ID: 1106401193

View in Genome Browser
Species Human (GRCh38)
Location 13:29432671-29432693
Sequence TTGGACAGTGAAGGGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106401193_1106401196 -8 Left 1106401193 13:29432671-29432693 CCTAAGCTCCCTTCACTGTCCAA 0: 1
1: 0
2: 2
3: 21
4: 193
Right 1106401196 13:29432686-29432708 CTGTCCAACTCCTCTTGTAATGG 0: 1
1: 0
2: 0
3: 5
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106401193 Original CRISPR TTGGACAGTGAAGGGAGCTT AGG (reversed) Intronic
900114672 1:1023421-1023443 CTGGACCCTGAAGGCAGCTTGGG - Intronic
901808926 1:11754958-11754980 TTGGACAGACAAGGAAGCTGAGG + Intergenic
901906933 1:12420674-12420696 TTGTACATTGAGGGGAGCTTGGG + Intronic
902388229 1:16088216-16088238 TTGGACAGAAAAAGGAGGTTCGG + Intergenic
903614717 1:24643428-24643450 GTGGCCAGCGAGGGGAGCTTCGG + Intronic
904058125 1:27685811-27685833 GTGGCTGGTGAAGGGAGCTTAGG - Intergenic
904449414 1:30601377-30601399 TTGGACAGTGAAGGGTGAGGAGG - Intergenic
905872539 1:41413324-41413346 TTTGACAGTGAAGGGCACTGAGG - Intergenic
906185814 1:43861114-43861136 TGGGCAAGTGAAGAGAGCTTAGG + Intronic
906614811 1:47226682-47226704 GTGGACTGTGCAGGGAGGTTGGG - Intronic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
912591907 1:110830756-110830778 GTGGACAGTGAAGGGAGAGCTGG + Intergenic
917074974 1:171195147-171195169 TTGGAGAGTGAAGAGGGGTTGGG + Intronic
918092649 1:181310713-181310735 ATGGAAAGTGAAGGGACATTTGG + Intergenic
919907021 1:202085259-202085281 TTGGAGAGGGAAGGGAGCTGGGG - Intergenic
921042113 1:211442796-211442818 CTGGACAGTGAAGGGAGCCCAGG + Intergenic
921357232 1:214296692-214296714 TTTGACAGTGAAGGAAACTGAGG + Intronic
922309277 1:224372966-224372988 TAGCACAGTGAAGGGATTTTAGG - Intronic
922678609 1:227570522-227570544 CTGGACAGTATAGTGAGCTTTGG - Intronic
923051630 1:230394546-230394568 GTGGGCAATGAATGGAGCTTGGG - Intronic
1065644771 10:27822731-27822753 TTGGTCAGTGAAGGGAGTCAAGG + Intronic
1070846213 10:79524227-79524249 TTGGCCATTGAAGGGTGCTTAGG + Intergenic
1070927585 10:80236083-80236105 TTGGCCATTGAAGGGTGCTTAGG - Intergenic
1071587662 10:86840879-86840901 TTGGATGGTGAAGGGGGATTCGG - Intronic
1072631356 10:97149069-97149091 TTGGACAGCCAAGGGAGCCCGGG - Intronic
1072813221 10:98479898-98479920 TTTGACAGTGAAGGAAGCTCAGG + Intronic
1076219255 10:128719706-128719728 TGGCACAGTGCAGGGAGCTAGGG + Intergenic
1077397047 11:2329810-2329832 TTGGAAAGGGAAGGGCGATTGGG - Intergenic
1078006076 11:7533344-7533366 GTGGAAAGTGAAGGGAGGCTGGG - Intronic
1079198235 11:18350294-18350316 TTGGATTGTTATGGGAGCTTGGG + Intronic
1079202003 11:18384360-18384382 TTGGGCAGGGGAGGGAGCTAGGG + Intergenic
1081537730 11:44007503-44007525 TGGGACAGAGAAGAGGGCTTAGG - Intergenic
1081660694 11:44886325-44886347 TGGGACATTGATGGCAGCTTGGG + Intronic
1083343716 11:61975177-61975199 CGGGGCAGTGCAGGGAGCTTTGG - Intergenic
1084672590 11:70616055-70616077 AAGGACAGTGAAGGGAGGATGGG - Intronic
1085114827 11:73921644-73921666 CTGGACAGTGAAAGGAGCACGGG - Intronic
1087082856 11:94188437-94188459 CTGGGCAGTGAAGGGAGCCCGGG - Intergenic
1088792678 11:113239995-113240017 TGGGACACTGAATGGATCTTTGG - Intronic
1093346636 12:18044626-18044648 TTCTACAGATAAGGGAGCTTAGG + Intergenic
1096239673 12:49953142-49953164 GAGGACAGTGAAAAGAGCTTTGG - Intronic
1098279028 12:68844497-68844519 TGGGACAGGGAGGGGAGTTTGGG + Exonic
1098992145 12:77075523-77075545 ATGGACAAAGATGGGAGCTTTGG + Intergenic
1100167866 12:91938695-91938717 TTGGAGAGGGAAGGGAGATGGGG - Intergenic
1101038840 12:100733491-100733513 TGGGAGAGTGAAGGGTGCTTGGG - Intronic
1101708658 12:107244460-107244482 TAGGAGAGTGATGGGAGATTAGG + Intergenic
1102120295 12:110435143-110435165 CTGGACAGTGAAGGGAGCCCGGG - Exonic
1102542031 12:113627893-113627915 TTTTACAGTGAAGGAAGCTGAGG + Intergenic
1102895990 12:116599099-116599121 GTGGAGAGGGCAGGGAGCTTTGG - Intergenic
1104958383 12:132476828-132476850 CTGGACAGTGATGGAAGCTGGGG - Intergenic
1105424278 13:20281954-20281976 TTGGACAGTGAAGGGTGGAAGGG - Intergenic
1106401193 13:29432671-29432693 TTGGACAGTGAAGGGAGCTTAGG - Intronic
1107505090 13:41025971-41025993 TAGGACAGTGAAGGTATTTTTGG - Intronic
1107713639 13:43175716-43175738 ATGGACAATGAAGATAGCTTAGG - Intergenic
1114293781 14:21311186-21311208 TTAGAAAGTGAAGGCAGCTTTGG + Intronic
1114472520 14:22973609-22973631 TTGGACACTGAGGGTATCTTAGG + Intronic
1114482730 14:23045585-23045607 TTAGACAGTGAGGGGTGCATTGG - Intergenic
1114705015 14:24715809-24715831 TGGGACTGTGATGGCAGCTTTGG + Intergenic
1117504680 14:56390304-56390326 TTGGTTGATGAAGGGAGCTTGGG - Intergenic
1117824139 14:59683518-59683540 TTCTACAGTGAATGGATCTTAGG - Intronic
1117895139 14:60476408-60476430 TTGAACAGGGATGGGAGATTAGG + Intronic
1119030467 14:71188333-71188355 GTGTGCAGTGAAGGGAGCTGGGG + Intergenic
1119499613 14:75113105-75113127 TTGGGGAGTGAAGGGCTCTTGGG + Intronic
1120619951 14:86750997-86751019 TTGGACAGTGAATGCAGCCCAGG - Intergenic
1121211055 14:92208112-92208134 TGGGACCATGCAGGGAGCTTGGG - Intergenic
1121834723 14:97081693-97081715 TTGGCCAGGGAAGGGAGGTTTGG - Intergenic
1126403621 15:48300424-48300446 TTGGACAGTGAAGGAAGATAAGG + Intronic
1128093380 15:64934141-64934163 CTGCATAGTGAAGGCAGCTTAGG - Exonic
1128801147 15:70497951-70497973 CTGTACAGGGAAGGGGGCTTTGG + Intergenic
1132702581 16:1228441-1228463 TAGGACAGGGAAGGGGGCTCAGG + Exonic
1132705745 16:1242427-1242449 TAGGACAGGGAAGGGGGCTCAGG - Exonic
1135605574 16:23821420-23821442 ATGGTCAGTGAAGGGACCCTTGG + Intergenic
1135870427 16:26144794-26144816 TTGATCATTAAAGGGAGCTTGGG + Intergenic
1137557607 16:49482645-49482667 TTTGACAGTGAGGGAAGCTGGGG - Intergenic
1138081801 16:54097790-54097812 TAGGACAGTGAAGGAAGATGGGG + Intronic
1138580449 16:57937575-57937597 TTGGTAAGTGGAGGGAGCATGGG - Intronic
1139239249 16:65373748-65373770 TTGGACAAATAAGGGGGCTTTGG + Intergenic
1141339877 16:83193292-83193314 TTTTACAGTGGAGGGAGCTGAGG + Intronic
1141939954 16:87269023-87269045 TAGGACAGTGGATGGAGCGTGGG - Intronic
1144033522 17:11342916-11342938 TTGGACTGGGAGGGGACCTTGGG + Intronic
1144340897 17:14309626-14309648 TTGGAAAGCGAAGGCAGCTCAGG - Intronic
1146075304 17:29723204-29723226 TTGGAAAATGAAGGGAGGTTTGG - Intronic
1148897575 17:50848426-50848448 TGGGGCACTGAAGGGAGCTGTGG + Intergenic
1150428316 17:65094845-65094867 TGGGAATGTGAAGGGAGCTGTGG + Intergenic
1150442456 17:65202567-65202589 TGGGACAGTGAGCGCAGCTTGGG + Intronic
1151880488 17:76891800-76891822 TTTGACAGACAAGGGAGCTGAGG + Intronic
1152250020 17:79207662-79207684 TAGAAAAGGGAAGGGAGCTTAGG - Intronic
1153322404 18:3786020-3786042 TTGGAGAGAGAAGGAAGCATTGG - Intronic
1154385660 18:13889627-13889649 TTGGAAAGTCCAGGGAGCATGGG + Intronic
1156490205 18:37491600-37491622 TGGGGCACTGAAGGGAGATTGGG + Intronic
1156494399 18:37516435-37516457 CTGGCCAGCAAAGGGAGCTTGGG + Intronic
1157623432 18:49029219-49029241 TTGGAAAGTGGAGTGAGCATTGG + Intergenic
1157637899 18:49179691-49179713 TTTTACAGAGAAGGGAGCTGAGG + Intronic
1157655802 18:49386682-49386704 TGGAACAGTGAAGGCAGATTAGG + Intronic
1158481843 18:57828879-57828901 TTTGACAGAGAAGGTAGCTCAGG - Intergenic
1159346555 18:67214211-67214233 TTGAAGACTGAAGGCAGCTTTGG - Intergenic
1166246361 19:41529837-41529859 TTGGACAGGGTAGGGAGCCTAGG + Intergenic
1167074188 19:47239185-47239207 TTGGACAGTGAGGGAAACTGAGG - Intergenic
1168105378 19:54162932-54162954 TTGGGCGGAGAGGGGAGCTTGGG - Intronic
1168426774 19:56245396-56245418 CTGGACAGTGCAGGGACCCTGGG - Exonic
925741095 2:7006701-7006723 ATGGACAGGGAAGGGAGGATGGG - Intronic
926502562 2:13674016-13674038 TTGGAATGTGAAAGCAGCTTTGG - Intergenic
927573838 2:24183909-24183931 TTATAAAGTGAAGGGAGCTCTGG - Intronic
928192080 2:29180312-29180334 GTGGACAGTGCAGGCAGCTCTGG + Intronic
928241845 2:29593204-29593226 TTGGTCTGTGAAGGGGCCTTGGG + Intronic
928759718 2:34567826-34567848 TGGGTCAGTGAAGGAAGCTGTGG - Intergenic
929047700 2:37806140-37806162 CTGGACAGTGGTGGGAGGTTTGG - Intergenic
930460837 2:51673488-51673510 TTGGAGGGTGAAGGAATCTTGGG - Intergenic
930704509 2:54490908-54490930 TTGAAGAGTGAAGGGAGCTGAGG + Intronic
933692670 2:85191427-85191449 TTGCATAGTGCAGGGAGCTGAGG - Intronic
936526539 2:113245423-113245445 TTGGACAGGGCAGGGAGCAAAGG - Intronic
937299681 2:120831617-120831639 GGGGCCTGTGAAGGGAGCTTTGG + Intronic
939034293 2:137112413-137112435 TTTGCCAGTGAATGGAACTTGGG + Intronic
942022813 2:171883737-171883759 GTGGTCAGTGAAGGGCCCTTAGG - Intronic
942182463 2:173393388-173393410 ATGGAGAGTGAAGTCAGCTTGGG + Intergenic
943562647 2:189482382-189482404 TTAGGCAGTGAAGGGATTTTTGG + Intergenic
944093679 2:195942867-195942889 TTGGAAGGTGATGGGAGTTTGGG - Intronic
944978733 2:205089558-205089580 ATGGACAGTGAAAGGAGCCAGGG - Intronic
946155951 2:217806701-217806723 ATGGTCAGTGATGGTAGCTTAGG - Intronic
947833364 2:233157826-233157848 CTGGACATTGAAGAGAGGTTGGG + Intronic
1173280608 20:41623652-41623674 TTGGACCATGAAGTGACCTTGGG - Intergenic
1173396013 20:42680521-42680543 TTGGAGACTGATGGGAGCTCTGG - Intronic
1174241057 20:49135006-49135028 CTGGACAGCGAAGGGAGCCCGGG + Intronic
1174378065 20:50139389-50139411 GTGGCCAGTAAAGGGACCTTTGG - Intronic
1174526152 20:51173111-51173133 TTGGACAATGAGGTGACCTTGGG - Intergenic
1175785112 20:61707355-61707377 TTGGACAGTAAAGGAAACCTGGG + Intronic
1178216542 21:30605487-30605509 TTGGACAGTGAAGGGAATGTTGG + Intergenic
1179210025 21:39316572-39316594 TTGGACAATGACCAGAGCTTGGG - Intronic
1182954566 22:34410148-34410170 TGAGACAGTGAAGGAATCTTCGG - Intergenic
1184416117 22:44352759-44352781 GAGGACAGTGAGGGGAGCTGTGG - Intergenic
951431975 3:22618769-22618791 TTTCACAGTGACGGCAGCTTGGG - Intergenic
953179842 3:40584813-40584835 TTGCGCAGTGAATGCAGCTTGGG + Intergenic
953214990 3:40909622-40909644 TTGGACTGGGAAGCCAGCTTGGG + Intergenic
953384654 3:42499699-42499721 TTGGACAGGGTGGGGAGATTGGG + Intronic
955253079 3:57304140-57304162 TTTGTCAGTGAAGGGAGATGGGG - Intronic
956198246 3:66675460-66675482 CTGGAAAGTGGAGAGAGCTTGGG - Intergenic
960874425 3:122282952-122282974 TTGGGCAGTGAAGGGAGCATGGG - Intronic
962569563 3:136699057-136699079 TTGGGCAGTGGAGGAAGGTTTGG + Intronic
962909691 3:139836641-139836663 TTGCAAAGGGAAGGGAGCTCTGG + Intergenic
963466728 3:145691184-145691206 TTGAACAGAGATGGGAGCTGGGG - Intergenic
963627934 3:147696576-147696598 TTGGACAGGATAGGGAGCTAGGG + Intergenic
967296125 3:187966794-187966816 TTTGACAATGAAAGCAGCTTTGG + Intergenic
968490874 4:889970-889992 TTGGACAGTGGAGGGCGGTGGGG - Intronic
972669919 4:41205327-41205349 TTTTACAGAGAAGGGAGCTATGG + Intronic
973027347 4:45289314-45289336 TTTATCAGTGAAAGGAGCTTTGG + Intergenic
976348135 4:84028918-84028940 TTGCACAGTGAAGGGAATATTGG - Intergenic
977663464 4:99617425-99617447 TTGGAAAGTGAAGAGAACTCAGG + Intronic
979095313 4:116541584-116541606 TCTGACAGTGGAAGGAGCTTTGG + Intergenic
982120408 4:152137715-152137737 TAGGACAGGAAAGGGAGATTTGG + Intergenic
983976662 4:173943123-173943145 TTGGACAGTGAATAGAACTTAGG - Intergenic
985805392 5:2039280-2039302 TCCCACAGTGCAGGGAGCTTAGG + Intergenic
986055893 5:4136231-4136253 TGGGACAGGGAAGGTGGCTTTGG - Intergenic
989158622 5:38368839-38368861 TTTGACAGAGAAGGGAACTAAGG - Intronic
989453902 5:41619930-41619952 CTGTACAGTGAAGGGAGTATGGG - Intergenic
990141715 5:52712213-52712235 TTTGGCAGTGGAGGGAGCTTTGG - Intergenic
990453514 5:55960514-55960536 TTGGACAGTGAATGAAGATCGGG + Exonic
995470466 5:112496460-112496482 TGGGACAGTGATTGGAGTTTGGG + Intergenic
996164387 5:120207003-120207025 GTGGACTGTGTAGGGACCTTAGG - Intergenic
998449129 5:142220823-142220845 CTGGGCAGTGTGGGGAGCTTGGG + Intergenic
998630419 5:143891999-143892021 TTGGAAAGTTAAGGGTTCTTTGG - Intergenic
999126425 5:149249619-149249641 CTGGACAGGGAAGGGAGATGGGG + Intronic
1000182024 5:158820927-158820949 TTGGACACTGAAGGGAGGAGAGG - Intronic
1002329676 5:178432901-178432923 TTGGTGGGTGAAGGGAGCTCTGG - Intronic
1004054247 6:12119234-12119256 TTGGAAAGGGAGGGGAGGTTTGG + Intronic
1004455529 6:15788313-15788335 GTGGACAGTGACGGGGGCTGGGG - Intergenic
1004471718 6:15935307-15935329 CTGGACAGTGAAGGGAGCCTGGG + Intergenic
1006679754 6:35788315-35788337 TTGGGGTGGGAAGGGAGCTTTGG - Intronic
1007176416 6:39900916-39900938 TTTGACAGTGGAGGAAGCTGAGG + Intronic
1008742905 6:54631399-54631421 GTGGAAAGTGAAGGGAGCACAGG - Intergenic
1012512331 6:100016992-100017014 TTGTACACTGGAGGGACCTTAGG - Intergenic
1012532123 6:100250711-100250733 TAGGAGAGTGAGGTGAGCTTGGG + Intergenic
1014754928 6:125292302-125292324 GCTGACAGTGAAGGGAGGTTAGG - Intronic
1016083074 6:139879030-139879052 TTGGAAAGTGAAGGAACCCTGGG + Intergenic
1016838406 6:148502583-148502605 TTGGACCGTGGAGGGAGATCAGG + Intronic
1022134454 7:27434352-27434374 TTTGACAGTGGAGGGAACTGAGG + Intergenic
1023990795 7:45127134-45127156 TTGGACAGGGAAGGGGCCCTGGG + Intergenic
1024515504 7:50250956-50250978 TTGGACACTGAATGGATTTTAGG - Intergenic
1027442759 7:78237980-78238002 TAGGACGGAGAAGGTAGCTTTGG - Intronic
1027480777 7:78693993-78694015 GGGGACAGTGAAAAGAGCTTTGG + Intronic
1030229640 7:107193977-107193999 TTAGACAGTGAAGTGAGAATGGG + Intronic
1030607626 7:111654697-111654719 TTGGATGGTGAAGGGAGGTGGGG + Intergenic
1033548116 7:142420944-142420966 ATGGACAGTGGAGGGTGCTGAGG + Intergenic
1034203968 7:149299714-149299736 CTGGAAAGTGCAGGGAGATTGGG + Intergenic
1034841893 7:154405682-154405704 GTGGACAGAGAAGGGAACCTGGG + Intronic
1034912617 7:155009668-155009690 ATGGAGAGTGAAGGGACCTGTGG - Intergenic
1036491277 8:9227949-9227971 GTGCACAGTTAAGGGAGCATAGG - Intergenic
1037948804 8:23005626-23005648 TGGTGCAGTGAAGGGAGCCTGGG + Intronic
1038442282 8:27579662-27579684 TTTCACAGAGAAGGGAACTTAGG - Intergenic
1042704297 8:71650354-71650376 TAGGACACAGAAAGGAGCTTGGG + Intergenic
1044611695 8:94098209-94098231 TTGGACAGTGGTGTCAGCTTTGG + Intergenic
1044653671 8:94525002-94525024 TGGGTCAGTGATGGGAGGTTGGG - Intronic
1044929961 8:97242471-97242493 TTGGACCATGAAGTGATCTTGGG + Intergenic
1045279590 8:100738402-100738424 TTGGATAGCAAAAGGAGCTTGGG + Intergenic
1045845975 8:106636751-106636773 TAGGATAGTGAAGGGAATTTTGG + Intronic
1047055779 8:121163715-121163737 CTGGACAGAGAAGGGAACTGAGG - Intergenic
1048006753 8:130425840-130425862 TTGGCCATTGTAGGGAGATTGGG - Intronic
1048573242 8:135671955-135671977 CTGGACCGTGAAGGGCGCTTGGG + Intergenic
1048712127 8:137224299-137224321 GTGGACAGTGGAGTGTGCTTAGG + Intergenic
1048788106 8:138073488-138073510 TTGGAGCCTGAAGGGAGCTTAGG + Intergenic
1048887040 8:138916935-138916957 TTGGCCAATGAAGGTAGCTTGGG - Intergenic
1050030457 9:1380280-1380302 TTGGAGAGTGAAGATAGCCTTGG - Intergenic
1057408605 9:94796226-94796248 TTGGACATGGAAGGGGGCATGGG - Intronic
1057746144 9:97752865-97752887 TTGCACAGAGGAGGGAGCTGAGG - Intergenic
1058453363 9:105117098-105117120 GGGGACAGTGCAGGGAGCTGTGG + Intergenic
1059096582 9:111422600-111422622 CTCTACAGTGAAAGGAGCTTTGG - Intronic
1060084718 9:120686753-120686775 TTGTACAGGGGAGGGAGCTGAGG - Intronic
1061800083 9:133108969-133108991 CTGGACAGCCAAGGGGGCTTGGG - Intronic
1186938068 X:14472991-14473013 TTGGACAGTGGAGCGAGGTAAGG + Intergenic
1188507515 X:30898568-30898590 TTGGACCATCAAGGGAGGTTTGG + Intronic
1189770020 X:44416495-44416517 TTGGGCCTTGAAGGGAGCATCGG - Intergenic
1190215525 X:48477212-48477234 GTGGACAGTGAGGGGAGAATGGG + Intronic
1193748223 X:85309908-85309930 TGAGACTGTGAAGGGAGCTTGGG + Intronic
1197710728 X:129665324-129665346 TTGGACAGTGAGGGGTGGATGGG - Intergenic
1197766122 X:130060435-130060457 CTGGAAAGTGAAGGGGGCTGGGG + Intergenic
1198784652 X:140273948-140273970 TTGGACTGGGAAGGGAGGTGAGG - Intergenic
1200313034 X:155099309-155099331 GTGGACCATGAAGGGACCTTAGG - Exonic
1202329018 Y:23725386-23725408 TTGGAGGTTGAAGGGAGCTGAGG + Intergenic
1202541753 Y:25944668-25944690 TTGGAGGTTGAAGGGAGCTGAGG - Intergenic