ID: 1106402442

View in Genome Browser
Species Human (GRCh38)
Location 13:29443323-29443345
Sequence CTGTGTCCCCTGATGCAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106402434_1106402442 5 Left 1106402434 13:29443295-29443317 CCATGGGCAAGCTTTGGCTCTGG 0: 1
1: 0
2: 2
3: 21
4: 235
Right 1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1106402432_1106402442 7 Left 1106402432 13:29443293-29443315 CCCCATGGGCAAGCTTTGGCTCT 0: 1
1: 0
2: 0
3: 11
4: 163
Right 1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1106402433_1106402442 6 Left 1106402433 13:29443294-29443316 CCCATGGGCAAGCTTTGGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 171
Right 1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1106402427_1106402442 28 Left 1106402427 13:29443272-29443294 CCCTAGAGAGACTTCTGCACTCC 0: 1
1: 0
2: 0
3: 9
4: 177
Right 1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1106402428_1106402442 27 Left 1106402428 13:29443273-29443295 CCTAGAGAGACTTCTGCACTCCC 0: 1
1: 0
2: 1
3: 24
4: 208
Right 1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG 0: 1
1: 0
2: 1
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106402442 Original CRISPR CTGTGTCCCCTGATGCAATT GGG Intronic
901269392 1:7939984-7940006 CTGTTTCCCATGATGAAATCTGG + Exonic
903325714 1:22567495-22567517 CTGTGTCCCCTGATCCCAAGTGG + Intronic
909050426 1:70761046-70761068 CTGTGTACTCTGATGCTTTTGGG + Intergenic
909540500 1:76786355-76786377 CAGTGTCCTATGATGTAATTTGG - Intergenic
909684601 1:78333183-78333205 CAGTGTCCCTGGATCCAATTTGG + Intronic
910228492 1:84962174-84962196 CTGTTTCCCCTAATAAAATTGGG - Intronic
924721840 1:246630566-246630588 CTGTTTCCCCTGAGGGATTTGGG + Intronic
1064434155 10:15296143-15296165 CTGTGTAATCTGATGAAATTAGG + Intronic
1064535118 10:16350338-16350360 CTCTGTCCACTGAGGCAACTAGG + Intergenic
1069551299 10:69366363-69366385 CTGGGTCCCTTTATGCCATTAGG + Intronic
1071117577 10:82240521-82240543 CTTTTTCCCCTAATGGAATTAGG - Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1073568482 10:104556042-104556064 GTTTGTCCCCTGCTGCCATTGGG + Intergenic
1075589522 10:123681195-123681217 CTGAGTCACTTGATGGAATTGGG - Intronic
1075735172 10:124660212-124660234 CTCTGTCTCCTGAAGCATTTTGG - Intronic
1076063607 10:127431241-127431263 TTGTTTCATCTGATGCAATTAGG - Intronic
1077352811 11:2100694-2100716 CTGGGTTCCCTGATGCAACCAGG + Intergenic
1079369870 11:19842283-19842305 GTGTGTCCCTTGATCTAATTTGG + Intronic
1079495447 11:21038149-21038171 CTTTGTGCCCTGATGCAGCTGGG - Intronic
1080251770 11:30241631-30241653 CTGTTTCCCCAGATGCATTAAGG - Intergenic
1081288406 11:41301723-41301745 CTCTCTCCTCTGATGAAATTGGG - Intronic
1084603186 11:70158720-70158742 CAGTGTCCCCTCATGCTCTTAGG + Intronic
1087377343 11:97361068-97361090 CTGTGTCCCAAGGTCCAATTTGG - Intergenic
1087850931 11:103028502-103028524 CTGAGAACACTGATGCAATTAGG + Intergenic
1093022139 12:14213695-14213717 CTGGGTCCCCTGATACACATTGG - Intergenic
1097204668 12:57310264-57310286 CTGTGTCTCCTGACGCAAACTGG + Exonic
1098798314 12:74922149-74922171 CTGGGTCCTCTGGTGCCATTGGG - Intergenic
1101737285 12:107472493-107472515 CTGTGTGACCTTAGGCAATTTGG + Intronic
1102606234 12:114069641-114069663 CTGAGTCCACTGATGTAGTTGGG - Intergenic
1105225594 13:18428649-18428671 GTGGGTCCCTTGATGCAGTTGGG - Intergenic
1105836568 13:24217329-24217351 CTGTGGCCACTGATGCTATTAGG - Intronic
1106356283 13:28986552-28986574 CCGTGTCCCCTGATGAATTTTGG + Intronic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1108064713 13:46565372-46565394 CTGTTTCCCCCCATGCAATATGG - Intronic
1109600886 13:64627250-64627272 TTGTGTCCCCTGATATAGTTTGG + Intergenic
1109667162 13:65553904-65553926 CTGTTGCCCCTGAAGCAGTTGGG + Intergenic
1110333085 13:74294999-74295021 CTCTGTCCCCTGACAAAATTGGG + Intergenic
1113423337 13:110186902-110186924 CAGTGTCTTCTGATGCATTTGGG - Intronic
1113817045 13:113179617-113179639 CTGTGTGCTCTGATGAAATGTGG + Intronic
1117292842 14:54350231-54350253 CTCTGTTCCCTGATGCAGTGTGG + Intergenic
1117561581 14:56945614-56945636 CTTTGTCCTCTGATGCATCTTGG + Intergenic
1119484879 14:74980795-74980817 CTGTGTGCGCTGATGGGATTAGG - Intergenic
1121963113 14:98279289-98279311 CTTTCTCCCCTGATGCATTTAGG + Intergenic
1124851693 15:33345709-33345731 CTGTGTAGCCTGATGCAATGAGG - Intronic
1125395101 15:39238579-39238601 CTGGGTTTCCTGATGCCATTTGG - Intergenic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127578303 15:60313824-60313846 CTTTGTCTCCTGATGCTAGTGGG - Intergenic
1127600123 15:60527296-60527318 CTGTATCTCATGATGAAATTAGG + Intronic
1130549163 15:84878810-84878832 CTGTGTCCCCTGAGGCCCTTTGG - Intergenic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1138878241 16:60979232-60979254 CTGGGTCCCCAGCTGCAGTTTGG - Intergenic
1140624300 16:76772863-76772885 CTGACTCCCCTGATGAAAGTTGG + Intergenic
1144052008 17:11504896-11504918 CTGTGTCCCAAGAGGCAACTGGG + Intronic
1144654071 17:17024546-17024568 CTGTGGCTACTGATGCCATTTGG + Intergenic
1147125130 17:38362301-38362323 CTGTGTTCCCTGCTGCAAGAGGG - Intronic
1148068430 17:44890920-44890942 ATGTGTCCCTTTATGCAATGTGG - Intronic
1148840764 17:50495401-50495423 CTGTGTCCCCCGAAGCCAGTTGG + Intergenic
1150579624 17:66460521-66460543 CTGTCTGCACTGCTGCAATTCGG - Intronic
1151913014 17:77096679-77096701 CTGTGTTCTCTGATGTAACTTGG + Intronic
1154527784 18:15310873-15310895 GTGGGTCCCTTGATGCAGTTGGG + Intergenic
1156826407 18:41434916-41434938 CTTTGCCCACTGATGCAGTTTGG + Intergenic
1162436495 19:10663128-10663150 GTGTGTCCTCTGAGGCATTTTGG + Intronic
1163621549 19:18363796-18363818 CTGTGTCCCCAGATGCAGGGAGG - Exonic
1164803297 19:31095947-31095969 CTTTGTCCTCAGATGCTATTGGG - Intergenic
1168507762 19:56950773-56950795 CTGTGTCTCCTGATTCACTATGG + Intergenic
929153376 2:38768448-38768470 CTGTGTCCCTTGATACCACTTGG - Intronic
931908294 2:66866866-66866888 CTGTGTTCCCTGATGGAGTGGGG + Intergenic
932222814 2:70012583-70012605 CTGTGACTCCTGGTGCAGTTTGG - Intergenic
933389615 2:81653374-81653396 GTGGGTCCCCTGATGTAGTTGGG + Intergenic
934051117 2:88211845-88211867 CTGTCTCTCCAGATGCAATTGGG - Intergenic
934777156 2:96946778-96946800 CTGTAGCCCCCGATGCACTTTGG - Intronic
936074940 2:109395767-109395789 CTGTGTCTCCTGATGAGAATAGG + Intronic
940906485 2:159174409-159174431 CAGTGTCCCTTGATGCAGTGTGG + Intronic
943140169 2:183972464-183972486 CTGTGCAACCTGATGTAATTTGG - Intergenic
943663762 2:190587363-190587385 CTGTGCCACCTGTTGGAATTGGG + Intergenic
944599429 2:201288300-201288322 CTTTGTCCCCTGGGGCATTTAGG - Intronic
947618234 2:231572164-231572186 CTTTGACCCCTTATGCAAATAGG - Intergenic
947880750 2:233509152-233509174 CTCTGTCCCCTGATACAGGTTGG - Intronic
948150235 2:235739135-235739157 CAGTGTCCCCAGATGCAAAGGGG - Intronic
1168824041 20:797044-797066 ATGGGTCCCCTGATGTAGTTGGG - Intergenic
1169308918 20:4518817-4518839 CTGTGACCCCAGATGCAAAAAGG - Intergenic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1172773640 20:37395412-37395434 CCTTGTTCCCTGATGCCATTTGG + Intronic
1173072493 20:39782497-39782519 ATGTGTTCCCTTATGAAATTGGG - Intergenic
1174405757 20:50302298-50302320 CTGTGTTCCCTGATGGACTGCGG - Intergenic
1176095942 20:63344672-63344694 CTGGGTCCACTTATGCAATGTGG + Exonic
1176769648 21:13057672-13057694 GTGGGTCCCTTGATGCAGTTGGG - Intergenic
1179437574 21:41373024-41373046 CTGTCTCCCCAGCTGCAATAAGG - Intronic
1180516752 22:16151616-16151638 GTGGGTCCCTTGATGCAGTTGGG - Intergenic
1184064491 22:42109666-42109688 GTGTGTCCCTTGATGCAGGTGGG + Intergenic
950298463 3:11852572-11852594 CTGTGTGACCTGGTGCAAGTTGG + Intergenic
950846294 3:16019053-16019075 GTGGGTCCCCTGATGTAGTTGGG + Intergenic
955061170 3:55492528-55492550 CTGGGTCCCCTGGTGGAATCTGG + Intergenic
956871081 3:73418783-73418805 CTGTGTCCCCTGTTGGACCTGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961006631 3:123410033-123410055 CTGTGTTCCCTGAGGCAGTGTGG + Intronic
964443690 3:156738512-156738534 CTGTGTCCCCTGCAGTAATGGGG + Intergenic
964465441 3:156986569-156986591 CTGTCTACCCTGATGCAAAAAGG - Intronic
966618960 3:181943510-181943532 CTGGGTGCCCTGAAACAATTAGG + Intergenic
967166048 3:186780311-186780333 CTGTGACCCCTGACGCAATTTGG - Intergenic
969314656 4:6374496-6374518 CTGTGTCCCCTCTTGCCTTTTGG - Intronic
970005756 4:11409253-11409275 TTGTTTCCCCTGAAACAATTTGG + Intronic
973939638 4:55893615-55893637 TTTTGTCTCCTAATGCAATTAGG - Exonic
982175235 4:152699967-152699989 CTGTGACCTCTAATGCTATTGGG + Intronic
985626302 5:990347-990369 CTGTGTCCCCTGAAGCCAGGGGG + Intergenic
989613683 5:43318705-43318727 GTGGGTCCCCTGATGTAGTTGGG + Intergenic
991297926 5:65101267-65101289 CTCTGCCCCCTGGTGCAAGTCGG - Intergenic
992869257 5:80990103-80990125 CTGTGTCCCCTGGAGAAAGTAGG + Intronic
998042575 5:138961697-138961719 CTGTGCCCCCTGAAGCCATGTGG + Intronic
998992716 5:147835999-147836021 CTGTGGTGCTTGATGCAATTAGG + Intergenic
1003833694 6:10043602-10043624 TTGTGTCACCTGTTACAATTTGG - Intronic
1008473904 6:51915619-51915641 CTGTGTCCCATGATGAAATGTGG - Intronic
1008791752 6:55243402-55243424 CTGTGTCCTCTGATGAACTTTGG - Intronic
1012160386 6:95877721-95877743 CTCTCTCCCCTGTTGCAATATGG - Intergenic
1012198863 6:96379975-96379997 CTAAGTCCCCTGTTGGAATTCGG - Intergenic
1013352284 6:109316680-109316702 CTGTGCCCCCAGAAGCACTTGGG + Intergenic
1013517591 6:110902322-110902344 CTCTGGCCCCAGATGCCATTTGG - Intergenic
1014663612 6:124206366-124206388 CTGTGTTCCCTTAAGCAAGTAGG - Intronic
1014779323 6:125545031-125545053 ATGTGTCCCCTGCTGCGGTTGGG + Intergenic
1017888692 6:158621817-158621839 CTGTAGCCCCTGAAGCAGTTAGG - Intronic
1018961059 6:168448664-168448686 CTGTCTCCACTGAGGCAATGAGG + Intronic
1020745268 7:12071900-12071922 ATGGGTCCCTTGATGCAGTTGGG - Intergenic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1023673645 7:42606539-42606561 CTGTGTCCCTTGATGGGATTCGG - Intergenic
1024640838 7:51327281-51327303 CCGTGTCCCCTGATGCCCTGGGG - Intergenic
1026443733 7:70465827-70465849 CTGTGTACCCCCATGCAAGTGGG + Intronic
1028404368 7:90460227-90460249 CAGTGTCCTCTAATTCAATTCGG + Intronic
1032515983 7:132506681-132506703 CTGTGTCCCCTGCTTCACCTGGG + Intronic
1034471173 7:151255134-151255156 CTGTGGTGACTGATGCAATTGGG - Intronic
1035987280 8:4448407-4448429 CTGTGTGCCCTGATGCAGATTGG + Intronic
1036607338 8:10319142-10319164 CTGTTTCCCCTGATTATATTAGG + Intronic
1039192431 8:34991926-34991948 GTGAGTCCTCTGATGTAATTTGG + Intergenic
1042953398 8:74223953-74223975 CTGTGTCCCCTCATGCAGGAAGG + Intergenic
1043161449 8:76852615-76852637 CTCTGGCCCCTGAAGCTATTCGG - Exonic
1045338253 8:101228237-101228259 CTTTGTCCACGGATGAAATTTGG - Intergenic
1047670198 8:127137536-127137558 CTGTGTCCCCATATGCAAAATGG + Intergenic
1048507203 8:135032389-135032411 CCCTGTCCCCTCATGCAACTCGG + Intergenic
1050110617 9:2211643-2211665 CTGAGACCCCTGTTGTAATTGGG + Intergenic
1052819235 9:33125744-33125766 ATCTGTCCCCTGTTGCAATCAGG - Intronic
1053705574 9:40749685-40749707 GTGGGTCCCTTGATGCAGTTGGG + Intergenic
1054415651 9:64873292-64873314 GTGGGTCCCTTGATGCAGTTGGG + Intergenic
1055375616 9:75646257-75646279 CTGTATCTCCTGATTCAGTTGGG - Intergenic
1055750843 9:79503148-79503170 GTGTGTCCCCTGAAACATTTGGG + Intergenic
1057167743 9:92941845-92941867 CTGGGTCCCCTGATGCAAAGTGG + Intergenic
1058901748 9:109448116-109448138 CAGTATCCCATGAAGCAATTAGG - Intronic
1060640562 9:125234977-125234999 CTGTGTACCCTGGGGCAATAGGG - Exonic
1062394421 9:136347022-136347044 CTGTGCTCCCTGATGCAGTGGGG + Intronic
1185650543 X:1644881-1644903 CTGTGTGCCCTGCTGCAAATAGG + Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1188121181 X:26309991-26310013 TTGTGTCCCCTGATCCATTGAGG + Intergenic