ID: 1106403496

View in Genome Browser
Species Human (GRCh38)
Location 13:29452826-29452848
Sequence TTGTCCCCAGGGTGACTTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106403496_1106403502 13 Left 1106403496 13:29452826-29452848 CCCCTAAGTCACCCTGGGGACAA 0: 1
1: 0
2: 1
3: 18
4: 93
Right 1106403502 13:29452862-29452884 ACAGAGTCAGCTGCCTCCACTGG 0: 1
1: 1
2: 2
3: 18
4: 204
1106403496_1106403503 18 Left 1106403496 13:29452826-29452848 CCCCTAAGTCACCCTGGGGACAA 0: 1
1: 0
2: 1
3: 18
4: 93
Right 1106403503 13:29452867-29452889 GTCAGCTGCCTCCACTGGTTTGG 0: 1
1: 0
2: 2
3: 9
4: 131
1106403496_1106403504 19 Left 1106403496 13:29452826-29452848 CCCCTAAGTCACCCTGGGGACAA 0: 1
1: 0
2: 1
3: 18
4: 93
Right 1106403504 13:29452868-29452890 TCAGCTGCCTCCACTGGTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106403496 Original CRISPR TTGTCCCCAGGGTGACTTAG GGG (reversed) Intronic