ID: 1106393078

View in Genome Browser
Species Human (GRCh38)
Location 13:29354678-29354700
Sequence GCTGGTCTTAAGTACAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106393078 Original CRISPR GCTGGTCTTAAGTACAGGTC GGG (reversed) Intronic
902827657 1:18988087-18988109 GCTGCTCGTGAGTACACGTCAGG + Intergenic
905031905 1:34890083-34890105 GCTGGTCTGAAGTACAGGGATGG + Intronic
907854123 1:58284486-58284508 GCTGGTATTAAGCACAGATCTGG + Intronic
908312796 1:62902261-62902283 TCTGGACTCAAGTCCAGGTCTGG - Intergenic
909901064 1:81136185-81136207 GCTGGTCTTCACCACAGGACTGG - Intergenic
1073982918 10:109175416-109175438 GTTGGTCTTATGTAAAAGTCTGG + Intergenic
1075010079 10:118860208-118860230 GCTGGGCTCACGTACATGTCTGG - Intergenic
1075780333 10:125013218-125013240 GCTGGTTTTCATTACAGGTGAGG - Intronic
1078337173 11:10473716-10473738 TCTGGTCTCAAGTACAGGGAAGG + Intronic
1079301771 11:19284960-19284982 GCTGGTCTTATCTACAGGTCTGG + Intergenic
1079870709 11:25794625-25794647 CTTGGTTTTAAGTGCAGGTCTGG + Intergenic
1085514523 11:77104642-77104664 GCTGATGTTAGGTGCAGGTCAGG - Intronic
1088607795 11:111548077-111548099 ACAGGTATTAAGTAGAGGTCTGG - Intronic
1091296770 11:134479419-134479441 GCTGGCCTTACCTACAGGGCTGG + Intergenic
1094608862 12:31973970-31973992 GTTGGTCAAAAGTACAGGTCTGG - Intronic
1101209756 12:102524114-102524136 GATGGTCTTAAATAGTGGTCAGG + Intergenic
1101948685 12:109157605-109157627 GCTGGTCTTGAGTACTGCCCTGG + Intronic
1102027148 12:109720113-109720135 GCTGGGCTTGAATACAGGCCTGG + Intronic
1103526326 12:121571500-121571522 GCTGGTCTTGACTTGAGGTCAGG + Intronic
1105486962 13:20843454-20843476 GCTGGCCTTAAAAATAGGTCTGG - Intronic
1106393078 13:29354678-29354700 GCTGGTCTTAAGTACAGGTCGGG - Intronic
1110880496 13:80566461-80566483 GCTGTACTTAACTACAGGTGGGG - Intergenic
1111514293 13:89307556-89307578 GTTGAGCTTAAGTACAGGCCAGG - Intergenic
1118332542 14:64825319-64825341 GGTGGTCTTGGGCACAGGTCTGG - Intronic
1119579450 14:75763911-75763933 ACAGGCGTTAAGTACAGGTCTGG - Intronic
1120151870 14:81045207-81045229 GCTGGGCTTATGTCCATGTCTGG + Intronic
1122813739 14:104301985-104302007 GCTGGGCTTGAGAACAGGGCCGG - Intergenic
1124870056 15:33532055-33532077 GCTCCTTTTAAGTACAGCTCTGG + Intronic
1125994497 15:44144891-44144913 GCTGGTCCTAAGTGCAGGGTTGG + Intronic
1132804353 16:1768843-1768865 GGGGGTCCTATGTACAGGTCGGG - Exonic
1136349577 16:29698115-29698137 GCTGGTGTTTGGTACAGGTTGGG - Exonic
1136624878 16:31456285-31456307 GCTGGTCTTTAGTAGAGGGTTGG + Intergenic
1139230348 16:65277133-65277155 GCTGGACTGAAGTCCTGGTCAGG + Intergenic
1140631434 16:76857202-76857224 TCTGGTCTTAAGTACATTTTTGG - Intergenic
1150993669 17:70290922-70290944 GCAGTTCTTAAGTACATTTCTGG - Intergenic
1154939080 18:21092893-21092915 GGTGGTCTTAAGTTGAGGTTTGG + Intronic
1160474109 18:79167244-79167266 GCTGGTCTCAAGTTCTTGTCCGG + Intronic
1165116266 19:33530777-33530799 GCTGGGCTTGAGTGCAGCTCAGG + Intergenic
932409036 2:71534460-71534482 CCTGGTCTTTAGGACAGGGCTGG + Intronic
932479796 2:72032399-72032421 GTTGGTCTTATGCACAGGTAAGG - Intergenic
933642862 2:84782757-84782779 GGAGGTCTTCAGTACTGGTCAGG + Intronic
1173402163 20:42735324-42735346 CCTGGTCCTAAGGACAGCTCAGG - Intronic
1175314186 20:58035549-58035571 GCTGGTTTGAAGTCCAGGGCGGG + Intergenic
1178154440 21:29834953-29834975 TCTGGTCTTTAGCACAGGTTTGG + Intronic
1179620423 21:42611642-42611664 GGCGGTCTCAAGTTCAGGTCAGG + Intergenic
951664832 3:25111347-25111369 GTTGGTATTAAGTCCATGTCTGG + Intergenic
965478431 3:169186278-169186300 GCTGGTCATGAGTAAAGGTAGGG + Intronic
965997225 3:174898588-174898610 GCTTGTGTTAAGTACATATCAGG + Intronic
968503077 4:960178-960200 GCTGCTCTTAAGGACTGGCCAGG + Exonic
973166850 4:47088582-47088604 CCTGGTACTAAGTACAGGCCTGG - Intronic
980459167 4:133083378-133083400 TCTGTTCTTAAATACAGGACTGG + Intergenic
991643943 5:68781834-68781856 GATGGAATTAAGTACAGGTTTGG - Intergenic
1000693515 5:164351402-164351424 AATGGTCTTAAGTACAGATTAGG + Intergenic
1002165143 5:177339306-177339328 GCTGGCCTCAAGCCCAGGTCTGG + Intronic
1003769629 6:9284791-9284813 GATGGTCCTAAGTACAAATCAGG + Intergenic
1008783717 6:55140087-55140109 GCTGGTCTCAATAAGAGGTCAGG - Intronic
1013448358 6:110253967-110253989 GCTGCTCTTGAGTTGAGGTCTGG - Intronic
1017103547 6:150867452-150867474 GCTGGGATTAATTACACGTCAGG + Intronic
1028487981 7:91380776-91380798 GGTGGTCTTATGTAGATGTCAGG + Intergenic
1030120966 7:106110530-106110552 GCTAGTGTTTAGTACAGATCTGG + Intronic
1030668871 7:112312330-112312352 GGTGGTCTTGAGTAGAGGTTAGG + Intronic
1030830799 7:114218432-114218454 GCAGTTCTTAAATATAGGTCTGG + Intronic
1043248326 8:78034856-78034878 CCTGGTCAAAAGTAGAGGTCAGG + Intergenic
1044859648 8:96510265-96510287 GCTGAACTTAAGTGCAGGTACGG - Intronic
1046090309 8:109495794-109495816 GCTGGTATTAAGTACAATTTAGG + Intronic
1046161020 8:110365097-110365119 GCTGGTCTTTCTTACAGGTTGGG - Intergenic
1046947842 8:119991002-119991024 GATGGCCTTAAGTACAGCTCGGG + Intronic
1051675181 9:19551732-19551754 GCTGGCCTTGAGGAGAGGTCAGG + Intronic
1056199776 9:84263926-84263948 GATGTTCTTCAGTATAGGTCAGG - Intergenic
1059044814 9:110854887-110854909 GCAGGTCTGAAGTACAGGGCTGG - Intergenic
1060187930 9:121575193-121575215 GGGGGTGTTAAGTACAGTTCAGG - Intronic
1196711428 X:118767701-118767723 GCTAGGCTCAAGTACAGGACTGG + Intronic
1197070557 X:122291599-122291621 GTTGGTCTGAAGTATAGGACAGG + Intergenic