56234749 AAGCAGAGGAAGATAAAGGAGGG - Intronic
1008955911 6:57215401-57215423 AAGCAGCCAGAGAAAAAGGATGG + Intronic
1010073284 6:71769673-71769695 AAGTTAACCAAGAAAGGGGAAGG - Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010800246 6:80166929-80166951 AGGCATACCAAAAAAAAGGAGGG - Intronic
1010813948 6:80332885-80332907 AAGATGAGCAAGTAAGAGGAAGG - Intronic
1011000858 6:82587091-82587113 CAGGAGACCAATAAAGAGTAGGG - Intergenic
1011032144 6:82935215-82935237 AAGCAGAGCAAGCAAGAGAGAGG + Intronic
1011133870 6:84078751-84078773 AAGCAGACCCATAAAAAGGAAGG - Intronic
1011344636 6:86355433-86355455 AAGCATAGCAAGAGAGAGAATGG + Intergenic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1011720900 6:90155683-90155705 AAACAGAGCAGGAAAGAGGAGGG - Intronic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1012351078 6:98251200-98251222 AAGTAAACCAACAAAGAGAATGG + Intergenic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1014344844 6:120255160-120255182 AAGAAGACACACAAAGAGGAGGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014776471 6:125516352-125516374 AAGCAGACAAAAAAAAAGGGAGG - Intergenic
1014913160 6:127117888-127117910 AGAAAGACAAAGAAAGAGGAAGG + Intergenic
1015021533 6:128481639-128481661 AATCAGGTCAAGAAAGAGGGAGG - Intronic
1015065295 6:129019113-129019135 AAGTAAACCAAGAAAGAGGAAGG - Intronic
1015315439 6:131811128-131811150 AATCACACCAAGAAACAAGAAGG - Intronic
1015787273 6:136930815-136930837 AAGCACTCCAAGAAGGAGAAGGG - Intergenic
1015810751 6:137159752-137159774 GAGCAGACCAGGAAAAGGGAAGG - Intronic
1016760040 6:147726777-147726799 AAGGATTCCAAGAAAGAGGTGGG + Intronic
1017275352 6:152560405-152560427 GAGCAGGCCAATAATGAGGAAGG + Intronic
1017328341 6:153166279-153166301 GAGCAGGACAAGAAAGAGGAAGG + Intergenic
1017488178 6:154921789-154921811 ATGCAGCCCAAGAATGAGAAAGG - Intronic
1017577230 6:155818456-155818478 AACCAGAGAAAGCAAGAGGAAGG + Intergenic
1017812799 6:157996346-157996368 AAGCAGACCAGGAAAGCACATGG - Intronic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1019029298 6:168996298-168996320 GAGATGACCAAGCAAGAGGAGGG + Intergenic
1019049026 6:169169321-169169343 AAGCTGGCCAAGAAAGAGAGAGG + Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020733910 7:11921460-11921482 GAGCAGACCAATAATGAGTAAGG + Intergenic
1021636092 7:22695182-22695204 AAATAAGCCAAGAAAGAGGAAGG - Intergenic
1021652269 7:22843843-22843865 AAGAAGACCAAGAAGGGTGAAGG - Intergenic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022157075 7:27671427-27671449 AAGCATAGAAAGAAAGAGGCAGG + Intergenic
1023007498 7:35888032-35888054 AGGCAAACCAAGGAAGACGATGG + Intronic
1023180785 7:37481115-37481137 GAGCACACCAAGTGAGAGGAAGG + Intergenic
1023184727 7:37521354-37521376 AAACAGACCAAGGAAAAGCAAGG - Intergenic
1023204336 7:37731871-37731893 AAGCAAAGCAAGAACTAGGATGG - Intronic
1023884468 7:44342966-44342988 ATGCAGACAAAGCAAGAAGACGG + Intergenic
1023884653 7:44345053-44345075 AAGCATACCAAGAAAAAAAAAGG - Intergenic
1024005459 7:45222262-45222284 AAGAAGCCCAGGAAAGAGGAAGG - Intergenic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024481097 7:49864254-49864276 AAGAAGACAAAGAAGGAGGGAGG + Intronic
1024979410 7:55144969-55144991 AATCATACCAAGGAAGTGGAAGG - Intronic
1025519618 7:61707571-61707593 AAACAGATCAAGCAAAAGGAAGG - Intergenic
1025543942 7:62136223-62136245 AAACAGATCAAGCAAAAGGAAGG - Intergenic
1026066792 7:67081817-67081839 AGTCAGACCAAAAAAAAGGAAGG - Intronic
1026110546 7:67455695-67455717 GAGAAGAGAAAGAAAGAGGAAGG - Intergenic
1026657341 7:72268323-72268345 AAGCAGACAAAAAAAAAGAAGGG + Intronic
1027394155 7:77736481-77736503 AATGAGATCAAGAAAGAGAATGG + Exonic
1027646704 7:80810586-80810608 AAGTAGACAACGAAAGAGGGAGG - Intronic
1027942450 7:84701553-84701575 ATGTAGACCAAGGAAGAAGACGG + Intergenic
1027991633 7:85370262-85370284 AAGCAGGGAAAGGAAGAGGAAGG + Intergenic
1028256013 7:88598482-88598504 AAGAAGAACAAGAAAGCGGAGGG + Intergenic
1028988108 7:97023575-97023597 AAGCGGACGAAAAAGGAGGACGG + Intronic
1029072580 7:97912034-97912056 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1029185774 7:98737384-98737406 AAGCAGTCCAAGGGAGAGGAAGG - Intergenic
1029615701 7:101655848-101655870 AAATAAACCAAGAAAGAGGGAGG - Intergenic
1029684322 7:102135391-102135413 AAGTAGGCCAAGGAAGAGGAGGG + Intronic
1030470327 7:109955152-109955174 AACAGGACCAAGAGAGAGGAGGG + Intergenic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031014906 7:116562925-116562947 AGGAAGAGAAAGAAAGAGGAAGG + Intergenic
1031270177 7:119639082-119639104 GAGCAGACTAATAAAGAGTAAGG - Intergenic
1031828168 7:126592097-126592119 AAACAGACCAATAATGAGTAAGG + Intronic
1031842517 7:126761414-126761436 AAGAAGTCAAAGATAGAGGAAGG - Intronic
1032298144 7:130661235-130661257 AAGCAGAGTAAGAAAGAAAAAGG - Intronic
1032379219 7:131458648-131458670 AAGGAATCCAAGAAAGAAGATGG - Intronic
1032540526 7:132699409-132699431 AAGCACAGTTAGAAAGAGGAAGG + Intronic
1032760218 7:134933671-134933693 CAGCTGCCCAAGAAAGAGAAAGG + Exonic
1032819246 7:135509743-135509765 AAGAAGACCAAGGAGGAGGAGGG + Intronic
1032989961 7:137382758-137382780 AAGTAGAACAAGAAAGAAGGTGG + Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1034983336 7:155491894-155491916 AAGCAGAGCAGGAAGCAGGAAGG + Intronic
1035110779 7:156479854-156479876 AACAAGAAAAAGAAAGAGGAGGG + Intergenic
1035485427 7:159220334-159220356 ATGCCCACCCAGAAAGAGGAAGG + Intergenic
1036024297 8:4887002-4887024 ACACAAACCAAGCAAGAGGAAGG - Intronic
1036245086 8:7109268-7109290 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036255661 8:7204541-7204563 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036361823 8:8082961-8082983 AGGCAGAACAAGGAAAAGGATGG - Intergenic
1036889145 8:12584054-12584076 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1036896733 8:12642196-12642218 AGGCAGAACAAGGAAAAGGATGG + Intergenic
1037064860 8:14565720-14565742 AAACATATCCAGAAAGAGGAGGG + Intronic
1037094803 8:14972977-14972999 AGGCACACAAAGAAGGAGGAAGG - Intronic
1037571835 8:20164684-20164706 AAGCAGTCTGAGAAAGGGGAGGG - Intronic
1037636140 8:20702388-20702410 AAGCAAAGCCAGAAAGAGAAGGG + Intergenic
1037711037 8:21355595-21355617 AAACAGACCCAGAGAGGGGAGGG + Intergenic
1038216549 8:25566981-25567003 AAGCAGAGAAAGAAAGACGAAGG - Intergenic
1039498306 8:37997710-37997732 AAGCAGGCAAGGAGAGAGGAAGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039689900 8:39852088-39852110 GAGCAGACGAAGCAAGAGAAAGG - Intergenic
1040056824 8:43065776-43065798 AAGTAAATCAAGAAAGAGAAAGG - Intronic
1040059194 8:43089930-43089952 AAACTGACCAACAGAGAGGAGGG - Intergenic
1040543787 8:48381412-48381434 AAGAAGAGAAAGAAAAAGGAAGG - Intergenic
1040578776 8:48677779-48677801 AGGCAGACGAAGCAAGAGGGTGG + Intergenic
1040656275 8:49513002-49513024 AGGCAGAGTAGGAAAGAGGAAGG - Intergenic
1040894778 8:52354761-52354783 AAGTTGAGCAAGAAAGAGAAGGG + Intronic
1042098056 8:65240717-65240739 AAGGAGACCACAAAAGAGGAAGG + Intergenic
1043500560 8:80850545-80850567 GCACAGACCAAGAAACAGGAAGG - Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043751781 8:83945526-83945548 GAGCAGACCAAGAAAAAGAGTGG - Intergenic
1043869703 8:85418595-85418617 AAACAGACCAATAACGAGCAAGG - Intronic
1044968689 8:97598523-97598545 AACCAGACAATGAAAAAGGAAGG - Intergenic
1045657448 8:104401591-104401613 AAACAGACCAAGAAACATCATGG - Intronic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1047365327 8:124206030-124206052 AAGCAGACAAAGAACGTGGAAGG + Intergenic
1048063604 8:130945986-130946008 TAGCTGAGCAATAAAGAGGATGG - Intronic
1048115059 8:131511700-131511722 ATGAAGACAAAGAAAGAGAAAGG + Intergenic
1048808703 8:138265131-138265153 CACCAGAGAAAGAAAGAGGAAGG - Intronic
1048874551 8:138826902-138826924 AGGCAGGCCAAGAAGGTGGATGG - Intronic
1049581780 8:143415312-143415334 AAGTCAACCAAGAAAGAGAAGGG + Intergenic
1050730568 9:8704382-8704404 AAGCAGAGTAGGAAGGAGGATGG + Intronic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1050847275 9:10237652-10237674 TTGCAGACCTAGGAAGAGGAGGG - Intronic
1051756762 9:20409186-20409208 AAGTAAGGCAAGAAAGAGGAAGG + Intronic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1052478073 9:28987218-28987240 GAACAGACCAATAATGAGGAAGG - Intergenic
1052597649 9:30580834-30580856 AAGAGGAACAAGAAAGTGGAGGG + Intergenic
1052606637 9:30712371-30712393 AAGCAAAATAAGAGAGAGGAAGG + Intergenic
1053147942 9:35724547-35724569 AAGCAGAACTAGAAAAAAGAGGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054762996 9:69020139-69020161 CAGCAGAGCAAGAAAGAAAAAGG + Intergenic
1054913049 9:70471615-70471637 AAGAAAAGAAAGAAAGAGGAAGG - Intergenic
1055064290 9:72103033-72103055 GAGCAAAGCAAGAAAGAGGAAGG - Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055807059 9:80107669-80107691 AAGTAGAGCAAGGAAGAGGAGGG + Intergenic
1057767010 9:97930099-97930121 AACCACACCAAGAAACAGGTGGG - Exonic
1058230971 9:102424414-102424436 AAACAGAGAAAGAAAGATGAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059266704 9:113039556-113039578 AAGCAAACCAAGGAAGGGGAGGG - Intronic
1059615068 9:115941399-115941421 AAACACACTAAGAAACAGGAAGG - Intergenic
1059617425 9:115966549-115966571 AACAGGACCAAGAGAGAGGAGGG + Intergenic
1059666382 9:116450184-116450206 AAGCAAACCAAAAAAGAGTGTGG - Intronic
1060199160 9:121641818-121641840 AAGAAAAGAAAGAAAGAGGAAGG - Intronic
1060493543 9:124101795-124101817 AAGAAAAGAAAGAAAGAGGAAGG + Intergenic
1061587661 9:131579124-131579146 CAGCAGACCAAGGAAGTGGTGGG - Exonic
1061732528 9:132627059-132627081 AATCAGACCAAGAAAAAGATGGG - Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062674703 9:137734086-137734108 AGGCATACAAAGAAACAGGAAGG + Intronic
1062682684 9:137790522-137790544 AAGCAGACAAAGAAGGGGGAGGG - Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185534416 X:849484-849506 AAGGAAACAAAGAAAGAGGAAGG - Intergenic
1185603480 X:1354577-1354599 AAGAAAACGGAGAAAGAGGAGGG + Intronic
1185827033 X:3261343-3261365 CTGCAGACCAGGAAGGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1186579133 X:10798400-10798422 AAGCAAACTAGGAGAGAGGAGGG - Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187631619 X:21179175-21179197 AAGCATAAGAAGAAATAGGAAGG - Intergenic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1188303075 X:28529291-28529313 GAGTAGACCACTAAAGAGGAGGG - Intergenic
1188349745 X:29113364-29113386 AAGAAGATCAATAAAGAGGAGGG - Intronic
1188539195 X:31230825-31230847 AGGAAGGCCAAGCAAGAGGAGGG - Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1189301493 X:39955765-39955787 AAGCAGAGCAAGAGAAGGGAAGG - Intergenic
1189860426 X:45265622-45265644 AAGCAGAACAGGAAAAAGAAAGG - Intergenic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190502632 X:51095102-51095124 AAGCAGAGAAAGAGAGAGCAGGG - Intergenic
1190635235 X:52426532-52426554 AAGCAAAGCAAGACAGAGGAGGG - Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191717369 X:64203017-64203039 AAGCAGACCCAGGAATGGGAGGG - Intronic
1191971454 X:66821445-66821467 ATGCAGAGCAAGGTAGAGGAGGG + Intergenic
1192262059 X:69511358-69511380 AAAGAGAGCAAGAAAAAGGATGG - Intronic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192315196 X:70045796-70045818 GAGTAAACCAAGAAAGAGGAAGG + Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1195594806 X:106675479-106675501 AGGCAGAGGAAGAAAGATGAAGG + Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196087561 X:111701375-111701397 GAACAGACCAATAATGAGGAAGG - Intronic
1196164427 X:112522904-112522926 AAACAGACTAAGAAGGAGAAAGG - Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196761084 X:119201530-119201552 TAGCAGAAGAACAAAGAGGAAGG - Intergenic
1197705587 X:129632375-129632397 AAACAGACTAAGACAGGGGAAGG + Intergenic
1198158860 X:133987314-133987336 AGGGAGACAAAGAGAGAGGAAGG + Intergenic
1198529889 X:137541981-137542003 AAGGAGACTAAGAAACAGCATGG - Intergenic
1199522690 X:148754072-148754094 AAGTAGACCACAAAAGAGGAAGG + Intronic
1199861770 X:151807417-151807439 AGCCTGAGCAAGAAAGAGGATGG + Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1201348694 Y:13014839-13014861 GAGCAGACCAAAAATGAGGAAGG - Intergenic
1201456165 Y:14168877-14168899 AAGTAAACCCAGAAAGAGCAAGG + Intergenic
1201793094 Y:17864011-17864033 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1201808460 Y:18041975-18041997 GAGGAGACCTAGAAAGAAGAGGG - Intergenic
1201852215 Y:18497803-18497825 GCTCAGAACAAGAAAGAGGACGG + Intergenic
1201881106 Y:18822581-18822603 GCTCAGAACAAGAAAGAGGACGG - Intronic
1202354627 Y:24033255-24033277 GAGGAGACCTAGAAAGAAGAGGG + Intergenic
1202516151 Y:25636857-25636879 GAGGAGACCTAGAAAGAAGAGGG - Intergenic