ID: 1106402028

View in Genome Browser
Species Human (GRCh38)
Location 13:29440644-29440666
Sequence CAGATGGTCGAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106402028_1106402032 -5 Left 1106402028 13:29440644-29440666 CCATCTTCCCTCTCGACCATCTG 0: 1
1: 0
2: 1
3: 26
4: 331
Right 1106402032 13:29440662-29440684 ATCTGTTATTCTCTTTCCCCAGG 0: 1
1: 0
2: 2
3: 30
4: 257
1106402028_1106402036 25 Left 1106402028 13:29440644-29440666 CCATCTTCCCTCTCGACCATCTG 0: 1
1: 0
2: 1
3: 26
4: 331
Right 1106402036 13:29440692-29440714 CAGCAAAGCTGAAATACACATGG 0: 1
1: 0
2: 3
3: 43
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106402028 Original CRISPR CAGATGGTCGAGAGGGAAGA TGG (reversed) Intronic
900563862 1:3322875-3322897 CAGAAGGTAGAAAGGTAAGAAGG - Intronic
900746151 1:4362060-4362082 CAGCTGGGGGAGAGGGGAGATGG + Intergenic
900830163 1:4959988-4960010 AAGGAGGTGGAGAGGGAAGAGGG + Intergenic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
902052658 1:13576671-13576693 GAGATGGGCGAGAGGCATGAAGG - Intergenic
902793265 1:18783624-18783646 CAAAGGGTGGAGAGGGAGGAGGG + Intergenic
903583466 1:24390071-24390093 CAGATGGCAGAGAGGGAATGAGG - Intronic
904322766 1:29707722-29707744 CAAATGGTGGGGAGGGGAGAAGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
905677417 1:39837384-39837406 AAGATGGTGGGGAGGAAAGATGG - Intergenic
907628643 1:56057544-56057566 AGGATGATCGAGATGGAAGAAGG + Intergenic
908926451 1:69260647-69260669 CAGAGGGTGGAGGGGGAAGGAGG + Intergenic
909379655 1:74984012-74984034 GAGGTAGTAGAGAGGGAAGATGG - Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909524384 1:76606561-76606583 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
909867425 1:80690964-80690986 CAGGTGGTTAGGAGGGAAGAAGG + Intergenic
910769461 1:90816388-90816410 GAGATGGTTGAGAAGGCAGAAGG - Intergenic
911132543 1:94404399-94404421 AAGATGGAAGAGAGGAAAGAAGG - Intergenic
912429673 1:109622435-109622457 CTCCTGGTCGAGAGGGGAGATGG + Intronic
913114667 1:115685126-115685148 CAGAGAGTGGAGAGGGAGGAAGG - Intronic
913437972 1:118866727-118866749 CAGATGGTGGGCAGAGAAGAAGG + Intergenic
915533302 1:156517074-156517096 CAGATGGTGGAGCTAGAAGATGG - Intergenic
915671413 1:157491893-157491915 CAGAAGGTCCAGGGGAAAGAAGG - Intergenic
916564195 1:165958862-165958884 AAGATGGATGAGAGGGAAGATGG + Intergenic
917986899 1:180329786-180329808 CAACTGGTAGAGAGGCAAGAAGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
920799683 1:209174403-209174425 CTGATGGTCGAGGGGCAAGTGGG + Intergenic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
921254889 1:213330168-213330190 CAGATGGATGGGAGGGGAGATGG - Intergenic
921431130 1:215067427-215067449 CTCATTGTCAAGAGGGAAGAGGG + Intronic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922609013 1:226910728-226910750 CAGGTGCTCAAGAGCGAAGATGG - Exonic
922956149 1:229602388-229602410 CAGATGGTAGTGAGGGAGGGAGG + Exonic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923247558 1:232147351-232147373 AAGAAGGGCGAGAGGAAAGAAGG + Intergenic
924517605 1:244779713-244779735 CAGATGAGAGAGAGGGGAGAGGG - Intergenic
1062953934 10:1527810-1527832 CAGATGGACGACAGGGGAGAGGG + Intronic
1064100325 10:12458065-12458087 CAGGTGGTGGAGAGTGAAGGTGG + Intronic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1069772545 10:70908781-70908803 CAGACGGTGGACTGGGAAGAGGG - Intergenic
1071919095 10:90329292-90329314 CAGATGGGTGAGAGGCAACATGG + Intergenic
1073288843 10:102403471-102403493 CAGATGGTGGGGTGGGCAGAAGG - Intronic
1073819739 10:107247882-107247904 AACATGCTCCAGAGGGAAGAAGG + Intergenic
1074300398 10:112227828-112227850 CAGACAGGCAAGAGGGAAGAGGG - Intergenic
1075102138 10:119513876-119513898 CAGATGGACAAGAGGGAATCTGG + Intronic
1075876560 10:125811382-125811404 GAGATGTGCGGGAGGGAAGATGG + Intronic
1077248736 11:1551404-1551426 CAGATGGACGAATGGGTAGAGGG - Intergenic
1077988397 11:7378557-7378579 CAGTTGATGGAGATGGAAGAGGG + Intronic
1079383621 11:19959861-19959883 CAGATGGTGGGGGGGGAAGAAGG - Intronic
1080109144 11:28546114-28546136 AAGAAGGACGAGAGAGAAGAGGG + Intergenic
1080425340 11:32149453-32149475 GGGGTGGTGGAGAGGGAAGACGG - Intergenic
1080474680 11:32579055-32579077 CATGTGGTGGAGAGGAAAGACGG - Intergenic
1080892370 11:36420091-36420113 CATATGGTGGAGAGGGAATGGGG + Intronic
1083330536 11:61896388-61896410 CAGATGGAAGAGAGGAAAGCAGG - Intergenic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1084028881 11:66469123-66469145 CAGATGGGGGAGGAGGAAGAGGG - Intronic
1084406203 11:68975053-68975075 CAGATTGAAGACAGGGAAGAGGG + Intergenic
1084412293 11:69011909-69011931 CAGATGGTAGAGAGGGGAGCTGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1085143530 11:74171454-74171476 GAGGTGGGCGAGAGGGAAGGCGG - Exonic
1085389242 11:76174060-76174082 TAGCTGGTAGAGAGGGAAGAGGG + Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090068765 11:123525943-123525965 CAGCTGGGAGAGGGGGAAGAAGG + Exonic
1090114024 11:123947160-123947182 CAAATGGTCCAGATGGATGAAGG - Intergenic
1090204083 11:124875359-124875381 TGGATGGACAAGAGGGAAGAAGG + Intronic
1090377166 11:126298948-126298970 CCGTTGTTCCAGAGGGAAGAAGG - Intronic
1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG + Intergenic
1091418959 12:318041-318063 CAGAAGGTAGAGTGGGAAGAAGG - Intronic
1091831183 12:3552254-3552276 CAGGTGGTAAAGAGAGAAGAGGG + Intronic
1092019207 12:5186467-5186489 CACATAGAGGAGAGGGAAGAAGG - Intergenic
1092229699 12:6769712-6769734 GAGATGATTGGGAGGGAAGATGG - Intronic
1097914738 12:65008844-65008866 CAGATGGTGGAAATGGAAGCTGG - Intergenic
1102657819 12:114497761-114497783 GAGAAGCTTGAGAGGGAAGAGGG - Intergenic
1102895637 12:116595923-116595945 TAGATGGCTGAGAGGGTAGATGG + Intergenic
1102896028 12:116599347-116599369 CCGATGGTGGAGACGGAACAGGG + Intergenic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1105308478 13:19185719-19185741 CACATGGTGGAGAGAGAAGGGGG - Intronic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106999356 13:35525843-35525865 CACATGGTGGAAGGGGAAGAGGG + Intronic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1110560127 13:76902288-76902310 CTGATGGTCAAGAGGAAAGCGGG + Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1115196306 14:30803741-30803763 CAGATGGTCAAGAGAGAATATGG + Intergenic
1115465069 14:33706262-33706284 CAAGTGGTGGAGAGGGAGGATGG + Intronic
1115754791 14:36519904-36519926 GAGATGGTTGAGAGGAAGGAAGG + Intronic
1115930950 14:38493918-38493940 CAGATGTTGGAAAGGGAAGGGGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119625927 14:76175371-76175393 GAGATGGGGGAGGGGGAAGAAGG - Intronic
1120270378 14:82306366-82306388 CAGATGATCCTGAGGAAAGATGG - Intergenic
1120648558 14:87102703-87102725 AAGAAGGGCAAGAGGGAAGAGGG - Intergenic
1120750639 14:88194618-88194640 GAGATGGGCAGGAGGGAAGATGG + Intronic
1121047072 14:90796110-90796132 CAGCTGGTTGGGAGGGAAGCTGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121492271 14:94369089-94369111 CAGGTAGGAGAGAGGGAAGAGGG + Intergenic
1122631361 14:103109145-103109167 CAGGTGGTGGAGAGGGAGGGAGG - Intronic
1124602938 15:31149834-31149856 CAGAATGTCAAGATGGAAGAGGG - Intronic
1126148891 15:45504034-45504056 CAAATGGTCTGGAGTGAAGAAGG - Intronic
1127458180 15:59173927-59173949 AAGAGGGTCAAGATGGAAGAAGG + Intronic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1130693390 15:86105570-86105592 TAAATGGTTGAGAAGGAAGAAGG + Intergenic
1130957848 15:88639654-88639676 CAGATGGGCACCAGGGAAGAGGG - Intronic
1131960227 15:97782433-97782455 CTTGTGGTCGAGAGGCAAGAAGG - Intergenic
1132183420 15:99780429-99780451 GAGATGGAGGAGAGGGAGGAGGG + Intergenic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1132333446 15:101027935-101027957 AAGAAGGGTGAGAGGGAAGAAGG - Intronic
1132435015 15:101793052-101793074 GAGATGGAGGAGAGGGAGGAGGG - Intergenic
1134244719 16:12531441-12531463 CAGATGGCCAAGAGGAAAGGGGG + Intronic
1134258884 16:12634550-12634572 AAGATGGGAAAGAGGGAAGAGGG + Intergenic
1134346217 16:13394129-13394151 CAGATGGTAGAAATGCAAGAAGG - Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1136779573 16:32887716-32887738 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1136891043 16:33973802-33973824 CAGAGGCTCGAGAGGGATGTAGG - Intergenic
1137598758 16:49742324-49742346 CAGATGAGAGGGAGGGAAGAGGG + Intronic
1137800970 16:51261947-51261969 AAGAAGGGAGAGAGGGAAGAAGG - Intergenic
1139266355 16:65642879-65642901 CAGATGGTTTAGGGGGCAGATGG - Intergenic
1141186113 16:81788807-81788829 CAAACAGTCAAGAGGGAAGATGG - Intronic
1141430264 16:83967677-83967699 CAGATGGGCGGGCGGGCAGATGG + Intergenic
1141650140 16:85388441-85388463 CAGATGGATGAGTGGGTAGATGG + Intergenic
1141650168 16:85388549-85388571 CAGATGGATGAGTGGGTAGATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141877295 16:86834634-86834656 CAGATGGTGGAGAGGGCTGCAGG - Intergenic
1141884041 16:86879585-86879607 GAGATGGACGTGAGGGAAGCAGG - Intergenic
1142031937 16:87842876-87842898 CAGATGGGAGAGAGGCCAGAGGG - Intronic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1203081989 16_KI270728v1_random:1149804-1149826 CAGAGGCTCGAGAGGGATGTAGG + Intergenic
1144620784 17:16817255-16817277 CAGATGGTCCATGGGGAAGTTGG - Intergenic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1146432926 17:32815569-32815591 CAAATCTACGAGAGGGAAGAGGG - Intronic
1147036455 17:37685181-37685203 TAGATGGAAGAGAGGGAGGATGG - Intergenic
1147263936 17:39224165-39224187 GGGATGGTCAAGATGGAAGAAGG + Intronic
1147572173 17:41578158-41578180 CAGATGGTCCATGGGGAAGTTGG - Intergenic
1148331192 17:46814876-46814898 CAGGTGCTCGAGTGGGAGGATGG + Intronic
1148894285 17:50831098-50831120 CAGATGGTGGAGACGGATGGGGG - Intergenic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149062081 17:52434437-52434459 CATATGGTGGAAAGGGCAGAAGG - Intergenic
1151052643 17:70995874-70995896 GAGAAGATGGAGAGGGAAGATGG - Intergenic
1151192684 17:72410044-72410066 CAGATGGTCTAACAGGAAGATGG + Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1152269425 17:79315404-79315426 CAGATGGTGGTGTGAGAAGAGGG - Intronic
1153712867 18:7817966-7817988 CAGATGGTACACAGGGAAGGTGG + Intronic
1156569205 18:38233500-38233522 CGGGTGGTCCAGAGAGAAGATGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159210812 18:65318938-65318960 CATAGGGTAGATAGGGAAGATGG - Intergenic
1160005208 18:75064031-75064053 CAGGTGGTGGTGAGCGAAGAGGG + Exonic
1161994395 19:7703624-7703646 CACCTGGTCCAGGGGGAAGAGGG - Intergenic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1163002673 19:14378404-14378426 CAGATTGTTGCAAGGGAAGAAGG + Intergenic
1163064121 19:14780688-14780710 CAGATGGTTGCTAGGGAAGAAGG - Intergenic
1164559667 19:29281411-29281433 CAGATGATCAATAGAGAAGATGG - Intergenic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
926001856 2:9339733-9339755 CAGATAGTGAAGAAGGAAGAGGG - Intronic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926411232 2:12604784-12604806 CAGATGGAAGTGTGGGAAGAGGG + Intergenic
927319733 2:21729215-21729237 AAGATGGACTAGAAGGAAGAAGG - Intergenic
927352491 2:22133754-22133776 CAAATGATAGAGAGGGAGGAGGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928388002 2:30885790-30885812 CTGATGGTGAAGAGGGAAGTTGG + Intergenic
930494793 2:52127493-52127515 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
930578092 2:53176953-53176975 CAGAAGGTAGAAAGGCAAGAGGG - Intergenic
931701696 2:64914272-64914294 CAGGTGGGAGAGAAGGAAGAAGG - Intergenic
932451409 2:71813000-71813022 CAGGTGGGCCAGAGGGAGGAGGG - Intergenic
932797501 2:74709759-74709781 CAGAAGGTGGAAAGGTAAGAGGG + Intergenic
933427816 2:82135494-82135516 AAGATGGAAGAGAGGGAACAGGG - Intergenic
934108818 2:88722886-88722908 CAGATGGCAAAGGGGGAAGAAGG + Intronic
934810617 2:97273477-97273499 CAGATCATTGAGAGGGAACATGG + Intergenic
934827075 2:97434462-97434484 CAGATCATTGAGAGGGAACATGG - Intergenic
937010144 2:118555542-118555564 CAGGTGGGCAAGAGGAAAGAAGG + Intergenic
937239392 2:120450592-120450614 CAGGTGGGAGGGAGGGAAGATGG - Intergenic
937536099 2:122889531-122889553 CAGAGGGGCGAGAGGGGAAATGG - Intergenic
939748128 2:146003698-146003720 CAGACGGTCCCCAGGGAAGAAGG + Intergenic
942538420 2:176989979-176990001 CAGATGGTCTATAAGGCAGATGG + Intergenic
944537434 2:200725086-200725108 CAGAGGGTCCAGCAGGAAGAGGG + Intergenic
947625481 2:231615656-231615678 AAGAGGGTCGAGAGGGGAGGCGG - Intergenic
948326237 2:237123974-237123996 CAGATGGTGGAAGGGAAAGAGGG - Intergenic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
1169964601 20:11201783-11201805 CAGAAGGTCAAGAGGCAAAAAGG + Intergenic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1173580582 20:44143969-44143991 CAGAGGCTCGAGAGGCAAGGAGG + Intronic
1173810294 20:45951263-45951285 CAGAGGTTGGAGAGGGAAGCAGG - Intronic
1175487488 20:59356063-59356085 CAGATGGGAGAGAGGGGAGAGGG - Intergenic
1175692515 20:61075806-61075828 CACATGGTGAAGGGGGAAGAAGG + Intergenic
1176097469 20:63350892-63350914 CTGCTGGTCGAAGGGGAAGAAGG + Exonic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176242581 20:64081898-64081920 CAGACAGGCAAGAGGGAAGAGGG - Intronic
1177718819 21:24877779-24877801 CAGAAAGTAGAGAGGCAAGAAGG + Intergenic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179520951 21:41944183-41944205 CAGAAGGTAGCAAGGGAAGAGGG - Intronic
1179874095 21:44258821-44258843 CAGGTGGTGGACTGGGAAGAGGG + Intronic
1179884750 21:44309087-44309109 CAGAGGGTCGAGAGGCAGAAGGG + Intronic
1182948452 22:34347934-34347956 AACAGGGTGGAGAGGGAAGAGGG + Intergenic
1183109230 22:35636825-35636847 CAGCTGGGAGGGAGGGAAGAGGG - Intronic
1184232811 22:43167740-43167762 CAGATGGTGGTGAGGGGTGAGGG + Exonic
1184488403 22:44795474-44795496 CAGCTGGCCCAGAGGGTAGAGGG - Intronic
1184534484 22:45077367-45077389 CAGATGGCTGTGAGGGGAGAGGG - Intergenic
949797261 3:7864512-7864534 AAGAAGGTAGAGAGGGAACAGGG - Intergenic
950584707 3:13883908-13883930 CAGATGGTGGGGAGAGAAGGGGG + Intergenic
950883658 3:16344490-16344512 TAGTTGGGCGAGGGGGAAGAAGG - Intronic
951047578 3:18057692-18057714 CAAATGGGCAACAGGGAAGATGG + Intronic
952228696 3:31406255-31406277 TAGATGGTGGAGAGGGGAGGTGG + Intergenic
952279383 3:31908509-31908531 CAGCTGATCTAGAGGCAAGATGG + Intronic
952894525 3:38068976-38068998 CAGATATGGGAGAGGGAAGAGGG + Intronic
953154837 3:40360315-40360337 CAGATGTTGGGGATGGAAGAGGG + Intergenic
953410111 3:42686022-42686044 CAGGAGGCCGAGACGGAAGACGG - Exonic
953856013 3:46499561-46499583 CAGGAGGTAGAGAGAGAAGAAGG - Intronic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
954587847 3:51752193-51752215 CAGATGGCAAAGGGGGAAGAAGG + Intergenic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955123714 3:56088152-56088174 CAGATGGTGGAGATACAAGATGG + Intronic
955867324 3:63398838-63398860 CAGATGGTGAACTGGGAAGAAGG + Intronic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959521753 3:107329214-107329236 GATCTGGTGGAGAGGGAAGAAGG + Intergenic
960452935 3:117832435-117832457 CAGCTGGTGGAGAGGAAGGATGG - Intergenic
964577415 3:158188480-158188502 CAGATGATAGAGCAGGAAGAGGG - Intronic
964719054 3:159753757-159753779 CTGATGGTGGAGAGTGAGGAGGG - Intronic
965545980 3:169916817-169916839 TAAATGGTCTAGAGGGAAGAAGG + Intronic
966419764 3:179726088-179726110 CAGATGGTAGGGAGTGAGGAAGG + Intronic
966960939 3:184938058-184938080 CAAATGGAGGAGAGAGAAGAAGG + Intronic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
968442848 4:633307-633329 AAGATGGTGGAGCAGGAAGACGG - Intronic
969373238 4:6747280-6747302 GAGAGAGGCGAGAGGGAAGAAGG - Intergenic
972576632 4:40357931-40357953 CAAATGGAGGAGAGGAAAGATGG - Intergenic
978066395 4:104408448-104408470 TGGATGGCAGAGAGGGAAGAAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
979531302 4:121771645-121771667 AAGATGGTCGAGAGGAGAGAAGG + Intergenic
982078626 4:151764448-151764470 CACATGGTAGAGACGGAAGATGG + Intergenic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982326885 4:154137335-154137357 CAGGTGGTGGAGAGGGTTGAAGG - Intergenic
983392011 4:167143921-167143943 CAGATGGGTGAGAGAGCAGAGGG + Intronic
983703297 4:170625099-170625121 CTGATGGCCGAGATGGCAGAGGG - Intergenic
985204081 4:187514793-187514815 CAGATGGTCAAAATGGAAGAAGG - Intergenic
986371795 5:7087655-7087677 CAGTTGGTGGAAAGGGGAGATGG + Intergenic
986564617 5:9099896-9099918 CAGAGTGTCGAGAGTGAAGCTGG - Intronic
986907661 5:12515127-12515149 GAGATGGTGGAGGGAGAAGAAGG - Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988031082 5:25763221-25763243 CAGGTGGTGAAGAGGGAAGGAGG + Intergenic
988294141 5:29333020-29333042 CAGAGGGTGGAGGGGGAGGAAGG - Intergenic
988492737 5:31718309-31718331 CAGATGGGCCTGGGGGAAGAAGG + Intronic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
991017408 5:61946557-61946579 CAGAACTTGGAGAGGGAAGATGG + Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
996483383 5:124001225-124001247 CAGAGGGTCGGGAGGGGAGCTGG + Intergenic
996578495 5:125002992-125003014 CAGAATGTCAAGAGAGAAGAGGG + Intergenic
996695778 5:126393187-126393209 GAGATGGTCGTGATGGAAAAGGG - Intronic
997142480 5:131397524-131397546 CAGATTGAAAAGAGGGAAGAAGG - Intronic
998730854 5:145075337-145075359 CAGATGATTGAGGGGGAAAAAGG - Intergenic
999587685 5:153109012-153109034 TAGATGGTGGAGATGGTAGAAGG - Intergenic
1000469742 5:161626685-161626707 GAGATGGTAGAGTGGGAAGTGGG - Intronic
1001045170 5:168365854-168365876 CAGATGCTGGAGGGGCAAGAAGG - Intronic
1001432117 5:171670596-171670618 AGGATGCTAGAGAGGGAAGAAGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001573096 5:172743682-172743704 CAGGTGGTCCAGAGGAAGGAGGG + Intergenic
1001811154 5:174629282-174629304 CAGGTGGTCCACAGGGAACAAGG + Intergenic
1003612066 6:7622676-7622698 CAGATGCTAGAGCTGGAAGAAGG + Intergenic
1003696845 6:8415575-8415597 CACATAGTCAAGTGGGAAGATGG - Intronic
1004605671 6:17192979-17193001 CACATGGTGAAGAGGTAAGAGGG + Intergenic
1005206222 6:23408267-23408289 CAGAAGGTTGAGGGGAAAGAGGG + Intergenic
1006206028 6:32343816-32343838 AAAATGTTGGAGAGGGAAGATGG - Intronic
1010899468 6:81408409-81408431 CAGATGATGGAAATGGAAGAAGG - Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011939620 6:92826615-92826637 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1013291337 6:108721283-108721305 AAGATGATTGAGAGGGAGGATGG - Intergenic
1013655527 6:112242923-112242945 CAGAGGGTCCAGAGAGGAGAAGG - Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1016586248 6:145689966-145689988 CTGATGGTCGGGTGGGAAGGAGG - Intronic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1018278041 6:162153827-162153849 CAGCTGGTAGAGAGGGGAAATGG - Intronic
1018737380 6:166697588-166697610 AAGATGGTAGAGCGAGAAGATGG + Intronic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1020009029 7:4798584-4798606 CAGCTGGTGGAGAGGGACGCTGG + Intronic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1022228379 7:28387630-28387652 CAGAGGGTGGAGGGGGAGGAGGG + Intronic
1024250656 7:47503372-47503394 CAGATGTTGGGGAGGGGAGAAGG - Intronic
1024416255 7:49110611-49110633 CAGAAGGTGGAGAGGGTATAGGG + Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1031079387 7:117243399-117243421 CATATGTTCCAGAGGGGAGAGGG - Intergenic
1031593507 7:123621687-123621709 CAGATGGCTGATAGGGAATAAGG - Intronic
1031869686 7:127078247-127078269 CAGATGGAGGAGTGGAAAGAGGG - Intronic
1031959424 7:127975583-127975605 GATATGGTGGAGAGGGAACAAGG + Intronic
1032090545 7:128909594-128909616 GAGATGGTGGAGAGAGGAGAAGG - Intronic
1032117238 7:129127358-129127380 CCCGTGGTCGACAGGGAAGAAGG + Intergenic
1032341502 7:131078238-131078260 CAGATGGAGGAGAGGGAAATGGG + Intergenic
1032770204 7:135045292-135045314 CAGATGGTGGAAAAGGAACAAGG + Intronic
1033321429 7:140343258-140343280 CAGCTGGTCCTGAGGGGAGACGG + Intronic
1034345244 7:150381844-150381866 AAGATGGTGGAGTAGGAAGAGGG + Intronic
1034422311 7:150996261-150996283 GGGATGGGGGAGAGGGAAGAAGG - Intronic
1034954223 7:155324077-155324099 CAGATGCTTGAGAGTGAAGGGGG - Intergenic
1035386258 7:158475024-158475046 CAGATGCTGGCGAGGGAGGAAGG + Intronic
1035931702 8:3786792-3786814 CAGGTGGTAGAGAGAGAAGAAGG + Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1038235286 8:25746862-25746884 TAGATGGAGGAGAGGGGAGAGGG - Intergenic
1038425946 8:27463858-27463880 CTGCTGGTCGAAGGGGAAGAAGG + Exonic
1040080641 8:43281199-43281221 CAGAAGGTGGAGCGGGAAGCGGG - Intergenic
1040817764 8:51526979-51527001 CAGATGGCTGAGTGGGAAGGAGG - Intronic
1042710581 8:71712906-71712928 CAGATGGTTGGGAAAGAAGAAGG + Intergenic
1045981014 8:108187344-108187366 CAGGTGGTCAGAAGGGAAGATGG - Intergenic
1048252314 8:132876947-132876969 CAGATTGCCCAGTGGGAAGAAGG + Intronic
1048612871 8:136042694-136042716 CAGGTGGTAGAGATTGAAGATGG + Intergenic
1048858138 8:138701158-138701180 TGCATGGTGGAGAGGGAAGAGGG - Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049396749 8:142404460-142404482 CACATGGGTGGGAGGGAAGAGGG + Intergenic
1049702148 8:144020193-144020215 GAGATGGTCCTGAGGGAAGAGGG - Intronic
1049702228 8:144020528-144020550 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702323 8:144020882-144020904 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702328 8:144020898-144020920 GAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049702600 8:144021942-144021964 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702752 8:144022563-144022585 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703118 8:144023950-144023972 TAGAAGGTCCTGAGGGAAGAGGG - Intronic
1049703335 8:144024715-144024737 AAGAGGGTCGTCAGGGAAGAGGG - Intronic
1049703366 8:144024816-144024838 AAGAGGGTCCTGAGGGAAGAGGG - Intronic
1050132761 9:2429602-2429624 TAGATGGTAGAGGGGCAAGAAGG + Intergenic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050621125 9:7453058-7453080 AAGATGGTTGAGAGGGAAAAGGG - Intergenic
1050866756 9:10510276-10510298 CAGATTGTCGAGGGGGTACATGG - Intronic
1052031516 9:23634761-23634783 CAGAAGGTAGCAAGGGAAGAGGG + Intergenic
1053034845 9:34816157-34816179 CAGAAGTTCCAGTGGGAAGATGG - Intergenic
1054925496 9:70584829-70584851 CACATGGCAGAGAGGGAACAGGG - Intronic
1057787159 9:98095892-98095914 CAGAGAGTCGGGATGGAAGATGG - Intronic
1057980880 9:99661996-99662018 CAGATGGTAGAAATGGAGGAAGG + Intergenic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1059705390 9:116818335-116818357 GAGATGGTCCAGAGAGAAGTGGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1203772478 EBV:56580-56602 CAGCTGGCCGAGAGCGACGATGG - Intergenic
1185624933 X:1474677-1474699 CAGATGGATGAGTGGGAGGATGG + Intronic
1185624994 X:1474975-1474997 CAGATGGATGAGTGGGAGGATGG + Intronic
1186087435 X:6005607-6005629 CAGAGGGTTGAGAGACAAGAGGG - Intronic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187503524 X:19859785-19859807 CAGATGGTTGAGAGGCCAGGAGG - Intronic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190296615 X:49031362-49031384 GAGATGGTGGTGGGGGAAGAGGG - Intronic
1190732073 X:53233060-53233082 CCCATGGTGGAGAGGGGAGAGGG + Exonic
1190756450 X:53405774-53405796 CAGGTAGTCAAGAGGCAAGAAGG + Exonic
1192156013 X:68747127-68747149 GAGAGAGTCGAGAGGGAAGCAGG + Intergenic
1195653318 X:107310066-107310088 CAAATGGGAGGGAGGGAAGAAGG - Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1198361961 X:135904280-135904302 CATAGTGTCGTGAGGGAAGAAGG + Intronic
1199545072 X:148999887-148999909 AAGATGCATGAGAGGGAAGATGG + Exonic
1199550654 X:149057497-149057519 AGGATGGTGGAGAGGGAGGAAGG + Intergenic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1199963757 X:152801076-152801098 CAGATGGTGGGGAGGGAGGGAGG - Intergenic