ID: 1106407178

View in Genome Browser
Species Human (GRCh38)
Location 13:29484299-29484321
Sequence CCTGCTCTGCAGGAGGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106407178_1106407183 -2 Left 1106407178 13:29484299-29484321 CCTTAGCCCTCCTGCAGAGCAGG 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1106407183 13:29484320-29484342 GGCTCATAGCTGCCATGCAGCGG 0: 1
1: 0
2: 2
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106407178 Original CRISPR CCTGCTCTGCAGGAGGGCTA AGG (reversed) Intronic
900342697 1:2196212-2196234 CATGGTCTGCAGGAGGGCCTTGG + Intronic
901194254 1:7431674-7431696 CCTGATCTGCAGATGGGCTGGGG - Intronic
902285457 1:15405596-15405618 CCTGCTCTGCCTGAGGGCTGGGG - Intergenic
902325254 1:15695915-15695937 CCAGCTATTCAGGAGGGCTGAGG - Intronic
902393977 1:16122416-16122438 CCTGCTCATCAGCAGGGCCATGG + Intergenic
902784542 1:18724558-18724580 CATCCTCTGCAGGATGACTAAGG - Intronic
903067687 1:20709927-20709949 CCTGCATTACAGGAGGGCGAGGG - Intronic
903445145 1:23418181-23418203 CCTGCTCTGCACGAGGCCGAGGG + Intronic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904474844 1:30758011-30758033 CCTTCTCTGCACCAGGGCCAGGG + Intergenic
905279723 1:36841427-36841449 CTTGCTCTGGAGGAGGCCTGTGG - Intronic
907288402 1:53396763-53396785 CCTGCTTCCCAGCAGGGCTATGG + Intergenic
908102678 1:60807739-60807761 CCTCCTCAGCAGCAGGGCTGTGG - Intergenic
908355721 1:63323510-63323532 CGGGCTCTGCAGGATGGCCATGG - Exonic
908757534 1:67482519-67482541 CGTGCTCTTCAGGAGAGCAAAGG + Intergenic
912686194 1:111767778-111767800 CCTGCTCTGCTGGTAGGCTAGGG + Exonic
912745355 1:112241303-112241325 CCTGCTCAGAATGAGGGCTTGGG - Intergenic
914422445 1:147541750-147541772 GCTGCTCTGGAGGAGCGCTGGGG + Intronic
915118145 1:153612968-153612990 CCTCCTCTCCAGCAGGGCTCTGG + Intronic
915273833 1:154774624-154774646 CCAGATCTGCTGGAGGGCCAAGG - Intronic
916201194 1:162273126-162273148 CCTGCTCTGCAGGACAACTCTGG + Intronic
917968115 1:180191284-180191306 CCTGCAGTGCATCAGGGCTAGGG + Intronic
920305567 1:205016143-205016165 CCTGCTTTGCAGAAGGGAAATGG - Intronic
921671169 1:217925330-217925352 CCTGGGAGGCAGGAGGGCTATGG - Intergenic
922616295 1:226963086-226963108 CCTGCTCGCCATTAGGGCTAAGG - Intronic
922972520 1:229754879-229754901 CCTGCTAGGCAGGAGTTCTAAGG + Intergenic
923031111 1:230249637-230249659 CTTCCTCTGCAGGAGAGCAAAGG - Intronic
1063448621 10:6136257-6136279 CCTGCTCAGCAGGAGGTGGAGGG - Intergenic
1065046194 10:21749279-21749301 CCTGCTCTGGAGGAGCCCTGGGG - Intergenic
1066370750 10:34815904-34815926 CCGGCCCTGCAGCAGAGCTAGGG - Intergenic
1067220921 10:44343794-44343816 CTTCCTCTGCAGTAGGGCTTGGG - Intergenic
1067842438 10:49691744-49691766 CAGGCCCTGCAGGAGGGCCAGGG + Intronic
1069810840 10:71158407-71158429 CCAGCTCTGCAGGAAGACCATGG - Intergenic
1070541050 10:77415659-77415681 CCTGGTCTACAGGATGGCAATGG - Intronic
1070718759 10:78741877-78741899 CCACCTCTCCAGGAAGGCTATGG + Intergenic
1071235864 10:83647337-83647359 CCTGCTGTGCTGGAGGGCCAGGG - Intergenic
1073393783 10:103201267-103201289 ACTGCTCTGGTGGAGGGATATGG - Intergenic
1073829201 10:107362521-107362543 CCAGCTGTGCATGAGGGCCAGGG + Intergenic
1075273042 10:121069571-121069593 CATGCTCTGCAGGCGGCCTTGGG + Intergenic
1075674392 10:124286344-124286366 CCTGCCCTGCAGGAAGGGAACGG + Intergenic
1076404090 10:130201018-130201040 CCTGTTCTGCAGGAGGGGAGAGG + Intergenic
1076518152 10:131061718-131061740 CCAGCTCTGCAGGAGGAGGATGG - Intergenic
1076750938 10:132542626-132542648 CCTGCTGTGCAGGAGTGCTGGGG - Intronic
1077393492 11:2310318-2310340 CCTGCTCTCCAGGAAGGGAAGGG + Intronic
1077466045 11:2734262-2734284 CCTGCTCTGCAGCTGGGCTCCGG - Intronic
1078235401 11:9480060-9480082 CCTGGTCTGCAGGTGGCCTGTGG + Intronic
1078449885 11:11432867-11432889 CCAGCTTTGCTGGAGGGCTCGGG + Intronic
1078479465 11:11663458-11663480 CCTGCTAGGCAGGAAGGCTGAGG + Intergenic
1079098150 11:17524302-17524324 CCTTCTCTGCAGGGTGGGTAGGG + Intronic
1080359037 11:31491688-31491710 CATGCTCTGGAGAAGGGCCAAGG + Intronic
1082880031 11:58028159-58028181 CCTGCTCTGCATCAGGCCTCAGG + Intronic
1083827508 11:65211793-65211815 CCTGGTCGGCAGCAGGGCCAGGG - Exonic
1083969986 11:66069081-66069103 CCTGCTTTGTAGGAAGGCTTGGG + Intronic
1084480309 11:69416095-69416117 TGGGCTCTGCAGGAGGGCCAGGG - Intergenic
1084603348 11:70159349-70159371 CCTCCTCTGCAGGGAGGCTCAGG + Intronic
1085517420 11:77119523-77119545 CCTCCAATGCAGGAAGGCTAAGG - Intronic
1086432176 11:86746530-86746552 CCTGATTTGCAAGAGGGCTGAGG + Intergenic
1088446216 11:109931592-109931614 CCTGGTCTGCAGGCGGCCTGTGG - Intergenic
1088500279 11:110476099-110476121 CCTGCTGTGTAAGTGGGCTAGGG - Intergenic
1089354680 11:117841922-117841944 CCTGCCTGGCAGGAGGGGTAGGG - Intronic
1089457683 11:118634901-118634923 CCTGGTCGGCGGGAGGGCGAGGG - Intronic
1090478533 11:127046969-127046991 CCATCTCTGCAGTTGGGCTAGGG + Intergenic
1091387069 12:102404-102426 CCTCCTCTGCAGTCTGGCTAAGG + Intronic
1092181843 12:6451611-6451633 CCTGCGCTGCAGGAGGGCGGGGG + Exonic
1092450596 12:8598264-8598286 CCAGCTACTCAGGAGGGCTAAGG - Intergenic
1094248803 12:28335445-28335467 CTTGCTCTGCTGGAGCGCAATGG + Intronic
1095918519 12:47505100-47505122 TCTGCTCTTCAGGAGGGATGGGG + Intergenic
1096798369 12:54092665-54092687 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1096840670 12:54377926-54377948 CCTGCTCTCCAGAGGGGCTGAGG + Intronic
1096860248 12:54521340-54521362 CTTTCTCTGAAGTAGGGCTAGGG + Intronic
1097261062 12:57720548-57720570 CCTCCACTCCAGGAGGGCTGGGG - Intronic
1097849053 12:64393665-64393687 CCTGGGCTGCAGGTGGCCTATGG - Intergenic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1099272657 12:80530938-80530960 GCTACTCTGAAGGAAGGCTAAGG + Intronic
1100524676 12:95408186-95408208 CAAGGTCTGCAGGAGGGCCAGGG + Intergenic
1101811482 12:108111749-108111771 CCTGCTCAGCTGGTGGGCTCAGG - Intergenic
1102131738 12:110536293-110536315 CCTGATCTCCAGGAGGGGTAGGG - Exonic
1102277299 12:111592273-111592295 CCAGCTATTCGGGAGGGCTAAGG + Intronic
1106407178 13:29484299-29484321 CCTGCTCTGCAGGAGGGCTAAGG - Intronic
1107654260 13:42574993-42575015 GCTGCTCTGCAGGTGTGCTGGGG + Intronic
1108276892 13:48819995-48820017 CCTATTCTGCAGCAGGGCTCTGG - Intergenic
1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG + Intergenic
1113421992 13:110178091-110178113 CCTGCTGTCCAGGAAGGCCAGGG + Exonic
1113715122 13:112499343-112499365 GCTGCTCAGCAGGAGGGTTCAGG - Intronic
1116082901 14:40199124-40199146 CCTGCATTGCTGGAGGTCTAGGG - Intergenic
1118005813 14:61563407-61563429 CCCTCTCTGCTGGAGGGCTCTGG - Intronic
1118293808 14:64550143-64550165 CCGCCTCTGGAGGAGGGCGAGGG - Intronic
1121261617 14:92570270-92570292 CCTGCTCAGCAGGAAGGCCCTGG + Intronic
1121918464 14:97857815-97857837 CCAGCTCTGCAGGGGGGCTCTGG + Intergenic
1122272027 14:100572572-100572594 CCTCCCCTCCAGGAGGGGTAAGG - Intronic
1122353415 14:101110381-101110403 CCGCCTCTGGAGGAGGGCTTAGG - Intergenic
1122829657 14:104389605-104389627 CCTTCTCTCCAGGAAGGCCAGGG - Intergenic
1123701400 15:22917169-22917191 CTGGCTCTGCAGGAGGGTCAGGG - Intronic
1124259410 15:28175317-28175339 CCTGCTTTGCAGCAGGGGTTGGG - Intronic
1124317190 15:28680627-28680649 CCTGCTCAGCAGCAGGGGTTGGG - Intergenic
1125530675 15:40411477-40411499 CTTGCTCAGCAGAAGGTCTATGG + Intronic
1127097452 15:55527058-55527080 TCTTCTCTGCAGGGCGGCTATGG + Intergenic
1127464088 15:59227009-59227031 CCTGCCCTGCAGGCAGGCTGAGG + Intronic
1128234652 15:66059348-66059370 CCTCTTCTGCAGGAATGCTATGG - Intronic
1128719905 15:69940584-69940606 CCTGCTTTGGGGGAGGGCTGTGG - Intergenic
1129230595 15:74195119-74195141 GCTGCTCTGCAGGAGAGGCAGGG - Intronic
1129668991 15:77596661-77596683 CCTCCTCTGCAGAATGGCTTAGG + Intergenic
1130404180 15:83583378-83583400 CCAACTCTGCAAGAGGACTATGG - Intronic
1130722960 15:86407966-86407988 ACTCCTCTGCAGGAGGGAGAAGG + Intronic
1131512361 15:93056367-93056389 GCCGCTCTGCATCAGGGCTAAGG - Intronic
1132055621 15:98648825-98648847 CCTGCTCTGCGCGGGGGCTCCGG - Intergenic
1132178538 15:99733836-99733858 CCTTCCCCGCAGGAGGGCTCAGG - Intergenic
1132461343 16:56674-56696 CATGCTCTGCCAGAGGGCTGCGG + Intronic
1134779784 16:16885321-16885343 CCTTCACTGGAGGATGGCTAAGG + Intergenic
1137404031 16:48176187-48176209 CCTGCAGTGCAGGAGTGCTGAGG + Intronic
1138093998 16:54197958-54197980 CCTGCTCTGCAGGACGGCTTGGG + Intergenic
1138113124 16:54340208-54340230 GCTGCTCTGTAGGAAGGCTGAGG - Intergenic
1140575029 16:76157844-76157866 TCAGCTCTGCAGCAGGGCAAAGG + Intergenic
1141098465 16:81179715-81179737 GTTGCTCTGGAGGAGGGTTAAGG + Intergenic
1141328873 16:83089579-83089601 CCTGCTCTGGAGGTGGGGAATGG + Intronic
1141510697 16:84510065-84510087 CCGGCTCGGAAGGAGGGATAGGG - Intronic
1141590768 16:85067156-85067178 CCTGTGCTGCAGGACGGCGATGG + Exonic
1141879752 16:86849987-86850009 CGTGCTCTGCAGGGGGCCTCAGG + Intergenic
1142102843 16:88284767-88284789 GCAGCTCTGCAGGAGGGCGATGG + Intergenic
1142269036 16:89079581-89079603 CTGGCTCTGCAGGAGGGCGGAGG - Intergenic
1143874513 17:9981642-9981664 CCTGCTTGGCAGCAGGCCTAAGG + Intronic
1144759238 17:17698113-17698135 CATGCTTTGCATTAGGGCTATGG - Intronic
1147045512 17:37748869-37748891 CCTGTTCTGCAGGAGGTCAGGGG + Intergenic
1149259508 17:54863722-54863744 CCTCATCTCCAGGAGTGCTATGG + Intergenic
1150284777 17:63948610-63948632 CCTGCTCAGCAGTGGGGCTCTGG - Exonic
1150470265 17:65431290-65431312 CCTCCTCTGCAGCAGGGGCATGG + Intergenic
1151045348 17:70913605-70913627 TCTGCTGTGCAGGAATGCTAGGG - Intergenic
1152477379 17:80526949-80526971 CGTGCACTGCAACAGGGCTAAGG - Intergenic
1152537272 17:80957938-80957960 CCTGCGCTGCAGTATGGCTCAGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153817171 18:8800605-8800627 TCTGCTCTTCAGGATGGCTGGGG - Intronic
1155504946 18:26524180-26524202 CCTGCTTTCCAGCAGGGGTAGGG + Intronic
1156406636 18:36788909-36788931 CCTGCTCCCTAGGAGGGCAAAGG + Intronic
1156451121 18:37266959-37266981 CCAGCCCTGCAGAAGGGCTGTGG + Intronic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1158562754 18:58529090-58529112 CCTTCTCTGCACTTGGGCTATGG + Exonic
1158856044 18:61544159-61544181 CCTGTTCTGCAAGGGGGATAAGG - Intronic
1159921162 18:74228449-74228471 TCTGCTCTGCTGGATAGCTATGG + Intergenic
1161054716 19:2184561-2184583 GCGGCTCTGCAGGAGGGGTCAGG - Intronic
1164582238 19:29441839-29441861 CCTTCTCTGCATGAGGGTTGGGG - Intergenic
1164683358 19:30150579-30150601 CCTGCTATGCAGGAGGACACGGG + Intergenic
1166725548 19:45025253-45025275 CCTAACCTGCAGGAGGGCTCTGG - Intronic
1167713240 19:51124995-51125017 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
1167715831 19:51142393-51142415 CCTGCTCTGGGGGAGGGAGAGGG + Exonic
927905863 2:26855786-26855808 CTTGCTCTGCAGAAGGACAAAGG - Intronic
928140020 2:28720251-28720273 CCAGCACTGCAGGTGAGCTATGG + Intergenic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
934654175 2:96108734-96108756 CCTGCCCTGCCGGAGAGCTGGGG + Intergenic
934972778 2:98776279-98776301 CCAGCTCAGGAGGAAGGCTAGGG - Intergenic
936278935 2:111121781-111121803 CTTGCTCTGCAGGAGTCCTGCGG + Intronic
937111285 2:119368406-119368428 CCTACTCTTCAGGTGGGGTATGG + Intronic
939600932 2:144189319-144189341 CCTGCCCTGCAGGAGGGCCTTGG - Intronic
941582461 2:167316557-167316579 CCTGCCCTGCATGGGGGCTGAGG - Intergenic
942093299 2:172514593-172514615 CCAGCTCTGCAGGTGGCCCACGG + Intergenic
942578686 2:177393098-177393120 CCTGTGCTGCAGGAGGGCACAGG + Intronic
944188076 2:196971773-196971795 CCTGAACTGGAGGAGGGCCAGGG - Intronic
948904238 2:240970693-240970715 CCTGCTCCCCAGGGGGGCTCTGG + Intronic
1170598939 20:17826251-17826273 TCTGCTCTGCAGGTGGGCACAGG - Intergenic
1171798040 20:29581675-29581697 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1172479653 20:35263612-35263634 CCTGCTCTGCAGAGAGGCTTGGG + Intronic
1173727456 20:45307510-45307532 CCTGGACAGCATGAGGGCTAAGG + Intronic
1173821660 20:46023523-46023545 GCTTCTGTGGAGGAGGGCTAGGG - Intronic
1173843377 20:46173579-46173601 CCTGCCCTGCATGGGGGATAAGG - Intergenic
1173877770 20:46386201-46386223 CATGCTCTCCAGGATGGCCAGGG + Exonic
1175865324 20:62172897-62172919 CCTGGGCAGCAGCAGGGCTACGG + Intronic
1176155332 20:63617223-63617245 CCAGCACTGCAGGAGGCCGAGGG - Intronic
1176265218 20:64205644-64205666 CTGGCTCTGGACGAGGGCTATGG + Exonic
1176511287 21:7750515-7750537 CAGGCCCTGCAGGAGGGCTGAGG + Intronic
1178296129 21:31411815-31411837 TCTGGCCTGCAGGCGGGCTATGG + Intronic
1178373028 21:32042866-32042888 GCTGGTTTGCAGGTGGGCTACGG - Intronic
1178645401 21:34381044-34381066 CAGGCCCTGCAGGAGGGCTGAGG + Intronic
1178820357 21:35969548-35969570 CCTGCTCTGCCAAAGGCCTACGG + Intronic
1178827645 21:36030071-36030093 TCTGCCCTGCAGCAGGGCCAGGG + Intergenic
1179174809 21:39000675-39000697 CCTGCTTTGCAGCAGAGCCAGGG - Intergenic
1179559890 21:42208939-42208961 CCTCCTCTCCAGGAGGGCCTGGG - Intronic
1180181269 21:46119677-46119699 CCTTCTCTACAGGAGGGCTCTGG - Intronic
1180899783 22:19361874-19361896 GCTGCTCTCCAGGAGGTCTCGGG + Exonic
1181638588 22:24185474-24185496 GCTGCTCTGCAGACGGACTACGG + Exonic
1181851671 22:25754132-25754154 GCTGCTCTGGAGGAGGAGTAGGG + Intronic
1181964386 22:26646385-26646407 ACTGTTCTGCAGGACGGCTGTGG + Intergenic
1182576008 22:31273385-31273407 CCTGCTCTGCACTGGGTCTAGGG - Intronic
1182782636 22:32880420-32880442 CCTGGTCTACAGGGGGGCTCTGG + Intronic
1183273930 22:36879455-36879477 CCTGCTCTACCAGAGGGTTAAGG - Intergenic
1183360026 22:37378645-37378667 CCTGGTCTCCAGGATGGCTTGGG + Intronic
1183976086 22:41513131-41513153 CCCTCTCTGCAGCAGGGTTAGGG + Intronic
1184582733 22:45428481-45428503 CCTGGGCTGCAGGAGAGCGAGGG + Intronic
1184951330 22:47844521-47844543 CCTCCTGTGCAGGAGGGACAGGG + Intergenic
1185054086 22:48569014-48569036 CCAGCTCTGAAGGAGGGGCAGGG + Intronic
950020205 3:9781757-9781779 GCTGCTCTGCAGCAGGGTAAGGG + Intronic
950720756 3:14881033-14881055 CTTTCTCAGCAAGAGGGCTAAGG - Intronic
953072877 3:39540297-39540319 CCTGCTCTGTGGAAGGGCTTTGG + Intergenic
954373876 3:50184242-50184264 CCAGCTGTGCAGGAGGGAGACGG + Intronic
954385526 3:50241970-50241992 CCTGCAGTGCTGGAGGCCTAGGG - Intronic
959372605 3:105547224-105547246 ACTGCTCTGCAGGAGGTTGAAGG + Exonic
961332439 3:126150668-126150690 CCAGCTATTCAGGAGGGCTGAGG - Intronic
961826488 3:129601834-129601856 CCTGGTCTGCAGCAGTGCTGAGG - Intronic
966265551 3:178037622-178037644 CCAGCTCTTCAGGATTGCTATGG - Intergenic
968228075 3:196988414-196988436 CATGCTCTGCTGCAGGGCGAAGG + Intergenic
968273676 3:197423842-197423864 CCTGCACTGAAAGAGGACTAGGG - Intergenic
968908129 4:3463811-3463833 GCTGCTCTGCTGGGGGGCTCAGG - Intronic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
976119441 4:81763459-81763481 CCTGCTCTGGAGAGGGGCTCTGG - Intronic
978201913 4:106032524-106032546 CCTGCTCTGGTGGAGGTCTTAGG + Intergenic
978605599 4:110476089-110476111 GCTGCAGTGCAGGAGGGGTAGGG + Exonic
979108271 4:116715791-116715813 CCTGTTCTGCAGGAGCCCTGTGG + Intergenic
981322747 4:143411546-143411568 CCTGCTCTGCAGGATTGGCAAGG + Intronic
982375584 4:154686913-154686935 CCAGCACTGCATGAGGGTTAAGG + Intronic
985647664 5:1092674-1092696 CCTGCTCTGAAGCCGGGCGACGG - Intronic
986024901 5:3841541-3841563 CCTGCTCTCATGGAGGGCTGGGG + Intergenic
986203958 5:5605526-5605548 CCAGCTCTTCAGGAAGGCTAGGG + Intergenic
987114351 5:14714303-14714325 TCTGAGCTGCAGGAGGGCCATGG + Intronic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
992614167 5:78533931-78533953 GCTGGGCTGCAGGAGGGCTCAGG - Intronic
996738172 5:126776608-126776630 CCCGCTCCGCTGGAGGGCTCGGG - Intronic
996784125 5:127219859-127219881 CTTGCTGTGCAGGAGGTCTGAGG + Intergenic
997847139 5:137296878-137296900 CCCGTTTTGCAGGAGGGCTTGGG - Intronic
998169497 5:139864154-139864176 CCTGCTCTGCAGGATGGGATGGG + Intronic
999191221 5:149748871-149748893 GCTGCTCTGCAGAAGGGGAAAGG + Intronic
1000121588 5:158203138-158203160 CCTGCTCTCCAGCTGGGCTTTGG + Intergenic
1001825615 5:174742809-174742831 CCTGCTCTCCTGGAGGGGTTGGG - Intergenic
1001928068 5:175653569-175653591 CCTGCCTTGCCGGAGGGCTTTGG - Intergenic
1002280407 5:178126627-178126649 CCTGCGCTTCAGGAGGGTTTTGG - Intergenic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1004258861 6:14089992-14090014 CCTGCTCCCCAGAAGGGCAAAGG - Intergenic
1004332825 6:14737150-14737172 CATGCTCTGCAAGAGTGCAATGG + Intergenic
1004518428 6:16340285-16340307 CCTGATCTCCAGGAGGGCCTAGG + Intronic
1004721984 6:18275741-18275763 CCAGCACTTCAGGAGGGCAAGGG + Intergenic
1005960601 6:30690419-30690441 CCAGGTTTGCAGGAGGCCTAGGG - Intronic
1007422698 6:41729105-41729127 CCTCCCCTGCAGCAGGGCTGTGG + Intronic
1010892962 6:81336889-81336911 CCTGCTCTGTAGCAGTGCTCAGG + Intergenic
1010915126 6:81606719-81606741 CCATCTCAGAAGGAGGGCTAGGG + Intronic
1013635030 6:112021029-112021051 CCTGCTTGGCATGTGGGCTATGG + Intergenic
1014158467 6:118138789-118138811 CCTGGTCTTCAGGAGCACTAAGG + Intronic
1016839983 6:148516445-148516467 CCTGCTCTGCAAGATGGACAGGG - Intronic
1017009041 6:150050236-150050258 CCTGATCTGCTGGAGGCCTCTGG + Intergenic
1017628240 6:156369968-156369990 CCTGCTCTGCAGCATAGCTGGGG - Intergenic
1017772206 6:157652072-157652094 CCTCCTCTGCAGGATGTCAAAGG - Intronic
1019204136 6:170344777-170344799 TCTGCTATGCAGGAGGACTCTGG - Intronic
1021674799 7:23069265-23069287 CCTGACCTGCAGGTGGGCTGGGG - Intergenic
1022098089 7:27153077-27153099 CCTGGTCTGCAGGCGGGGTGGGG + Intergenic
1023401491 7:39795096-39795118 CCTGCACAGCAGCAGGGGTAGGG + Intergenic
1024575682 7:50762211-50762233 GCTGCTGTGCAGAAGGGCTGGGG - Intronic
1025917099 7:65873867-65873889 CCGGCTGTGCAGGAGCGCGAGGG + Intronic
1026649992 7:72208859-72208881 GCTGCTCTCCAGGAAGGCTGGGG + Intronic
1027185567 7:75968747-75968769 CCTGCTCTGCCCCAAGGCTAGGG - Intronic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1034254553 7:149717360-149717382 CCTGCTTGCCAGGAGGGCTCAGG - Intronic
1034883012 7:154776602-154776624 CCAGTTCTGCAGCAGGGCTCTGG + Intronic
1035372320 7:158387339-158387361 CCTGCACCACAGGAGGGCTGAGG + Intronic
1036254569 8:7195047-7195069 CCAGCTATTCAGGAGGGCTGAGG + Intergenic
1036362924 8:8092441-8092463 CCAGCTATTCAGGAGGGCTGAGG - Intergenic
1036730206 8:11256215-11256237 CCTGCCCTTCTGGTGGGCTAAGG - Intergenic
1039414352 8:37380590-37380612 CCTGAGCTGCAGGAGGCCCATGG - Intergenic
1040079594 8:43274152-43274174 CCTGCCCTGCAGGATGGCCCAGG - Intergenic
1043516054 8:80996162-80996184 GCTGCTCTGCAGGAGGACTGTGG + Intronic
1048986289 8:139736892-139736914 CCTGCTCAGCAGGGTGGCTGTGG - Intronic
1049426363 8:142539665-142539687 CCTGCTCAGCAGGAGTGCCAGGG - Intronic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1050598168 9:7224794-7224816 TCTGCTCTGGAGGTGGGGTAGGG + Intergenic
1051681323 9:19610935-19610957 CCTGCTCTGTTGGAGGAATAAGG + Intronic
1052778896 9:32760427-32760449 CCTGCTATGCAGGAGATCTGCGG - Intergenic
1053577134 9:39364348-39364370 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1053787976 9:41665779-41665801 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1053841638 9:42192273-42192295 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054098705 9:60923038-60923060 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054120105 9:61198667-61198689 ACTGAGCTGCAGAAGGGCTAAGG - Intergenic
1054157156 9:61648989-61649011 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1054176252 9:61877121-61877143 CCTGCTCTGCATGAAGGGTCAGG - Intergenic
1054476931 9:65579994-65580016 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1054587651 9:66983895-66983917 ACTGAGCTGCAGAAGGGCTAAGG + Intergenic
1054661287 9:67703687-67703709 CCTGCTCTGCATGAAGGGTCAGG + Intergenic
1055088935 9:72343110-72343132 CCTGCTCTGAAGAAGGGCTAAGG - Intergenic
1055805862 9:80092635-80092657 CATTCTCTGAAGGAGGGCTGAGG + Intergenic
1055960756 9:81818122-81818144 CCATCTGTGAAGGAGGGCTAGGG + Intergenic
1057271042 9:93651636-93651658 CCTGCTCTGTGGCAGGTCTAGGG + Intronic
1057938193 9:99258116-99258138 CCTGCCTTCCAGGAGGGCTTGGG - Intergenic
1058206048 9:102109381-102109403 ACTGCCCTGCAGGATGCCTAAGG + Intergenic
1059471213 9:114505684-114505706 CCGGCTCTGCCGGCGGGGTAGGG - Intergenic
1060739179 9:126086693-126086715 CCTGCTGTGCTTGAGGACTATGG - Intergenic
1060802081 9:126551236-126551258 CCTCCTCTGCAGGAAGGCTGCGG - Intergenic
1061937513 9:133866362-133866384 CCTGCTCTGCAGAAGGCGTAGGG - Intronic
1062331947 9:136048775-136048797 CCAGCACTGCAGGAGGGGAAGGG + Intronic
1062523634 9:136969713-136969735 CCTCCTCAGCAGCGGGGCTAAGG - Intronic
1189125173 X:38438078-38438100 CCTGTTCTGCAGCAGGTCTTGGG - Intronic
1190290843 X:48991092-48991114 CCAGCCCTGCAGGAACGCTATGG - Exonic
1190373246 X:49763496-49763518 CCAGCTACGCAGGAGGGCTGAGG - Intergenic
1190534087 X:51408459-51408481 CCTGCTCTTCTGGAGGGACAGGG - Exonic
1191015524 X:55805949-55805971 CTTGCTCTGCATCAGGGCTTTGG + Intergenic
1191754892 X:64582339-64582361 CCTGCTTTGCAGGATGGCTGAGG + Intergenic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1200052937 X:153444413-153444435 CCTGCTCAGCAGGGGGTCGAGGG + Intergenic