ID: 1106409506

View in Genome Browser
Species Human (GRCh38)
Location 13:29501429-29501451
Sequence GTCCTCCTGCAGCACTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106409497_1106409506 24 Left 1106409497 13:29501382-29501404 CCCCACCTTGAGAGAAATGAGTG 0: 1
1: 0
2: 1
3: 23
4: 152
Right 1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG 0: 1
1: 1
2: 5
3: 35
4: 269
1106409498_1106409506 23 Left 1106409498 13:29501383-29501405 CCCACCTTGAGAGAAATGAGTGA 0: 1
1: 0
2: 2
3: 10
4: 176
Right 1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG 0: 1
1: 1
2: 5
3: 35
4: 269
1106409499_1106409506 22 Left 1106409499 13:29501384-29501406 CCACCTTGAGAGAAATGAGTGAA 0: 1
1: 0
2: 0
3: 28
4: 228
Right 1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG 0: 1
1: 1
2: 5
3: 35
4: 269
1106409500_1106409506 19 Left 1106409500 13:29501387-29501409 CCTTGAGAGAAATGAGTGAAATC 0: 1
1: 0
2: 1
3: 28
4: 229
Right 1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG 0: 1
1: 1
2: 5
3: 35
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106409506 Original CRISPR GTCCTCCTGCAGCACTGGGA GGG Intronic
900335475 1:2160928-2160950 CTCCTCCTGCAGCCCTGAGGAGG - Intronic
900390293 1:2430915-2430937 GCCCACCTGCTGCACTGGGGGGG + Intronic
900520378 1:3102480-3102502 GCCCACCTGCAGCTCAGGGATGG - Intronic
900587883 1:3442148-3442170 GTCCTCATTCAGGACAGGGAAGG + Intergenic
901669883 1:10849974-10849996 GTCCTGCTGGGGCAATGGGAGGG - Intergenic
901965803 1:12864771-12864793 CTGCTGCTGCAGCAGTGGGATGG - Intronic
902020116 1:13339485-13339507 CTGCTGCTGCAGCAGTGGGATGG + Intergenic
902276991 1:15347011-15347033 TTTCTCCTGCAGCAGTGGGTGGG - Intronic
902436789 1:16403249-16403271 TTCCTCTTGCTGCACTAGGAGGG + Intronic
903613719 1:24636513-24636535 GTCCTTCTGTAGCAGGGGGAGGG - Intronic
903780634 1:25817996-25818018 CTTCTCCTGCTGCTCTGGGAGGG + Exonic
903995000 1:27300160-27300182 CTCCTTCTGCAGCACTCAGAGGG - Intronic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
905492642 1:38356502-38356524 GTCATACTGCAGAACTAGGAAGG - Intergenic
909814209 1:79970841-79970863 GTCCTTCAGCAGCACTAAGAGGG - Intergenic
915076523 1:153312568-153312590 GTCTTCATTCAGCAATGGGACGG - Intergenic
916382621 1:164229234-164229256 GTCCCCTTTCAGCATTGGGAGGG - Intergenic
917104656 1:171480295-171480317 TTCTTCCTGCAGCTCTGTGAGGG + Intergenic
917734365 1:177907122-177907144 GTGCTCCTGCAGGGCTGAGATGG - Intergenic
919201279 1:194358218-194358240 GTCCACCTGCAGCCCTGGTGTGG - Intergenic
919752709 1:201048245-201048267 GTTCTCAGGCAGCACTGGGCAGG - Intronic
921905253 1:220488938-220488960 TTACTCCAGCAGCACTGGGGAGG - Intergenic
922079357 1:222279859-222279881 CTCCTCCAGCAGCACTGCTAAGG + Intergenic
922097085 1:222451814-222451836 GTCATCCTGCTGCTCTGGGCAGG - Intergenic
923248858 1:232160892-232160914 GGCCTCTTGCAGGACTGGGATGG + Intergenic
924235878 1:241999179-241999201 GACCTCCTGCTGCCCAGGGAGGG - Intergenic
924612282 1:245583609-245583631 GTCCTCCGGCAGCATTGGAGAGG - Intronic
1063105518 10:2988429-2988451 AACCTACTGCAGCACTGGGAAGG - Intergenic
1064585551 10:16836561-16836583 TTCCTCCTGCCCCTCTGGGAAGG - Intronic
1065800113 10:29344361-29344383 GTCCGCATCCAGCACAGGGAGGG - Intergenic
1067544203 10:47181182-47181204 TTCCTCCTCCAGCCCTCGGACGG - Intergenic
1067659538 10:48224142-48224164 GTCCTCCAGTACCCCTGGGAGGG + Intronic
1068646900 10:59478234-59478256 GTCATTCTACAGCACTGGAAGGG - Intergenic
1068827082 10:61452684-61452706 GTCCCAGTGCAACACTGGGAAGG - Intronic
1069728438 10:70596053-70596075 ACCCTCCTGTAGCACTAGGAAGG + Intergenic
1070098795 10:73365525-73365547 GGCCTCCTGAAGTGCTGGGATGG + Intergenic
1071849220 10:89551485-89551507 GTGCTCCATCAGCACTGGGTTGG - Intronic
1072888005 10:99297270-99297292 GTTCAACTGCAGCAGTGGGAAGG - Intergenic
1073242789 10:102069130-102069152 GGCCTCCTCCAGAACTTGGATGG + Intergenic
1073432349 10:103494482-103494504 GTCCTCCAGCAGCGCTCGGCCGG - Intronic
1076231173 10:128821159-128821181 GGCCTCCTGCAGCCCTGGGATGG - Intergenic
1077306973 11:1872873-1872895 GCCCTCATGCAGCACTGGGTGGG + Intronic
1077411967 11:2407869-2407891 GTCCTCCAGCAGCAGTGGGTGGG + Exonic
1078729382 11:13961944-13961966 GTCCTCCTACAGCCCAGGAAAGG - Intergenic
1078933951 11:15936105-15936127 GAACTCCCCCAGCACTGGGAAGG + Intergenic
1079529029 11:21426873-21426895 GTCCATCTGGAGCACTGGCATGG + Intronic
1080001746 11:27358622-27358644 TTCCTTCTGCAAGACTGGGAAGG - Intronic
1081669619 11:44935708-44935730 GTCCTCCTGCCCTGCTGGGAGGG - Intronic
1083186297 11:61019754-61019776 CTCCTGCAGCAGCACTGGCATGG - Exonic
1083730103 11:64648272-64648294 GTCTGCTTGCAGCAGTGGGATGG - Exonic
1084495326 11:69500107-69500129 CGCCTCCGGCAGCACTGTGATGG + Intergenic
1084679888 11:70660818-70660840 GGCCTCCTGCAGCACAGGTGCGG + Intronic
1085033706 11:73287826-73287848 GATCTCCTGGAGCACTGGGTGGG + Intronic
1085390726 11:76180824-76180846 GTCTTCCTGCAGGCCTGTGATGG - Intergenic
1086294244 11:85347263-85347285 CTCCCCCTGAAGCACAGGGAGGG + Intronic
1089376450 11:117998643-117998665 CTTCCCCGGCAGCACTGGGATGG + Intronic
1090236123 11:125148674-125148696 GGCCTGCTGCAGAGCTGGGAGGG - Intergenic
1091216630 11:133906336-133906358 GCCCTCCTGCAGCCCGTGGACGG - Intergenic
1091590330 12:1838946-1838968 AGCCACCTGCAGCACTTGGAAGG - Intronic
1091613995 12:2035215-2035237 GGCCTCCTTCAGGACTTGGAAGG - Intronic
1091705222 12:2688910-2688932 GCCCTCCTGCAGCCCTGAGAGGG - Intronic
1091763120 12:3100696-3100718 GTCATCCTTCTGCACTGGGGTGG + Intronic
1092728853 12:11509604-11509626 GTCCTCCTGCAGTAGTGAGAGGG - Intergenic
1094011219 12:25811920-25811942 CTCATCCTGCTGCACTGGAAGGG - Intergenic
1094486939 12:30933066-30933088 GTCATCCTGCGGCTCTGGCAGGG - Intronic
1099732782 12:86526318-86526340 CTCCTGCTGCAGCAGTGGCAGGG + Intronic
1101064218 12:101002514-101002536 GTGCTCCTGCAGCATGGGAATGG + Intronic
1101447821 12:104750238-104750260 GTCCTCATGCAGCACAGAAAGGG + Intronic
1102011548 12:109622229-109622251 TGCCTCCTGCAGCTCGGGGAGGG + Intergenic
1102423755 12:112824507-112824529 GTCCACCGGCAGATCTGGGATGG - Intronic
1103793796 12:123489840-123489862 GTGGGCCAGCAGCACTGGGATGG - Intronic
1103817668 12:123671588-123671610 CTCGTCCTGCAGCACTGCCAGGG - Exonic
1104405169 12:128510992-128511014 GTCCTCCAGCAGGACCTGGAAGG - Intronic
1104765658 12:131328378-131328400 GTCCACCTGCATCTCTGGGGGGG - Intergenic
1105029576 12:132873525-132873547 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1105029594 12:132873615-132873637 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1105029612 12:132873705-132873727 GTCCTCCTGCTCCACAGGGCTGG + Intronic
1105239823 13:18599105-18599127 GCCCTCCTGTAGCTATGGGACGG + Intergenic
1106216940 13:27710792-27710814 GTCCTCATTCAGGGCTGGGAGGG - Intergenic
1106407669 13:29487964-29487986 GTCATCCTGCAGGATTGTGATGG - Exonic
1106409506 13:29501429-29501451 GTCCTCCTGCAGCACTGGGAGGG + Intronic
1106590097 13:31091532-31091554 TTCCCCTTGCAGCACTGGGGGGG - Intergenic
1107317905 13:39153379-39153401 GTTCTCCTGCAGCACTGATCTGG - Intergenic
1108363785 13:49691125-49691147 GACTTCCTGCAGCAGGGGGAGGG + Intronic
1110181279 13:72620422-72620444 GTGCACCTGCTGCAATGGGATGG + Intergenic
1112280195 13:98056181-98056203 GTCCTCCAGCTTCACTGAGAGGG + Intergenic
1113450757 13:110407771-110407793 GTCCTCACACTGCACTGGGAGGG - Intronic
1113715952 13:112508052-112508074 GGCCCCAGGCAGCACTGGGATGG - Intronic
1113857592 13:113456535-113456557 GCCCCCCTGCAGCACTGTGCAGG - Intronic
1114526913 14:23372247-23372269 GTCTTCCAGCAGCCCTGTGAGGG + Intergenic
1114725761 14:24934991-24935013 GGTCTCCTGGAGCAATGGGATGG + Intronic
1118478585 14:66141651-66141673 CTCCCGCTGCAGCACTGGTAAGG - Intergenic
1118640691 14:67789516-67789538 GTCCTCCTGGAGCATGGGGATGG + Exonic
1119190776 14:72680366-72680388 TTCCTCCTGGAGCCCTGGGGCGG - Intronic
1119197494 14:72728016-72728038 CTTCTCATGCAGCACTGGGCTGG - Intronic
1119860158 14:77930428-77930450 GCCTCCCAGCAGCACTGGGAAGG - Intronic
1121020249 14:90575570-90575592 GTCCTGCAGCACCAGTGGGAGGG + Intronic
1121537341 14:94699942-94699964 GTGCCCCTGCAACACTGGGGTGG - Intergenic
1122238918 14:100348963-100348985 GTCCCCCTGCACAGCTGGGACGG + Intronic
1122427355 14:101619760-101619782 GTCCTCCTCCAGCCCTGGACAGG - Intergenic
1122834802 14:104425395-104425417 GACACCCTGCAGCACCGGGAGGG + Intergenic
1123625379 15:22223486-22223508 GGCCTCCTGAAGCCCTTGGATGG + Intergenic
1124363163 15:29053732-29053754 GTCCTCCCGCAGCCATGTGAGGG - Intronic
1125105089 15:35961559-35961581 CTGTTTCTGCAGCACTGGGATGG - Intergenic
1126595672 15:50382435-50382457 CCCCTCCTCCAACACTGGGAGGG - Intergenic
1127467721 15:59260499-59260521 GTGCTTCTGCTGCAGTGGGAAGG + Intronic
1128317074 15:66667676-66667698 GTCCTCCTGGAGGGCTGAGAGGG + Intronic
1131300233 15:91193203-91193225 CTCCTCCTGCGGCACTTGCAGGG - Intronic
1131883551 15:96884698-96884720 GTCGTCCTGTTGCACTGAGATGG + Intergenic
1132522378 16:397613-397635 GGCCGGCTGCAGCACTGGGCGGG + Intronic
1132585403 16:704015-704037 CTCCTCCTGCACCACTGGTGGGG + Intronic
1133838086 16:9384126-9384148 CTTCTCCTTCAGCACTGTGACGG + Intergenic
1134247888 16:12553508-12553530 TCCCTCCTCCAGCACTGTGATGG - Intronic
1135658073 16:24268965-24268987 GTTCTCATGCAGCACTCAGATGG + Intronic
1137761053 16:50940627-50940649 GTGCTCCTGCAGCAGAGGGCGGG - Intergenic
1139537569 16:67587214-67587236 GGCCTCCTGCAGTGCTGGAATGG + Intronic
1141720311 16:85751874-85751896 TTCCTCCTGCCCCACTGGGCAGG - Intergenic
1141795713 16:86272346-86272368 CACCTCCTCCAGCCCTGGGAAGG - Intergenic
1141885888 16:86891936-86891958 GGCCTCCTGAAGCATTAGGATGG - Intergenic
1142395396 16:89828740-89828762 GACCTCCTGCTGCGCGGGGACGG + Exonic
1142596833 17:1033855-1033877 GTCCTCCTGGAGCCCTGGAAGGG - Intronic
1142687534 17:1586316-1586338 GACTTCCTGGAGCTCTGGGAAGG - Intronic
1143186243 17:5012244-5012266 GTCCTTCTGCAGCAGAGGCAGGG + Intronic
1143242335 17:5454431-5454453 GTCTTACAGCAGAACTGGGAGGG - Intronic
1143250999 17:5522930-5522952 CTCCTCCTCCAGCACTGTGTGGG + Intronic
1143408715 17:6695866-6695888 CTCCTCCTGCAGCACCTTGAGGG + Exonic
1143523074 17:7456572-7456594 GTCCTCCTTCAGCTGTGGGTAGG - Exonic
1144733772 17:17543410-17543432 GAGCTCCTGCGGCACTGGGAAGG + Intronic
1144863003 17:18317535-18317557 CTCCTCCTGCTGTATTGGGAAGG + Exonic
1145250839 17:21296184-21296206 TTCGTCCTGCAGCACTGTGCGGG + Intronic
1145296219 17:21594187-21594209 CTCTTCCTGCAGCTCAGGGATGG + Intergenic
1145859143 17:28192786-28192808 GTCCTGCTGCAGCATTAGTATGG + Intronic
1146926835 17:36751300-36751322 GTCCTCCTGCGCCAATGGGCTGG - Intergenic
1147458475 17:40553479-40553501 ATCCTACTGCAGCTTTGGGAAGG - Intergenic
1147660622 17:42115154-42115176 CTCCTCCTGGGGCACTGTGAGGG + Intronic
1148048926 17:44759737-44759759 GTCCTGCTGGAGCTCTGCGATGG + Exonic
1148103953 17:45109419-45109441 CTCCTCCTGCACCACTGGCCGGG + Exonic
1148392711 17:47284461-47284483 CTCCACCTGCCGCACTTGGATGG - Exonic
1149639571 17:58193946-58193968 CTCCTCCTGCAGCCATGGGTGGG - Exonic
1149681750 17:58512480-58512502 CTCACCCTGCAGCACTGTGAAGG + Exonic
1149856752 17:60089241-60089263 CTCGTCCTGCAGCTCTGGGGTGG + Intergenic
1150129509 17:62659712-62659734 GTCCTCTAACAGCACTTGGATGG - Intronic
1151917336 17:77127968-77127990 TCCCTCCTGCAGCTCTGGGAAGG - Intronic
1152169111 17:78732010-78732032 ACCCTCCTGAAGCACAGGGAGGG + Intronic
1152269533 17:79315953-79315975 GTCCGCCAGCAGCTCTGGGAGGG + Intronic
1153900846 18:9615197-9615219 TTCCTCGTGCAGCACGGTGAAGG + Intronic
1154449007 18:14459669-14459691 GCCCTCCTGTAGCTATGGGACGG - Intergenic
1157377001 18:47176203-47176225 CTCCTCGTGCAGCACTGCGATGG + Exonic
1157809363 18:50683773-50683795 GTTCTCCTGCAGCTCTGGGAGGG - Intronic
1158905133 18:62004305-62004327 GCCCTCCTGAAGCACTGGGGTGG - Intergenic
1159006691 18:63019671-63019693 GTACACCTTCAGCCCTGGGAGGG - Intergenic
1160798368 19:955939-955961 CTCCTCCTGCAGCCCCTGGAGGG - Intronic
1161235653 19:3196793-3196815 CTGCTGCTGCAGCACTGGCAGGG + Intronic
1161574569 19:5048505-5048527 GTCCTCCTCCAGCGCGAGGACGG - Intronic
1162341407 19:10093510-10093532 GTTCTCCTGGAGGACTGGGGGGG - Exonic
1163125740 19:15243324-15243346 ATCCTCCAGCAGCACTTGGGGGG + Exonic
1163132813 19:15286273-15286295 GTCTTGCTGCAGCACTGTGTTGG - Intronic
1163384836 19:16993295-16993317 GTACTCCTGCAGGGCTGGGACGG + Intronic
1163483427 19:17572396-17572418 GGCCTCCTGAAGCCGTGGGATGG + Intronic
1163598245 19:18232909-18232931 GGCCTCCTGCAGCGCGGGGGAGG - Intronic
1167030620 19:46957357-46957379 GGCCTCCAGAAGCACTGGGATGG - Intronic
1167336289 19:48888085-48888107 GTCCTCCTCCAGCCCAGGGCAGG + Exonic
1168669354 19:58229215-58229237 CTCCTGCTGCAGAGCTGGGAGGG + Intronic
924962073 2:44970-44992 GTCCACCTGCAGCCCTAGGTAGG - Intronic
927937736 2:27085066-27085088 GTCCTCGGGCAGCCCTGGGCTGG + Intronic
929137949 2:38643019-38643041 CTCCTCCTGCGGCCCTGGGGAGG - Intergenic
929382023 2:41364933-41364955 CTCCTGCTGCAGCAGTGGCAGGG - Intergenic
929614354 2:43296735-43296757 GTCCTCTAGCAGCAGTGGGTAGG - Intronic
929996124 2:46827200-46827222 GTCCACCTGCAGGAGTGGGTGGG - Intronic
932376820 2:71243785-71243807 GGGCTCCTGCAGCCCTGGAAAGG - Intergenic
932406101 2:71513434-71513456 CTCCTCCTGCAGGACTTGGCGGG + Intronic
933809980 2:86027124-86027146 GGCCTCCTGCAGCACAGGTGAGG + Exonic
936252057 2:110874600-110874622 GGCCTCCTTCAGCACAGGGGAGG + Intronic
936935663 2:117836432-117836454 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
936935677 2:117836480-117836502 GTCTCCCGGCAGCCCTGGGAAGG + Intergenic
937106946 2:119324728-119324750 CCCCTCCTGCAGCACTGAGAAGG + Intronic
937195956 2:120156504-120156526 CTCCTGCTGCAGCAGTGGCAGGG - Intronic
937355413 2:121195275-121195297 GTCCTGAAGCAGGACTGGGATGG + Intergenic
942578684 2:177393093-177393115 GCCCTCCTGCAGCACAGGCCCGG - Intronic
944586649 2:201178903-201178925 GTCCTCCTTCAGGCCAGGGAGGG + Intergenic
946172005 2:217901166-217901188 GCCATCCTGCTGCCCTGGGATGG - Intronic
947564345 2:231184465-231184487 GACGTCCTGCAGCGCTGGGTGGG + Intergenic
948587302 2:239027512-239027534 GTCCTCATGCAGCACTGCCAAGG - Intergenic
1168766941 20:388224-388246 GTCCTCCTGGAGCCCGAGGAGGG + Exonic
1169306450 20:4494996-4495018 GCCCTTCTGAAGCACTGGCATGG - Intergenic
1171048266 20:21831938-21831960 GTGCGCCTGCACCACAGGGAAGG + Intergenic
1172599351 20:36173300-36173322 GTCCAGCTTCAGCACTGGAAAGG + Intronic
1172664149 20:36587499-36587521 GTACTCCTGCAGCACAGGTATGG + Intronic
1173743867 20:45421488-45421510 GTCCAGCAGCAGCACCGGGAAGG - Exonic
1173769992 20:45647969-45647991 GACCTTCTCCAGCACTGGGCTGG - Intergenic
1173943262 20:46930155-46930177 GTCCTCCTGAAGAACAGGGCTGG + Intronic
1177460570 21:21403430-21403452 TTCCATCTGCAGCTCTGGGAGGG - Intronic
1177724690 21:24951580-24951602 GCCCTTCTGCAGCAAAGGGAAGG + Intergenic
1178518329 21:33266785-33266807 GTCCTCCTGCAGCTCTCTGCTGG + Intronic
1178622429 21:34188237-34188259 GTCCTGCTGCAGCACGTGGGCGG - Intergenic
1178894597 21:36548359-36548381 GGCCTGATGCAGCTCTGGGACGG - Intronic
1180017418 21:45096421-45096443 GTCTTCCTGCAGGTCTGGGCTGG + Intronic
1181309725 22:21938134-21938156 GGGCTCCTGCAGGCCTGGGAAGG - Intronic
1181547111 22:23608304-23608326 GTCCTCCTCCAGGACACGGAAGG - Intergenic
1182516950 22:30864487-30864509 CTCTGCATGCAGCACTGGGATGG + Intronic
1182630656 22:31682808-31682830 GACCTCCTGTAGCTCTGGGCAGG + Exonic
1183220939 22:36512592-36512614 GCTCTCCTGCAGCACTGTAATGG - Exonic
1184777463 22:46630606-46630628 GAGCTCCTGGAGCACTGAGAGGG - Intronic
1185367641 22:50444182-50444204 GTCTTCCTGCAGGAATGGGGTGG - Exonic
950076964 3:10194102-10194124 GTCATCATGGAGCCCTGGGACGG + Intronic
951579145 3:24143693-24143715 GTCATCCAGCACCACTGGGAGGG + Exonic
951930930 3:27966379-27966401 GTCTTCCTGTGGCTCTGGGAAGG - Intergenic
952877931 3:37963112-37963134 CTAATCCTGCAGCACTGTGACGG - Intronic
953664166 3:44914159-44914181 GTGCTCTCTCAGCACTGGGATGG + Exonic
954107028 3:48414964-48414986 GTCCTCAGGCAGGCCTGGGAGGG + Exonic
956482794 3:69689668-69689690 GTCCTCCTTCAGGAGGGGGAAGG - Intergenic
961385137 3:126518862-126518884 GCCCTTTTGCAGCACAGGGAGGG + Intergenic
968187910 3:196646007-196646029 GTCCTCCTGCAGGCCTTGGAAGG + Intronic
968613432 4:1567205-1567227 CTCCTCCAGCTGCCCTGGGAGGG - Intergenic
968616255 4:1579081-1579103 GGCGTCCAGCAGCGCTGGGAAGG - Intergenic
968962683 4:3753342-3753364 GCCCTCCTGCACCCCTGGAAGGG - Intergenic
969556726 4:7916604-7916626 CCCCTCCTGCAGGAGTGGGAAGG + Intronic
970969016 4:21959973-21959995 GTCCCACTGAAGAACTGGGACGG + Intergenic
971453227 4:26819352-26819374 GTCCTGCTTCAGCTCTGGGGTGG + Intergenic
973140824 4:46765935-46765957 GGCCTACTCCAGCACTAGGATGG + Intronic
973736037 4:53872518-53872540 ATCCTCCTGCACCACTGCTAGGG + Intronic
976520560 4:86021555-86021577 CTCCACCTGCAGCCCTGGTACGG - Intronic
981989624 4:150902396-150902418 ATTCTCCTGCCTCACTGGGATGG - Intronic
982205888 4:152996835-152996857 GTCTTCCTGCAGCCCAGGTAGGG - Intergenic
983673000 4:170259855-170259877 GCCTTCCTGAAGCACTGAGATGG + Intergenic
984819977 4:183873579-183873601 TTCCTCCTGGAGCACTGTGCTGG + Intronic
986077032 5:4348382-4348404 GTCCTCCTTCAACAGTGGAATGG + Intergenic
986639457 5:9858026-9858048 GACCACCCCCAGCACTGGGATGG - Intergenic
987048303 5:14127662-14127684 GTGCACCTGCAGCATGGGGAAGG + Intergenic
987292244 5:16520085-16520107 GTCCCCCAGCAGCCCTTGGATGG - Intronic
988035505 5:25823265-25823287 CTCCTCCTGCAGCCCTGGCATGG - Intergenic
988836851 5:35041519-35041541 GCCCCCCTGCAGCAGTGGGATGG + Intronic
989622392 5:43397269-43397291 TTTCTCCTGCAGCTCTGTGAAGG - Intronic
991609497 5:68435810-68435832 TTCCTCCGGCAGCACAGGGCAGG + Intergenic
993501843 5:88674572-88674594 GTCCTCCGGCTGCACTTGGCGGG - Intergenic
995513224 5:112928520-112928542 AGCCTCCTGCAGCAGAGGGAGGG - Intergenic
996522421 5:124441909-124441931 CTCCTCCAGAAGCACAGGGAAGG + Intergenic
996544323 5:124661584-124661606 GCTCTCCTCCAGCACAGGGAAGG + Intronic
996630088 5:125620363-125620385 GTCATCCTGAAGAACTGGGCTGG - Intergenic
996954230 5:129164204-129164226 CTCCTGCTGCAGCAGTGGCAGGG + Intergenic
998054473 5:139062589-139062611 GTCCTCCTTGAGGACTGGAAAGG - Intronic
1001787137 5:174423567-174423589 GTCTTCCAGCAGCACCTGGAAGG + Intergenic
1001934367 5:175694079-175694101 GTCCTTCCCCAGCCCTGGGAGGG - Intergenic
1001950471 5:175813044-175813066 GTGCTCATACAGCCCTGGGAGGG - Intronic
1002060091 5:176620838-176620860 TTCCTCCTGCATCACCGGGATGG + Exonic
1002068083 5:176662515-176662537 GACCTCCTGCTTCACTGGGCAGG + Intergenic
1003270456 6:4603291-4603313 ATCCTCCAGGAGCCCTGGGAGGG + Intergenic
1006388062 6:33743035-33743057 CTGCTGCTGCAGCACTGGCAAGG - Intronic
1006508199 6:34504698-34504720 ATCCTCCTGGAACACTGGGGAGG - Intronic
1007468271 6:42070632-42070654 GTGTTCCTGCAGTACAGGGAGGG + Intronic
1007933586 6:45713990-45714012 GGCTTTCTGCAGCACTGGGAGGG - Intergenic
1011002513 6:82606890-82606912 GCCCTGCTGCAGCACTGTGATGG + Intergenic
1014017850 6:116554102-116554124 GTTCTTCAGCATCACTGGGAGGG + Intronic
1017755485 6:157525781-157525803 GGCATCCAGCAGCAGTGGGACGG - Intronic
1018185727 6:161264284-161264306 AGCATCCTGCAGCTCTGGGAGGG - Intronic
1019176600 6:170162412-170162434 GCTCTCCTGCCTCACTGGGAGGG - Intergenic
1019388361 7:771275-771297 GCCCTCTAGGAGCACTGGGAGGG + Intronic
1019773345 7:2897315-2897337 TTCCTCCTGCAGCACTGGGCTGG + Intergenic
1019776332 7:2913867-2913889 GTCTCCCAGGAGCACTGGGAGGG + Intronic
1022020864 7:26398515-26398537 TTCCTCCTCCAGCACCGGGCCGG + Intergenic
1023252462 7:38280136-38280158 GTCATCCTGCAGCAGGGGGAAGG - Intergenic
1024555380 7:50599058-50599080 CTTCTCCTGCAGTTCTGGGACGG + Intronic
1024623889 7:51188056-51188078 GTCCTGCTGCAGCAGTGAGAAGG + Intronic
1026548586 7:71347046-71347068 GTCTTCACGCAGCAATGGGATGG + Intronic
1027133620 7:75609158-75609180 CTTCTCCTGCAGCTCTGGGGGGG + Intronic
1027222788 7:76224478-76224500 TTGCTCCTGCAGGACTGGGTGGG + Intronic
1027978130 7:85185177-85185199 TTCCACGTGCAGAACTGGGAAGG + Intronic
1028604973 7:92645530-92645552 GTGCTCCTGCAACCCGGGGAGGG + Intronic
1033288172 7:140060330-140060352 GTCCTGCTGCAGAGCTGGTACGG - Intronic
1034982679 7:155488835-155488857 TTCCTCCTGCAACCCTGAGAGGG + Intronic
1035923031 8:3699142-3699164 GAACTCCTTCAGCAGTGGGATGG + Intronic
1037239434 8:16760488-16760510 CTCCTCCTGCAGCCCTGGTGTGG - Intergenic
1038170731 8:25128963-25128985 CTCCTGCTGCAGCAGTGGCAGGG - Intergenic
1038367741 8:26953695-26953717 CTTGTCCTGCAGCACTGGCAGGG + Intergenic
1039965150 8:42278623-42278645 GTCTGCCTGCATCACTGGGACGG - Intronic
1040423525 8:47261399-47261421 CTCTTCCTGCCGCACTCGGAGGG + Intronic
1041398018 8:57411613-57411635 GTCATCCTGCAGCAATAGGATGG - Intergenic
1043800896 8:84608330-84608352 CACCTCATGCAGGACTGGGATGG + Intronic
1044725305 8:95189960-95189982 GTCCTCATACAGCACTGGGAGGG - Intergenic
1046794516 8:118356479-118356501 GCCCACCTGCAGCTCAGGGAGGG + Intronic
1047809819 8:128396408-128396430 TTCCTACAGCAGGACTGGGAAGG + Intergenic
1048878064 8:138852201-138852223 GTCACCCTGCAGCAGGGGGAGGG + Intronic
1049158926 8:141084907-141084929 GTCCTCCTGCGGCCCCGGGAGGG + Intergenic
1049368638 8:142253023-142253045 GCCCTCCTGCAGGCCTGGGGAGG - Intronic
1049621404 8:143599852-143599874 TTTCTCCTGCTGCACTTGGAGGG + Exonic
1051779864 9:20678578-20678600 GGCCTCCTGCAGCACTGTGAAGG - Intronic
1053472916 9:38359635-38359657 GGCTTCCTGAAGCACTGGGATGG + Intergenic
1055138883 9:72852616-72852638 TTCCGCCTGCAGCAATGGGAAGG - Intergenic
1056278389 9:85015691-85015713 TTCCTGCTGCAGCTCAGGGATGG - Intronic
1056736001 9:89209771-89209793 CTCCACCTGCAGCACTGGTGTGG + Intergenic
1057255683 9:93545257-93545279 TCCCTCATGCTGCACTGGGAGGG - Intronic
1058235627 9:102486931-102486953 CTCCACCTGCAGCCCTGGTATGG - Intergenic
1059437541 9:114285637-114285659 GTCCTCCTCCAGCAGGAGGAAGG - Intronic
1060213364 9:121723859-121723881 GTCCCCCAGCAGCAGTGGGCAGG - Intronic
1060968886 9:127726854-127726876 TTCCTTCTTCAGCCCTGGGAAGG + Intronic
1061443987 9:130627226-130627248 GCCCTGCTGCTACACTGGGAAGG - Intronic
1061715382 9:132515361-132515383 GTCCTCCTGCAGCCCTGGGAGGG - Intronic
1061782419 9:133003908-133003930 GGCCTCCTGAAGCCCTGAGAAGG - Intergenic
1062123668 9:134848101-134848123 GTGCTCCTGCGGCACTGTGGGGG - Intergenic
1062227604 9:135462135-135462157 GTTCACCTGCAGCTCTGGGAGGG + Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1185458780 X:324087-324109 GGCCTCCTGAAGCCCTTGGATGG - Intergenic
1191160878 X:57328939-57328961 GTCCTCCTGGACCACTAGAAGGG + Intronic
1192822582 X:74659902-74659924 ATCCTCCAGCAGCAGTGGCATGG - Intergenic
1193659115 X:84235921-84235943 GTCAGCCTGCTGCAGTGGGAGGG + Intergenic
1195228961 X:102826855-102826877 GCCCTCCTGCAACACTGGAATGG - Intergenic
1195300936 X:103529322-103529344 GTCCTCCTGCAGCAGTGTATAGG - Intergenic
1195816420 X:108894034-108894056 GTCTTCCTCCAGCACAGGGATGG + Intergenic
1199680602 X:150221867-150221889 TGCCTCCTGCAGCACTTTGAAGG + Intergenic
1200074951 X:153546273-153546295 CTCCTCCCTCTGCACTGGGACGG - Intronic
1202195840 Y:22297725-22297747 GAGCACCTGCAGCACTGGAATGG - Intergenic