ID: 1106403010

View in Genome Browser
Species Human (GRCh38)
Location 13:29447717-29447739
Sequence CTGGAAAAGGCTTCCCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106402996_1106403010 30 Left 1106402996 13:29447664-29447686 CCTCCATGGGTGATGGCTCTTGT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1106403010 13:29447717-29447739 CTGGAAAAGGCTTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 231
1106402997_1106403010 27 Left 1106402997 13:29447667-29447689 CCATGGGTGATGGCTCTTGTCTG 0: 1
1: 0
2: 4
3: 115
4: 2386
Right 1106403010 13:29447717-29447739 CTGGAAAAGGCTTCCCCAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106403010 Original CRISPR CTGGAAAAGGCTTCCCCAGG TGG Intronic
900226611 1:1536126-1536148 GTGGAAGAGGCCTCCCCCGGAGG + Intronic
900323306 1:2095506-2095528 CTTGAAAAGGCATCCACGGGAGG - Intronic
900891539 1:5453354-5453376 CTACCAAAGTCTTCCCCAGGTGG + Intergenic
902520598 1:17013468-17013490 TTGGAAATGGCTAGCCCAGGTGG + Intergenic
902609100 1:17586840-17586862 CACGAAAGGGGTTCCCCAGGAGG + Intronic
902702762 1:18183856-18183878 TTGGAATAGGCTTGCCCAGTGGG - Intronic
903854437 1:26328461-26328483 CTGGAATAGGGTTCCCAGGGCGG + Intronic
904467227 1:30715370-30715392 CTGCCTAAGCCTTCCCCAGGAGG - Intronic
905156792 1:35990969-35990991 CTGGATCAGGCTTACCCAGGCGG + Intronic
907753834 1:57290181-57290203 TAAGAAAAGGCTCCCCCAGGAGG + Intronic
915950488 1:160186963-160186985 CTGGAAAAGCCCTCACCAGCTGG + Exonic
916628167 1:166582302-166582324 CAGGAAAATGCTTCCCCCAGAGG + Intergenic
917154304 1:171979706-171979728 CTGGATAAGGCTTAGCCAAGAGG - Intronic
919257421 1:195142133-195142155 CTTGGAAAGTCTTCCCAAGGAGG - Intergenic
919856165 1:201707625-201707647 GGGAAACAGGCTTCCCCAGGAGG - Intronic
920371589 1:205482454-205482476 CTGGAAATAGCTCCCCCAAGGGG + Intergenic
921608445 1:217182321-217182343 CTGGAAAAGGCAAGCCCAGAAGG + Intergenic
923535946 1:234851952-234851974 CTGTTAAGGGCTGCCCCAGGGGG - Intergenic
1067234913 10:44439269-44439291 CTGTGAGTGGCTTCCCCAGGAGG - Intergenic
1069993916 10:72331293-72331315 CAGGAAACGTCATCCCCAGGAGG - Intergenic
1070940117 10:80337180-80337202 CTGGACAAGTCTTCCTCAGGAGG - Intronic
1072043538 10:91632847-91632869 CTGGAAATGGACACCCCAGGGGG - Intronic
1072199275 10:93144177-93144199 CTGGAAAAAGCTTTCCAAAGGGG + Intergenic
1073113315 10:101075827-101075849 CTGGAAAGGGCTTCCCAATGGGG + Intergenic
1074733854 10:116407404-116407426 CTGCAAAAAGCTTCCCCGGCTGG + Intergenic
1074947571 10:118296223-118296245 CTAAAAGAGGCTTCACCAGGTGG - Intergenic
1075003896 10:118817083-118817105 CTGGAGGAGGCTTCCCCTGAGGG - Intergenic
1078439459 11:11351967-11351989 CTGGAACAGGCATCCCAAGGGGG + Exonic
1080145934 11:28984036-28984058 CTAGGAAAGGCTTGACCAGGAGG + Intergenic
1080663362 11:34315049-34315071 CTGGAAAAGTCCTCGCCAGAAGG + Intronic
1080936393 11:36868425-36868447 CTGGGAAAGGTTCCCCAAGGAGG + Intergenic
1083621365 11:64051001-64051023 CTGGACCAGCCTTGCCCAGGGGG + Intronic
1084676591 11:70639091-70639113 CTGGGAAGGGCTTCCCCTGCTGG + Intronic
1085091271 11:73716398-73716420 CTGAAAAATGCCTCCCCAGGTGG + Intronic
1092046037 12:5432393-5432415 CTGGAAAATCCCTCCCCACGTGG - Intronic
1092480992 12:8858839-8858861 CAGGAAATGGCTTTCCCAGATGG - Intronic
1097147999 12:56954839-56954861 CTGGAAAAGACTTCCCCACAAGG + Intronic
1099399679 12:82187437-82187459 ATAGAAGAGGCTTCCCAAGGAGG - Intergenic
1099727476 12:86451308-86451330 CTGGCAGAGGCCTCCCCAGAAGG + Intronic
1102347529 12:112169307-112169329 CTGGCCGAGGCTTCCACAGGGGG + Intronic
1102457581 12:113080236-113080258 TTGGACAAGGCTTCCCCAAGGGG - Intronic
1103597817 12:122034885-122034907 TTGAGAAAGGCTGCCCCAGGGGG + Intronic
1103850432 12:123929505-123929527 TTGGAAATGGCTTCCTTAGGCGG + Exonic
1105636001 13:22215965-22215987 ATGCAAAAGGCTTCCTCAGTAGG - Intergenic
1106403010 13:29447717-29447739 CTGGAAAAGGCTTCCCCAGGTGG + Intronic
1107835047 13:44406180-44406202 CTGGAAAGGGCTGCTCCAGAAGG - Intergenic
1108271169 13:48760904-48760926 CTGGAAGACACTTACCCAGGTGG + Intergenic
1113850156 13:113413349-113413371 CTGGGAAAGGCTCCCTGAGGTGG - Intergenic
1114814692 14:25943500-25943522 CAGGAAAGGGCTCCCTCAGGAGG - Intergenic
1115373789 14:32650714-32650736 CTGGACCAGGGTTCCCCAAGAGG + Intronic
1116489684 14:45491664-45491686 CTGGGAAAGTCTTCCCAAGAAGG - Intergenic
1117504336 14:56387807-56387829 CTTGGAAAGCCTTCCCCAGAAGG - Intergenic
1119514761 14:75239464-75239486 ATGGAACAGGCTTACCCAGTGGG - Intronic
1119693487 14:76694830-76694852 CTGGAAAAGGCATCCCACGTGGG + Intergenic
1119699289 14:76742161-76742183 CTGGAAATGGAGTCCCCAGGTGG + Intergenic
1124368783 15:29091592-29091614 CTGGAAAAAGCTGCCCAAGAGGG - Intronic
1125567021 15:40684614-40684636 CTTGAAAAGCCTTCCCAAGAAGG - Intergenic
1126857513 15:52853368-52853390 CTGAAATAGGCTGCCTCAGGAGG - Intergenic
1127910831 15:63414818-63414840 TTGGAAAAGGGGTCCCAAGGTGG + Intergenic
1128222825 15:65981161-65981183 CTGAGGAAGGCTTCCCAAGGAGG + Intronic
1128262279 15:66240847-66240869 ATCCAAAAAGCTTCCCCAGGAGG - Intronic
1128789040 15:70419203-70419225 CTGGATGAGCCTTCTCCAGGAGG - Intergenic
1129191679 15:73941321-73941343 CTGGACCAGGCTCCCCCATGAGG + Intronic
1129653958 15:77510553-77510575 CTGGCAAGGCCTACCCCAGGAGG - Intergenic
1130441005 15:83954647-83954669 CTTGGAAAGGCTTCCCAAGAAGG - Intronic
1130910948 15:88270402-88270424 AAGGAAAAGGCTGCTCCAGGTGG + Intergenic
1130984891 15:88838396-88838418 CTAGAAAAGGATTCCAGAGGAGG - Intronic
1131154365 15:90065580-90065602 TGGGAAAAGGCTGCCCCAGGTGG + Intronic
1131305368 15:91238479-91238501 CTGGAAAAGTCTTCCAGGGGTGG - Intronic
1131880688 15:96859030-96859052 CTGGAAATGGCTTTCACAGCTGG - Intergenic
1133227450 16:4348607-4348629 CTGGAAAGGGTTTCACCCGGGGG - Intronic
1133336204 16:5008311-5008333 CTGGGAAAGGAGACCCCAGGGGG + Intronic
1134086134 16:11358703-11358725 CTGGTGAAGGCTTCCTCTGGTGG + Intergenic
1135187003 16:20323872-20323894 CTGGTGAAGGCCTGCCCAGGCGG - Exonic
1135826691 16:25734908-25734930 CTGGCACAGGTGTCCCCAGGAGG - Intronic
1136275283 16:29176173-29176195 CTGGGAAAGGCTGCCCTGGGAGG + Intergenic
1137617919 16:49857912-49857934 TGGGAAAAGTCTTCCCCAGACGG + Intronic
1138097836 16:54226403-54226425 CCTCAAATGGCTTCCCCAGGCGG + Intergenic
1138586709 16:57975377-57975399 CTGGAAGATTCTACCCCAGGAGG - Intergenic
1139753023 16:69120577-69120599 CTGCAAAAGGTTTCTCCAGGTGG + Exonic
1141591598 16:85072963-85072985 CTGCAAAAGACTGCACCAGGCGG - Exonic
1142079644 16:88142241-88142263 CTGGGAAAGGCTGCCCTGGGAGG + Intergenic
1142229392 16:88892744-88892766 CTGGAAATGGATTCCCAGGGAGG + Intronic
1142510794 17:391664-391686 CTGGATAAGGGATGCCCAGGTGG + Intergenic
1143850580 17:9808788-9808810 TTGGAACAGGCTGCCCCAGAGGG - Intronic
1143900680 17:10172338-10172360 CTGCCCAAGGATTCCCCAGGGGG + Intronic
1146242404 17:31242926-31242948 CTTGGAAAGCCTTCCCCAGAAGG - Intronic
1146485782 17:33241424-33241446 CTGGAACAGCCCTCCCCATGTGG - Intronic
1146536171 17:33654378-33654400 CTGGATAAGGATTGACCAGGAGG + Intronic
1149779933 17:59389254-59389276 CTGGGAAAGGCTGTCCCAAGGGG - Intronic
1150208263 17:63426010-63426032 ATGGAATAGGCTATCCCAGGGGG + Exonic
1150209513 17:63434467-63434489 CTGGAAGCGGCCTTCCCAGGCGG - Exonic
1152547537 17:81009341-81009363 CAGGAAACGGCTTCCCCACAGGG - Intronic
1152750048 17:82058490-82058512 CTGGCAGAGGCTTCCCCAGTGGG - Intronic
1152932484 17:83116948-83116970 CTGGAAAAGGCTGAGCCTGGTGG + Intergenic
1153604546 18:6818633-6818655 CTGGAAAGGGATCCCCCAAGAGG + Intronic
1154979986 18:21495763-21495785 CTGGGAAAGGTTTCTCCAAGAGG - Exonic
1156038051 18:32788325-32788347 CAGCAGAAAGCTTCCCCAGGAGG - Intergenic
1158022387 18:52858676-52858698 CTGGAAAAGGCAACCCCATGGGG + Intronic
1160025573 18:75212266-75212288 CTGGAAAAGTCCTCCAAAGGCGG + Intronic
1160560710 18:79754246-79754268 CCGGAAATGGGTTCCCTAGGAGG - Exonic
1161289923 19:3488154-3488176 CCCGAAAAGGCTTGTCCAGGTGG - Intergenic
1165182629 19:33985832-33985854 CTGGAGAAACCCTCCCCAGGAGG + Intergenic
1165890706 19:39110507-39110529 CTGGCAAGGGCATCGCCAGGTGG + Exonic
1166809800 19:45508251-45508273 CTGGAAAAAGTCTCCCCAAGTGG + Intronic
1167277442 19:48546831-48546853 CAGGAAAAGGATGCCCCAGTAGG - Intergenic
926094105 2:10069965-10069987 GAGGGAAAGGCTGCCCCAGGAGG + Intronic
926726611 2:16003707-16003729 CTGGGAAAGGCTTTTACAGGAGG + Intergenic
927936195 2:27078290-27078312 CTGGAGCAGGCCTCCCCTGGGGG - Intergenic
929296743 2:40256846-40256868 ATGCAAAAGGCTGTCCCAGGTGG - Intronic
930970323 2:57386816-57386838 CCTGAAAAGGCTTCCCCAAAAGG + Intergenic
931257152 2:60583699-60583721 CTGGGAAAGCCTCCCCCAAGAGG + Intergenic
932434279 2:71694147-71694169 CTGGCAAAGGCTTGCCGAGGAGG + Intergenic
934707783 2:96496894-96496916 CTGGAAAAGGCATCTCCCAGGGG - Intergenic
935454658 2:103253205-103253227 CAGGAAAGTGTTTCCCCAGGGGG + Intergenic
936572842 2:113630755-113630777 AAGGAAAAGCCTTCCACAGGAGG - Intronic
936985392 2:118307464-118307486 CTGGCAAAGGCTTCCCAACTGGG + Intergenic
937084428 2:119161300-119161322 CTGGAAAATGTTTGTCCAGGTGG - Intergenic
937364237 2:121249191-121249213 CTGGGAAAGGAAGCCCCAGGGGG - Intronic
938323496 2:130381435-130381457 CTGGAGAAGTCATCCCCAGCTGG + Intergenic
939531138 2:143363246-143363268 CTAGAAAACTCTTGCCCAGGTGG + Intronic
939951775 2:148483747-148483769 TTGGTAAAGGGTTCCCCAGGGGG - Intronic
942937491 2:181575543-181575565 CTGGAAAAGGCTTCAAGAGAAGG + Intronic
943845241 2:192636224-192636246 CCTGCAAAGCCTTCCCCAGGAGG + Intergenic
944901698 2:204222765-204222787 CTGCAAGAAGCTTCCCCAGCTGG + Intergenic
945807092 2:214502857-214502879 CAGTAAAAAGCTTCCCCAGATGG + Intronic
946030240 2:216697912-216697934 CTGGGATAGGCTTCCCGAGAGGG + Intergenic
946153261 2:217790235-217790257 TTCCAAAAGGCTGCCCCAGGAGG + Intergenic
947708132 2:232292913-232292935 CAGGAACAGGCTTCCCTGGGTGG - Intronic
947793476 2:232880469-232880491 CTGGAGAAGGCCTCCCCTGGAGG + Intronic
1168780363 20:483984-484006 CTGGAACAGGCATCCCAAGGGGG + Exonic
1169610934 20:7379378-7379400 CTGGAGAAAGATTCCCCAGCAGG - Intergenic
1170365828 20:15597577-15597599 CTGTAAAAGGCTACCAGAGGTGG + Intronic
1170972993 20:21133941-21133963 CTGGTAAGGGCAGCCCCAGGTGG + Intronic
1172438935 20:34951823-34951845 CTGCAAGAGGCTCCCCCAGTTGG + Exonic
1172623727 20:36335792-36335814 CTGGAGAAGGCTTCCCAGAGGGG - Intronic
1172745080 20:37200786-37200808 CTGGAGAAGCATTCCCCATGAGG - Intronic
1173197755 20:40930011-40930033 CTTGAAGAGGCTTCCCCACTAGG + Intergenic
1173352975 20:42261866-42261888 CTGGACAAAGCTGCCCCAGATGG - Intronic
1173812251 20:45963252-45963274 CTGGGAAGGGCTGCCACAGGCGG - Intronic
1174199846 20:48799645-48799667 CTGGAAAACCCTTACCCATGGGG - Intronic
1175038341 20:56021542-56021564 GTGGAAAACGCTTCCACAGTTGG + Intergenic
1175228035 20:57456336-57456358 CTGGAAGGCTCTTCCCCAGGCGG + Intergenic
1175807845 20:61840417-61840439 CTGGCAGAGTCTCCCCCAGGAGG - Intronic
1179189897 21:39115036-39115058 CTGCCAAAGGCACCCCCAGGAGG + Intergenic
1180835455 22:18927352-18927374 CAGGAAAAGCCATCCCCAAGGGG + Intronic
1181431636 22:22885072-22885094 CTGGACTAGGCCTCCCCAGCAGG - Intronic
1181671343 22:24426930-24426952 CTGGAACAAGCTTCCCCTGCGGG - Intronic
1183213279 22:36464035-36464057 CTGGAGCAGCTTTCCCCAGGCGG + Intergenic
1184436208 22:44478951-44478973 CTGGAAAGACATTCCCCAGGAGG - Intergenic
1184496420 22:44845005-44845027 TTGGGGAGGGCTTCCCCAGGGGG - Intronic
1185427349 22:50780105-50780127 AAGGAAAAGCCTTCCACAGGAGG + Intronic
1203285543 22_KI270734v1_random:152651-152673 CAGGAAAAGCCATCCCCAAGGGG + Intergenic
949158528 3:854225-854247 CTGGGAAAGCCTTCTCAAGGAGG + Intergenic
951120948 3:18928259-18928281 CTAGAAAATTCTTCCCTAGGTGG + Intergenic
952764818 3:36944844-36944866 CAGGGAAGCGCTTCCCCAGGCGG - Exonic
953434469 3:42867641-42867663 CAGGAAGAGGAATCCCCAGGGGG - Intronic
953979756 3:47407701-47407723 CTGGCAAGGGCTTCACCAAGGGG - Exonic
954412548 3:50377329-50377351 TCGGGGAAGGCTTCCCCAGGAGG - Intronic
955683018 3:61522186-61522208 CTGGAAAAGGCCTGCCCTGTGGG + Intergenic
955947323 3:64207916-64207938 CTGGGAAAGGCTGACGCAGGAGG + Intronic
959285084 3:104398217-104398239 CTTGAAAAGCCTTCCCAAGAAGG + Intergenic
960039290 3:113133296-113133318 CTGCAAATGACTTCCCCAGTTGG + Intergenic
960689991 3:120336297-120336319 ATGGAACAGGCTTCCCCAAAGGG + Intronic
961738535 3:129017489-129017511 CTGGAACGGGCTTTCCCAGGGGG - Intronic
965035057 3:163426932-163426954 CTTTAAAAGCCTTCCCAAGGAGG + Intergenic
965776734 3:172239591-172239613 ATTAAAAAGGCTTCCCCAGATGG - Intronic
966666213 3:182473607-182473629 TTGGAGAAGGCTGTCCCAGGAGG + Intergenic
968639444 4:1704830-1704852 CTGGAAAATTCTTACCCTGGAGG - Intronic
969467731 4:7367633-7367655 CTGGCAGGGGCTTCCCCATGGGG - Intronic
969535975 4:7756306-7756328 CTGCACAAAGCTGCCCCAGGAGG + Intergenic
976883727 4:89961496-89961518 CTGCAAATGGCTTCACCTGGAGG + Intergenic
976908055 4:90263988-90264010 CTAAAAAATGCTTCCCCAAGTGG - Intronic
977765466 4:100792376-100792398 CTGGCAGAGGCTTCACCAGGCGG - Intronic
983536885 4:168867336-168867358 TTGGAAAAGGCCTCCCCTGGTGG + Intronic
983868154 4:172792689-172792711 CTTGAAAAGGCTACCCAAGCAGG + Intronic
984711838 4:182892378-182892400 CTGTAAAAAGAATCCCCAGGTGG + Intronic
986796431 5:11217165-11217187 CAGAAAAAGTCTTCCCAAGGTGG + Intronic
986928317 5:12786378-12786400 CTGGAAAAGGCAACACCATGGGG - Intergenic
987238943 5:15972840-15972862 TTGGAATTGGATTCCCCAGGTGG - Intergenic
988495984 5:31746705-31746727 GTGGAAAAGCCTTGCCCAAGTGG - Intronic
992549575 5:77847931-77847953 CTGGAAACAGCTTCTCCTGGAGG - Intronic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995770750 5:115666213-115666235 TTGGAAAAGCCTTCCCAAGAAGG + Intergenic
996423769 5:123290796-123290818 GTGGAGGAGGCTGCCCCAGGAGG - Intergenic
996678851 5:126208233-126208255 CTGGAAAAGCGCTCCCCAGCAGG + Intergenic
998895783 5:146798338-146798360 CTGATGAAGGCTTCCCCAGCTGG + Intronic
999380245 5:151116476-151116498 CTGGAAATGGCTTCTTCTGGAGG - Intronic
999686746 5:154110003-154110025 ATGGAAAAAGCAACCCCAGGTGG - Intronic
1001102757 5:168827734-168827756 CAGGACAAGGGCTCCCCAGGCGG + Intronic
1001279622 5:170377462-170377484 CTGAGATAGGCTTCCCCAGCAGG + Exonic
1002861153 6:1080561-1080583 CTGGGAAAGGTTTACCCTGGGGG + Intergenic
1003330074 6:5122421-5122443 CTGGAAAGGGCTTCCAGAGTAGG + Intronic
1005048684 6:21665175-21665197 CTAGAAATTGCTTCCCCATGCGG + Intergenic
1005708545 6:28481494-28481516 CTGCAGGAGGCTTCCCCAAGAGG + Intergenic
1007087230 6:39157265-39157287 CTGGAAATGGTCTCACCAGGTGG + Intergenic
1009297946 6:61978109-61978131 CGTGAATAAGCTTCCCCAGGTGG + Exonic
1010976670 6:82323516-82323538 CTGGAAAAGGCTGGAGCAGGAGG - Intergenic
1012800554 6:103821047-103821069 CTTGAAAAGCCTTCCCAAGGAGG + Intergenic
1014542288 6:122691830-122691852 CCTGAAAAGGCTTCCCAAGAAGG - Intronic
1017702702 6:157090964-157090986 CTGGAAGAGGCTACCCCAGGCGG - Intronic
1019119284 6:169790455-169790477 GGGGATCAGGCTTCCCCAGGTGG + Intergenic
1019283144 7:210596-210618 CTGAAAAATGCTCCCACAGGTGG - Intronic
1019729805 7:2623603-2623625 CTCTGAAGGGCTTCCCCAGGTGG + Intergenic
1020124125 7:5523320-5523342 CTTGAGTAGGCTTCCCCAGAGGG - Intergenic
1021550780 7:21868950-21868972 CTGGAGAAAGCTTCCAAAGGAGG + Exonic
1022417238 7:30188910-30188932 CTGGGAAAGGCAACCTCAGGTGG - Intergenic
1022766559 7:33418724-33418746 CTGGGAAAGGCTTCTCCTGCAGG - Intronic
1024505662 7:50159202-50159224 CCGCACAAGCCTTCCCCAGGCGG - Exonic
1026450566 7:70525717-70525739 ATGGAAAAGTCTTCCCTATGAGG + Intronic
1026950082 7:74341001-74341023 CTGGCAAAGGTTTCTCCTGGAGG + Intronic
1029305983 7:99620351-99620373 CCGGAAAAATATTCCCCAGGTGG - Intronic
1029612982 7:101637190-101637212 CAGGAAAAGGCATCCCTAGTTGG - Intergenic
1030330257 7:108262964-108262986 CTGGGAAATGCTTCTCCACGTGG - Intronic
1032503509 7:132417994-132418016 CTCAAAAAGTCTTCCACAGGAGG - Intronic
1033257171 7:139812057-139812079 ATGGAACAGTCTTCCACAGGTGG + Intronic
1033636744 7:143218827-143218849 CTAGAAAATGCTTTCCCAGTTGG - Intergenic
1033881783 7:145893161-145893183 CTGGAGAAAGACTCCCCAGGTGG - Intergenic
1036614850 8:10380286-10380308 CTAGAAAAAGCTTCCAAAGGAGG - Intronic
1039303697 8:36238083-36238105 GTGGTAAAGGCTTCCCTTGGGGG - Intergenic
1040581014 8:48698680-48698702 CCGGAAATGCCTTGCCCAGGAGG + Intergenic
1041343119 8:56866735-56866757 CGGCAAAAGGCTTGCCCATGGGG + Intergenic
1042200514 8:66276082-66276104 CTGGATGAGGCTTCCCCAAGGGG - Intergenic
1042593198 8:70418194-70418216 CTGGGACAGGGTTCTCCAGGTGG - Intergenic
1044769442 8:95615024-95615046 CTGGAAAGGGCTTCCTGAAGAGG - Intergenic
1046747561 8:117892609-117892631 CTTTAAAAGGATTCCCCTGGTGG + Intronic
1047740517 8:127802887-127802909 CTGGAAGAGACTCGCCCAGGAGG + Intergenic
1047926956 8:129691479-129691501 CTGGACAGGCCTTCCCCAGGAGG - Intergenic
1049287118 8:141781895-141781917 CTGGGAAGGGCTCTCCCAGGAGG + Intergenic
1049531193 8:143156491-143156513 CTGGCCAAGGCTTCCCTCGGGGG + Intergenic
1050608653 9:7328125-7328147 CTGGAATTGACTTACCCAGGTGG - Intergenic
1052112379 9:24602791-24602813 CTTGAAAAGGCTACTGCAGGAGG - Intergenic
1056737963 9:89225916-89225938 CTGGAAAATGGTGACCCAGGAGG - Intergenic
1057187078 9:93062964-93062986 ATGGAAAGGGCTACCCCAAGGGG + Intronic
1057736687 9:97668765-97668787 CAGTAAAATGCTTCCCCTGGAGG + Intronic
1057949939 9:99361785-99361807 CTGAAAAAGGTTTTCGCAGGAGG - Intergenic
1058416005 9:104789180-104789202 CTGAAAAAGGCTGACCCTGGGGG - Intronic
1060166552 9:121422159-121422181 CTTGGAAAGCCTTCCCAAGGTGG - Intergenic
1060219654 9:121757638-121757660 CTGGACAGGTCATCCCCAGGTGG - Intronic
1061147738 9:128809473-128809495 CCAGGAAAGGCTTCCCCAGGTGG + Exonic
1061230451 9:129312856-129312878 TTGGAAGAGACCTCCCCAGGGGG - Intergenic
1061706108 9:132454634-132454656 CTAGAAAAGGATTCACCACGTGG - Intronic
1061973856 9:134058610-134058632 CGGGAAAAGGCTTCCCTTGCTGG - Intronic
1187045871 X:15647092-15647114 CTGGAAGGAGCTTCGCCAGGTGG + Intronic
1187051849 X:15703393-15703415 CTGGAAGGAGCTTCGCCAGGTGG + Intronic
1188522230 X:31051538-31051560 CTGGAATAGCCTTACACAGGAGG + Intergenic
1189175903 X:38957010-38957032 CTAGAAATGGATTTCCCAGGAGG - Intergenic
1190126640 X:47711445-47711467 CTGAAAAAGGCTTCCCAGTGGGG + Intergenic
1190808192 X:53859995-53860017 CTTGGAAAGGCTTCCCAAGAGGG - Intergenic
1191661490 X:63656201-63656223 CTGGCAAAGGATTACCTAGGGGG + Intronic
1191812269 X:65202368-65202390 CTAGAAAAGCCTTCCCAAGAAGG - Intergenic
1193897136 X:87127991-87128013 CTTGGAAAGGCTTCCCAAGAAGG + Intergenic
1198034081 X:132783722-132783744 CTGGAGAGGGCTTCCTGAGGCGG - Intronic
1198170446 X:134100144-134100166 GTGGAAAGTGTTTCCCCAGGAGG - Intergenic
1200366423 X:155670373-155670395 CTGCAAGAAGCTTCCCCAGAGGG - Intergenic
1201253047 Y:12079952-12079974 CTGGAAACGTCTTCCCTGGGTGG - Intergenic