ID: 1106403496 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:29452826-29452848 |
Sequence | TTGTCCCCAGGGTGACTTAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 113 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 93} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1106403496_1106403502 | 13 | Left | 1106403496 | 13:29452826-29452848 | CCCCTAAGTCACCCTGGGGACAA | 0: 1 1: 0 2: 1 3: 18 4: 93 |
||
Right | 1106403502 | 13:29452862-29452884 | ACAGAGTCAGCTGCCTCCACTGG | 0: 1 1: 1 2: 2 3: 18 4: 204 |
||||
1106403496_1106403503 | 18 | Left | 1106403496 | 13:29452826-29452848 | CCCCTAAGTCACCCTGGGGACAA | 0: 1 1: 0 2: 1 3: 18 4: 93 |
||
Right | 1106403503 | 13:29452867-29452889 | GTCAGCTGCCTCCACTGGTTTGG | 0: 1 1: 0 2: 2 3: 9 4: 131 |
||||
1106403496_1106403504 | 19 | Left | 1106403496 | 13:29452826-29452848 | CCCCTAAGTCACCCTGGGGACAA | 0: 1 1: 0 2: 1 3: 18 4: 93 |
||
Right | 1106403504 | 13:29452868-29452890 | TCAGCTGCCTCCACTGGTTTGGG | 0: 1 1: 0 2: 0 3: 18 4: 171 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1106403496 | Original CRISPR | TTGTCCCCAGGGTGACTTAG GGG (reversed) | Intronic | ||