ID: 1106403423

View in Genome Browser
Species Human (GRCh38)
Location 13:29451979-29452001
Sequence GAATTACCTGCCCCTCTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106403420_1106403423 0 Left 1106403420 13:29451956-29451978 CCACTCAGCATGACTAGGTCTGG 0: 1
1: 0
2: 1
3: 8
4: 93
Right 1106403423 13:29451979-29452001 GAATTACCTGCCCCTCTTATAGG 0: 1
1: 0
2: 0
3: 7
4: 61
1106403418_1106403423 14 Left 1106403418 13:29451942-29451964 CCTTGCACAATGGACCACTCAGC 0: 1
1: 0
2: 0
3: 72
4: 351
Right 1106403423 13:29451979-29452001 GAATTACCTGCCCCTCTTATAGG 0: 1
1: 0
2: 0
3: 7
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106403423 Original CRISPR GAATTACCTGCCCCTCTTAT AGG Intronic
910088715 1:83436279-83436301 GAGTTACCCGCCCCTTTTCTGGG + Intergenic
910252943 1:85217445-85217467 GAAATCACTGTCCCTCTTATAGG - Intergenic
917937005 1:179878139-179878161 GGATTACATGCTCCTCTTAATGG - Intergenic
920663125 1:207935413-207935435 GAAATGCCTGCCCCTTTTAAGGG - Intergenic
921154082 1:212424993-212425015 GAATGCCCTGCCTCTCTTTTGGG + Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923975422 1:239256970-239256992 GAATTCCCTGACCCTCTTCTGGG + Intergenic
1063201762 10:3790965-3790987 GAGTTTCCTGCCCATCTTCTGGG + Intergenic
1064012214 10:11743635-11743657 GAATTCCCTGCCCCTGCTGTGGG - Intronic
1067249919 10:44577401-44577423 GAAATAGTAGCCCCTCTTATGGG - Intergenic
1073640123 10:105243961-105243983 GACTGTCCTGCCCCTCTTAAAGG + Intronic
1075487397 10:122836197-122836219 GAATTTTCTGTCCCTCTTAATGG - Exonic
1077754776 11:5015218-5015240 GATTTCCCTGCCCATCTTCTTGG + Intergenic
1078613741 11:12845692-12845714 GAACCACCTGCCCCTTTTAGCGG + Intronic
1084716413 11:70877163-70877185 GAATTATTTTCCCCTCTTTTTGG + Intronic
1087896323 11:103590339-103590361 GAATTCCCTGATCCCCTTATGGG - Intergenic
1092096587 12:5847716-5847738 GAATTACCTTTCCCTCCTAAAGG + Intronic
1098690515 12:73481745-73481767 GCAATTCCTGCCCCTCTTAAGGG - Intergenic
1099720032 12:86349302-86349324 AAATTACCTCCACCCCTTATGGG - Intronic
1106403423 13:29451979-29452001 GAATTACCTGCCCCTCTTATAGG + Intronic
1107490203 13:40874240-40874262 GAAATTCCTGCCCCTTTTAAGGG + Intergenic
1107491177 13:40880943-40880965 GAAATTCCTGCCCCTTTTAAGGG + Intergenic
1108158924 13:47618167-47618189 GAGTTCCCTGACCCTCTTGTGGG + Intergenic
1131962516 15:97804648-97804670 AAATAAGCTGCACCTCTTATAGG + Intergenic
1140865464 16:79057210-79057232 GAATTGCCTGGACCTCTTTTAGG + Intronic
1155233011 18:23792985-23793007 GCATGACCTGCCCCTCCTCTGGG - Intronic
1157395837 18:47340090-47340112 GAAATACCTCCCCCTCCTGTGGG - Intergenic
1159048838 18:63397640-63397662 GAATTACCTCACAATCTTATAGG + Intronic
1159169451 18:64746116-64746138 GAATTTTCTGCCACTCTGATGGG + Intergenic
1159677716 18:71306317-71306339 GAATAAACAGCCCCTCTTCTTGG - Intergenic
1162790455 19:13060179-13060201 GAATTACCTGTCCCTAGTAAAGG - Intronic
1166007521 19:39917621-39917643 CAACTTCCAGCCCCTCTTATGGG + Intronic
931641274 2:64382955-64382977 GAATTATCTGCCCCCCTTAGAGG + Intergenic
933426011 2:82112874-82112896 GTGTTACCTGACCCTCTTGTGGG - Intergenic
933507828 2:83201416-83201438 GACTAACCTGCCCCTCTGATAGG + Intergenic
940625384 2:156169121-156169143 GAATTTCCTGCCTCTCTTTAGGG - Intergenic
940688537 2:156884866-156884888 GAATTAGATGCCACTCCTATGGG - Intergenic
943489145 2:188528026-188528048 GAATTTCTTGCCCCTCTTCTAGG - Intronic
944143191 2:196478991-196479013 GAATTATGTACCCCTCTTGTTGG - Intronic
948144707 2:235699696-235699718 GAATGGCCTGCCCATCCTATGGG - Intronic
1185298524 22:50066747-50066769 GACTGACCTGCTCCTCTTATGGG - Intronic
950214146 3:11146315-11146337 GACTTACCTCCCCCTGTTTTAGG + Intronic
965355130 3:167664233-167664255 GCACTACCTGCTTCTCTTATTGG + Intergenic
969077454 4:4591384-4591406 GTATTACCATCCCATCTTATAGG + Intergenic
975974209 4:80076385-80076407 TAATTACCTGCTCATCTTCTGGG + Intronic
989558662 5:42825967-42825989 GAGTTCTCTGACCCTCTTATGGG - Intronic
992809478 5:80372213-80372235 GAAATACCTGGCCCTTTTAAGGG - Intergenic
993320729 5:86465568-86465590 GAAATTCCTGCCCCTTTTAAGGG - Intergenic
1000962595 5:167618082-167618104 TAATTACCTGCCCCTCAAATGGG + Intronic
1001147923 5:169200917-169200939 GACTTTCCTGCCCCACATATGGG - Intronic
1004459397 6:15821453-15821475 AAATAACCAGACCCTCTTATTGG - Intergenic
1018664745 6:166125290-166125312 TAATTTCCTGCACCTCCTATAGG - Intergenic
1024511213 7:50206593-50206615 AACTTACCTGCCCCTCTTCCTGG - Intergenic
1034697388 7:153065970-153065992 GAAATACTTGCACCTCTTCTTGG - Intergenic
1039111086 8:34041189-34041211 GAGTTAGATGCCCCTCCTATGGG - Intergenic
1040643362 8:49367915-49367937 TAATTACCTTCTCCTCTTGTGGG - Intergenic
1040890829 8:52314381-52314403 GAATTATCTGCCCCTACTATAGG + Intronic
1046797419 8:118388048-118388070 GGGTTAAATGCCCCTCTTATGGG - Intronic
1048301673 8:133255847-133255869 GAATGACCTCCCCCTCTCCTTGG + Intronic
1051327226 9:15985751-15985773 GAATTACCTCTGCCTCTCATGGG - Intronic
1051336361 9:16069934-16069956 GGATTTCCTGCCCCTGCTATGGG - Intergenic
1053319582 9:37083932-37083954 AAATTAAATGCCCCTTTTATAGG - Intergenic
1059576071 9:115489996-115490018 AAATCACCTGCCCATCTGATTGG + Intergenic
1060726701 9:126010941-126010963 GAATGGCCTGCCCCTCTTGATGG - Intergenic
1187412804 X:19065533-19065555 TATTTACCTGCCCCTGTTGTTGG + Intronic
1187510224 X:19910903-19910925 GAGTTAGCTGCCCCTCCTCTGGG - Intergenic
1189707227 X:43770869-43770891 CAATGAACTGCCCCTCTTACAGG - Intronic
1198119658 X:133579433-133579455 GAATTACCTGACCATCATGTTGG + Intronic
1198310930 X:135425321-135425343 GACTTCCGTGACCCTCTTATGGG - Intergenic