ID: 1106409508

View in Genome Browser
Species Human (GRCh38)
Location 13:29501431-29501453
Sequence TCCCCTCCCAGTGCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 519}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106409508_1106409516 12 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409516 13:29501466-29501488 TTGGAAGAGATTAGGAGAGGAGG 0: 1
1: 0
2: 1
3: 51
4: 495
1106409508_1106409519 22 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409519 13:29501476-29501498 TTAGGAGAGGAGGGCCAGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 270
1106409508_1106409514 4 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409514 13:29501458-29501480 GTTTATTTTTGGAAGAGATTAGG 0: 1
1: 0
2: 21
3: 724
4: 14626
1106409508_1106409515 9 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409515 13:29501463-29501485 TTTTTGGAAGAGATTAGGAGAGG 0: 1
1: 0
2: 5
3: 52
4: 416
1106409508_1106409513 -7 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409513 13:29501447-29501469 GAGGGGAAGGGGTTTATTTTTGG 0: 1
1: 0
2: 0
3: 42
4: 374
1106409508_1106409518 21 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409518 13:29501475-29501497 ATTAGGAGAGGAGGGCCAGCTGG 0: 1
1: 0
2: 1
3: 19
4: 236
1106409508_1106409517 13 Left 1106409508 13:29501431-29501453 CCTCCTGCAGCACTGGGAGGGGA 0: 1
1: 0
2: 2
3: 39
4: 519
Right 1106409517 13:29501467-29501489 TGGAAGAGATTAGGAGAGGAGGG 0: 1
1: 0
2: 9
3: 77
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106409508 Original CRISPR TCCCCTCCCAGTGCTGCAGG AGG (reversed) Intronic
900370722 1:2331039-2331061 GCCCCTCCCAGGGCAGCAGGCGG + Intronic
900390295 1:2430917-2430939 GACCCCCCCAGTGCAGCAGGTGG - Intronic
900520375 1:3102478-3102500 CCCCATCCCTGAGCTGCAGGTGG + Intronic
900970465 1:5989877-5989899 TGCCCTCCTAGTACAGCAGGGGG - Intronic
901740114 1:11336116-11336138 TCACCTCCCATTGAAGCAGGAGG + Intergenic
901890402 1:12258612-12258634 TCCCATGCCAGGGCTCCAGGAGG - Intronic
901924423 1:12556885-12556907 TCCCCTCCCGGTTCTGCTGCGGG + Intergenic
902033518 1:13439660-13439682 TCCCCTACCGGGGCCGCAGGTGG - Intergenic
902582064 1:17414019-17414041 TCCTCCCCCACTGCTGGAGGCGG - Intronic
902773932 1:18662158-18662180 TCTCCTCCCAGGCCTGCAGGAGG - Intronic
902832401 1:19025297-19025319 TCCCTTCCCTGTGCTGCAGCCGG - Intergenic
902983981 1:20144262-20144284 ACTCCTCCCACTGCTGCAGCCGG + Intronic
903115440 1:21175991-21176013 TCCCCCCGCAGTGCTGCTGCCGG + Intronic
903280393 1:22246933-22246955 TACCCTCGCAGGGCTGCTGGGGG + Intergenic
903291551 1:22317457-22317479 TACCCGCCCAGACCTGCAGGGGG - Intergenic
903380231 1:22891606-22891628 TCCACTCCCACTGCAGCAGCTGG + Intronic
903500701 1:23798804-23798826 TCCCCGCCCGGTGGTGGAGGTGG + Intronic
903649582 1:24914567-24914589 TTCCCTCCCAGGGCTGCAAGTGG + Intronic
903653601 1:24935455-24935477 TCCCCACCCTGTTCTGCAGGTGG + Intronic
904270603 1:29347493-29347515 TTCCCTCCCAGTAATGGAGGAGG + Intergenic
904274149 1:29369469-29369491 TCCCCTCCAAGGACTGCAGTGGG - Intergenic
904423817 1:30410622-30410644 CCCCCTCCCAGGACTGCAGTAGG + Intergenic
904496456 1:30889589-30889611 TCCCTTCCCAGCTCTGCAGTGGG + Intronic
904538351 1:31216071-31216093 TCTCCTCCCAAAGCTGCAGTGGG - Intronic
904962731 1:34347576-34347598 TCCCCTCTAATTGCTGCAGCTGG - Intergenic
905185971 1:36197076-36197098 TCCCGCGCCAGGGCTGCAGGTGG - Intergenic
905226235 1:36481061-36481083 TCCCCAACCAGTGTTGCGGGGGG - Intronic
905245858 1:36612808-36612830 TCCCCTCCCAGTGCTGGCAAGGG - Intergenic
905392057 1:37642599-37642621 CCCCCTCCCAGATCTGCATGTGG + Intergenic
906240995 1:44242238-44242260 TCCCCTCCCAGCCCTGAAGGTGG + Intronic
906490952 1:46268112-46268134 TCCCCTCCCAGTGCTTTGAGAGG + Intronic
906609556 1:47192191-47192213 TACCATCCCTGTGCTGCAGACGG - Intergenic
906703460 1:47876690-47876712 ACCCCTCCCAGCACTGCTGGAGG - Intronic
907440261 1:54474614-54474636 TCCCCACTCACTGCGGCAGGAGG - Intergenic
907447304 1:54516716-54516738 TTCCCTCCCTCTGCTGCAGTTGG - Intergenic
908291415 1:62670303-62670325 TCCCGCACCAGGGCTGCAGGTGG - Intronic
909185088 1:72477362-72477384 TCACCTCCTAGGACTGCAGGAGG - Intergenic
910034694 1:82776729-82776751 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
911259523 1:95669575-95669597 TCCCACACCGGTGCTGCAGGTGG + Intergenic
911968993 1:104406804-104406826 TCCCCTCCCTGTGGTGATGGGGG + Intergenic
912259838 1:108099397-108099419 TCCCTTCCCAGTCCTGTAGCAGG + Intergenic
912449726 1:109761494-109761516 CCTCCACCCTGTGCTGCAGGAGG + Exonic
913190044 1:116405781-116405803 GCCCCTCCCAGTTCTGCGGCTGG - Intronic
913465658 1:119140295-119140317 TCCGCTCCCAGAACTGGAGGTGG + Intronic
914438362 1:147680713-147680735 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
914825407 1:151135547-151135569 TCCCCTCCCTGCTTTGCAGGGGG + Intronic
915735299 1:158080811-158080833 TTGCCTCCGTGTGCTGCAGGTGG - Intronic
915914816 1:159934548-159934570 TCCGCACCCGGGGCTGCAGGCGG + Exonic
916939099 1:169661586-169661608 TCCCACACCAGGGCTGCAGGTGG - Intergenic
917512060 1:175676914-175676936 CCTCCTCCCAGTGTCGCAGGAGG - Intronic
919167880 1:193918859-193918881 TCCCGCACCAGCGCTGCAGGTGG + Intergenic
919174544 1:194002252-194002274 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
919237091 1:194859413-194859435 TCCCGCACCGGTGCTGCAGGTGG - Intergenic
920315521 1:205073538-205073560 TCCGCTCCCAGGCCTGCAGCTGG + Intronic
921364119 1:214357823-214357845 TCCCCCCACAGGGGTGCAGGTGG - Exonic
923015996 1:230127104-230127126 CCCCCTCCCATTGCTGCCTGAGG + Intronic
923781833 1:237031812-237031834 TCACCTTCCAGAGCTGGAGGTGG + Intergenic
924235876 1:241999177-241999199 CCCCCTCCCTGGGCAGCAGGAGG + Intergenic
1062785217 10:259295-259317 TCCCCTCCCAAAGATGCCGGGGG + Intergenic
1063105517 10:2988427-2988449 GGCCTTCCCAGTGCTGCAGTAGG + Intergenic
1063769773 10:9183763-9183785 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1064790286 10:18951226-18951248 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1065441412 10:25756411-25756433 TCCCGTACCGGGGCTGCAGGTGG - Intergenic
1065802680 10:29366592-29366614 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1066006868 10:31153878-31153900 GCTCCTCCCAGTTCTGCTGGGGG - Intergenic
1067061156 10:43078551-43078573 TGGGGTCCCAGTGCTGCAGGGGG + Intronic
1067222811 10:44356289-44356311 TCCCCACCCAGTGCTGAAGCAGG - Intergenic
1067296948 10:44980052-44980074 ACGCCTGCCTGTGCTGCAGGTGG + Intronic
1067363269 10:45601154-45601176 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1068374098 10:56155537-56155559 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1068792346 10:61041027-61041049 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1068902191 10:62280791-62280813 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1069830274 10:71278721-71278743 TCCCCTCCCTCCGCTGTAGGTGG + Intronic
1070523973 10:77279085-77279107 TGCTGTCCCAGTGCTGCAGGTGG - Intronic
1071882179 10:89911298-89911320 TGCCCTTCCACTGCTGCAGTGGG - Intergenic
1072620247 10:97074833-97074855 TCCTCTCCCAGGGCTGGAGGAGG + Intronic
1074174980 10:110990176-110990198 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1074891276 10:117738409-117738431 TCGACTCCCAGGGCTGCAGAAGG - Intergenic
1076231171 10:128821157-128821179 CCCCATCCCAGGGCTGCAGGAGG + Intergenic
1076504365 10:130962246-130962268 TCCCCTCTCAATGCAGCTGGGGG + Intergenic
1077236920 11:1486314-1486336 TGCCCTCCCAGTGTGGCCGGCGG - Intronic
1077249439 11:1554482-1554504 GCCTCCTCCAGTGCTGCAGGAGG - Exonic
1077306975 11:1872875-1872897 GACCCACCCAGTGCTGCATGAGG - Intronic
1077419353 11:2443295-2443317 TCCCCTCCCACCTCAGCAGGAGG - Intergenic
1079726147 11:23883378-23883400 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1079867224 11:25751684-25751706 CCCCCTCCCCGAGCTGCAGTGGG + Intergenic
1082816832 11:57514828-57514850 CCCCCTCCCGGGGCTGGAGGGGG - Intronic
1082924695 11:58532356-58532378 TCCCATGCCAGGGCTGCGGGCGG - Intronic
1083074224 11:60020204-60020226 TCCCATACCGGGGCTGCAGGTGG + Intergenic
1083622649 11:64056686-64056708 TCCCCTATGAGTGCTGCTGGTGG - Intronic
1083775854 11:64894079-64894101 CCCCCTCCAAGTGCTGGAGCTGG + Intergenic
1084490440 11:69475519-69475541 TCCCCTCCCATTGCTTCCCGGGG + Intergenic
1084495327 11:69500109-69500131 TTCCATCACAGTGCTGCCGGAGG - Intergenic
1084632409 11:70362278-70362300 TCCCAACCCAGAGCTGGAGGCGG - Exonic
1084679890 11:70660820-70660842 TCCCGCACCTGTGCTGCAGGAGG - Intronic
1084973130 11:72781950-72781972 TCCCCTCCCAGGGCCGGCGGGGG - Intronic
1086294246 11:85347265-85347287 GCCCCTCCCTGTGCTTCAGGGGG - Intronic
1087354612 11:97077013-97077035 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1088570950 11:111222390-111222412 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1088952430 11:114585180-114585202 TCTTCCCCCAGTTCTGCAGGTGG + Intronic
1089640048 11:119842023-119842045 TCCCATCCCAGTGCTGAGGCTGG + Intergenic
1089697847 11:120226821-120226843 TCCCCGGGCAGTGCGGCAGGCGG + Exonic
1090236122 11:125148672-125148694 TGCCCTCCCAGCTCTGCAGCAGG + Intergenic
1090964304 11:131584871-131584893 CCCCCTCTCAGTGCTGCATCGGG + Intronic
1091590328 12:1838944-1838966 TCCCTTCCAAGTGCTGCAGGTGG + Intronic
1091619463 12:2075353-2075375 TCCCCTCCCATTGATGAAGTGGG + Intronic
1091692342 12:2605663-2605685 TCCCTTCCCACTGCAGCATGTGG + Exonic
1091705220 12:2688908-2688930 CTCCCTCTCAGGGCTGCAGGAGG + Intronic
1091771698 12:3156345-3156367 CCCTCTCCCAGTCCTGGAGGGGG - Intronic
1092142032 12:6190818-6190840 TCCCGCACCAGCGCTGCAGGTGG + Intergenic
1092289586 12:7151133-7151155 TCCTCTCCCAGAGGTGGAGGGGG - Intronic
1092732531 12:11547661-11547683 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
1093189479 12:16057788-16057810 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1093380963 12:18492836-18492858 ACCACCCCTAGTGCTGCAGGTGG + Intronic
1093781206 12:23139617-23139639 TCACCTCCCAGTGGTGGAAGGGG - Intergenic
1093789118 12:23226546-23226568 TACTTTCCCAGTGCTGCACGTGG - Intergenic
1094409912 12:30157273-30157295 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1094712450 12:32978566-32978588 CCCACCCCCAGTGCTGGAGGTGG + Intergenic
1095123165 12:38442362-38442384 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1096238475 12:49945711-49945733 TCCCATCACAGTGCTCCAGCAGG + Intergenic
1097893517 12:64801902-64801924 TCCCCTCCCCAAACTGCAGGAGG + Intronic
1099716158 12:86296349-86296371 TCCCACACCAGGGCTGCAGGTGG + Intronic
1099732783 12:86526320-86526342 TGCCCTGCCACTGCTGCAGCAGG - Intronic
1100392625 12:94157220-94157242 TCCCCAGCAGGTGCTGCAGGTGG + Intronic
1100583044 12:95954163-95954185 TCCCTTCTCAGAGTTGCAGGGGG + Intronic
1102011550 12:109622231-109622253 GCCCCTCCCCGAGCTGCAGGAGG - Intergenic
1102954671 12:117051796-117051818 TCCCCTCCGAGTGCTCCCGCAGG + Intronic
1103146072 12:118597123-118597145 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1103289716 12:119835298-119835320 TCCTCACACAGTGCTGCAAGAGG - Intronic
1103294798 12:119877110-119877132 TCCACCCCCAGGGCTGCGGGAGG - Intronic
1104765656 12:131328376-131328398 CCCCCCCCCAGAGATGCAGGTGG + Intergenic
1104813651 12:131633615-131633637 ACCCCCCCCAGAGATGCAGGTGG - Intergenic
1104881746 12:132076353-132076375 TGCTCTCTCACTGCTGCAGGTGG + Intronic
1105871077 13:24506766-24506788 TCCCATGCCAGGGCCGCAGGTGG + Intronic
1106409508 13:29501431-29501453 TCCCCTCCCAGTGCTGCAGGAGG - Intronic
1106590096 13:31091530-31091552 TTCCCCCCCAGTGCTGCAAGGGG + Intergenic
1106600485 13:31182999-31183021 TCCCTCACCAGGGCTGCAGGTGG + Intergenic
1106643358 13:31608776-31608798 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1107412788 13:40172903-40172925 TCCCCTCTGAGGGCTGCTGGAGG + Intergenic
1107590389 13:41898526-41898548 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1108099107 13:46936002-46936024 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1108358994 13:49652474-49652496 TTGCCTCCCAGGGCAGCAGGTGG - Intergenic
1108469384 13:50753254-50753276 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1108699956 13:52935215-52935237 TCCACTCCCAGTGCTGGACAAGG + Intergenic
1109124645 13:58504218-58504240 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1109159800 13:58958129-58958151 TCCCGTACCGGGGCTGCAGGTGG + Intergenic
1110023997 13:70511858-70511880 TCCCGCACCAGAGCTGCAGGTGG + Intergenic
1110430668 13:75419298-75419320 TCTCATTCCAGTGCTGGAGGAGG + Intronic
1111231931 13:85354782-85354804 TGCCCTGCCACTGCTGCTGGTGG + Intergenic
1112518718 13:100077929-100077951 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1112842760 13:103600352-103600374 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1113482611 13:110632976-110632998 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1113523016 13:110953916-110953938 TCCACTCCCAGGGCAGGAGGCGG - Intergenic
1113702353 13:112396893-112396915 TCCACTCCCAGGGCAGGAGGCGG + Intronic
1113715950 13:112508050-112508072 GCCCATCCCAGTGCTGCCTGGGG + Intronic
1113730714 13:112639244-112639266 TCCCCTCCCAGTGCCCCATCTGG + Intergenic
1114593612 14:23892171-23892193 TCCCCCACCAGGGCTGCAGGTGG - Intergenic
1115174514 14:30547455-30547477 TCCCGCCCCAGGGCTGAAGGCGG + Intergenic
1116382067 14:44282050-44282072 TCCCTTTCCAGTGCTCCATGGGG + Intergenic
1117077942 14:52122658-52122680 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1118182452 14:63507118-63507140 TCCCAGGCCACTGCTGCAGGGGG + Intronic
1118215297 14:63803211-63803233 TCCCCCACCGGGGCTGCAGGTGG + Intergenic
1118478584 14:66141649-66141671 TTCCTTACCAGTGCTGCAGCGGG + Intergenic
1119190774 14:72680364-72680386 TCCCGCCCCAGGGCTCCAGGAGG + Intronic
1119740019 14:77008155-77008177 CCCCCTTCCAGTTCTGCAGCTGG - Intergenic
1121463606 14:94100460-94100482 GCTCTGCCCAGTGCTGCAGGGGG + Intronic
1121732855 14:96198260-96198282 TCACCTCCCAGGGCAGCAGAGGG + Intergenic
1122330677 14:100910411-100910433 TCCCCTCCCTGAGCCTCAGGTGG - Intergenic
1122354766 14:101116191-101116213 TCTCATCCCAGGGCTGCAGGAGG + Intergenic
1122514610 14:102298102-102298124 TCCCACACCAGGGCTGCAGGTGG - Intronic
1124657991 15:31524202-31524224 TCCTGTGCCAGTGATGCAGGAGG - Intronic
1124709060 15:31990065-31990087 TCCCACCCCAGTGCTTCTGGTGG + Intergenic
1125360330 15:38857963-38857985 TCTCCTCCCAGGGAGGCAGGTGG - Intergenic
1125488788 15:40131295-40131317 ACTACTCCCAGTTCTGCAGGCGG + Intergenic
1126240332 15:46434610-46434632 TCCCATCCCAGTGTTGGAGGTGG - Intergenic
1126532773 15:49729766-49729788 TGTAATCCCAGTGCTGCAGGAGG + Intergenic
1126595670 15:50382433-50382455 ATCCCTCCCAGTGTTGGAGGAGG + Intergenic
1127355975 15:58200574-58200596 TCCTCTCACAGTGCTGGAGATGG - Intronic
1127707679 15:61563118-61563140 TCCGCTCCCAGTGAAGAAGGTGG - Intergenic
1127855574 15:62950846-62950868 TCACCTCCCAGTGCAGCAGTTGG - Intergenic
1127984857 15:64061299-64061321 TCCCCCACCAGGGCCGCAGGTGG - Intronic
1128345979 15:66852641-66852663 TGGCCTCCCAGAGCTGCTGGGGG - Intergenic
1128565957 15:68700498-68700520 TCCCCTCCCTGAGCAGGAGGAGG + Intronic
1128669911 15:69567305-69567327 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1128813234 15:70587121-70587143 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1129605120 15:77021031-77021053 TCCCCTGCCCGTTCTGCAAGGGG - Intronic
1129666918 15:77584534-77584556 TCCCCTCCCATTGCTTCCTGGGG + Intergenic
1130109402 15:80952266-80952288 GCCCCTTCCAGTGCTGCCTGAGG - Intronic
1130330331 15:82917444-82917466 TCCTCTCCCAGGGCCCCAGGGGG + Intronic
1130910813 15:88269720-88269742 TCCAACCCCAGAGCTGCAGGAGG - Intergenic
1131300231 15:91193201-91193223 GCCCCTGCAAGTGCCGCAGGAGG + Intronic
1132143305 15:99412195-99412217 CTACCTCCCAGTGCTGCTGGAGG - Intergenic
1132427482 15:101730671-101730693 TTCACCCCCAGTGTTGCAGGTGG - Intergenic
1132522380 16:397615-397637 TCCCCGCCCAGTGCTGCAGCCGG - Intronic
1132585404 16:704017-704039 TTCCCCACCAGTGGTGCAGGAGG - Intronic
1133287795 16:4698587-4698609 CCTCCTCGCAGCGCTGCAGGGGG + Exonic
1133342373 16:5045081-5045103 TCCCCTCCCACCCCTGCGGGGGG + Intronic
1133344806 16:5062687-5062709 TCCCCTCTGAGTGCTGGAGAAGG - Intronic
1133791600 16:9013357-9013379 TTCCCTCCCACCCCTGCAGGCGG - Intergenic
1134247886 16:12553506-12553528 TGCCATCACAGTGCTGGAGGAGG + Intronic
1135299321 16:21312727-21312749 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1136027096 16:27475505-27475527 TCCCCTGCCAGTGCTGCCCAGGG - Intronic
1136775514 16:32869750-32869772 GCCCCTCCCAGAGCTGAGGGTGG + Intergenic
1136895103 16:33991762-33991784 GCCCCTCCCAGAGCTGAGGGTGG - Intergenic
1137508306 16:49076046-49076068 TCCCCTCCCTGTGCTTCACCTGG + Intergenic
1138577110 16:57915150-57915172 CCCCTCCCCAGTGCTGCTGGGGG + Intronic
1139634061 16:68247391-68247413 TCCCCTCCCAGTGTTACTTGAGG + Intronic
1139965797 16:70744665-70744687 ACCCCTCCCACCCCTGCAGGTGG - Intronic
1141431681 16:83973420-83973442 TCACCCCCCAGGGATGCAGGAGG - Intronic
1141669740 16:85485510-85485532 TGCCCTCCCAGAACGGCAGGCGG - Intergenic
1141699981 16:85637941-85637963 GCAGCTCCCAGAGCTGCAGGGGG + Intronic
1142148509 16:88502576-88502598 TTCCCGTCCAGTGCTGCTGGAGG + Intronic
1142171536 16:88625113-88625135 TCACCTCACAGGGCTGCTGGTGG + Intronic
1203077932 16_KI270728v1_random:1131859-1131881 GCCCCTCCCAGAGCTGAGGGTGG + Intergenic
1142596831 17:1033853-1033875 GCCCCTTCCAGGGCTCCAGGAGG + Intronic
1143408716 17:6695868-6695890 TGCCCTCAAGGTGCTGCAGGAGG - Exonic
1144132905 17:12265458-12265480 TCCCTTCCCAGTGCCTCAGAGGG - Intergenic
1146061140 17:29607975-29607997 CCCTCCCCCAGTGCTCCAGGAGG + Exonic
1146633076 17:34484588-34484610 TCCCAGCCCCGTGCTGCAGTGGG + Intergenic
1146740386 17:35278860-35278882 TCCCCCACCAGGGCAGCAGGTGG + Intergenic
1147431887 17:40376243-40376265 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1147492159 17:40879690-40879712 TTCCCTGCCAGTTCTGCAAGGGG + Intronic
1150152438 17:62821540-62821562 CCCCCTCCTCGTGCTGCATGAGG + Intergenic
1150529297 17:65959761-65959783 TGCCCACCCACTGCAGCAGGTGG + Intronic
1150764556 17:67993278-67993300 TCCTCTCCCAGTCCCCCAGGAGG + Intronic
1150778353 17:68099694-68099716 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
1151404494 17:73877836-73877858 GCCACTCCCAGGGCTCCAGGTGG + Intergenic
1151546132 17:74794299-74794321 TCCCCTCTCACTCCAGCAGGAGG - Intronic
1151819153 17:76488007-76488029 TCCCTTACCAGTGAGGCAGGTGG - Intronic
1151917334 17:77127966-77127988 GACCTTCCCAGAGCTGCAGGAGG + Intronic
1152169114 17:78732012-78732034 ACCCCTCCCTGTGCTTCAGGAGG - Intronic
1152269535 17:79315955-79315977 ACCCCTCCCAGAGCTGCTGGCGG - Intronic
1152312671 17:79560384-79560406 TGCCCTCCCTGTCCTGCTGGCGG + Intergenic
1153832389 18:8935370-8935392 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1155141742 18:23050317-23050339 TCCTCTCACAGAGTTGCAGGTGG + Intergenic
1155199411 18:23503829-23503851 TCCCGTCCCAGCGCGGGAGGCGG + Intronic
1155852348 18:30788859-30788881 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1156691724 18:39715401-39715423 TCGATTCCCAGTGCTGTAGGTGG + Intergenic
1157979727 18:52366850-52366872 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1158230515 18:55249414-55249436 TCCCTTCAGAGTCCTGCAGGTGG - Intronic
1158634739 18:59146856-59146878 ACCCCTCCCAGTGATCCAGCTGG + Intronic
1158905130 18:62004303-62004325 GCCCACCCCAGTGCTTCAGGAGG + Intergenic
1159472872 18:68879942-68879964 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1159656032 18:71031284-71031306 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1160563258 18:79771950-79771972 TCCCCTCCCCAGTCTGCAGGGGG - Intergenic
1160565644 18:79785230-79785252 TCCCTTCCCAGTGCACCCGGCGG + Intergenic
1160689501 19:454884-454906 GCCTCTCCCAGTGCTGGTGGTGG + Intronic
1160696164 19:485621-485643 TGCCCTCCCGGTGCTTTAGGGGG - Intergenic
1160923045 19:1529506-1529528 TCCCAGCCCGGGGCTGCAGGTGG + Intronic
1160930261 19:1567021-1567043 TTCTCTCCCGGTCCTGCAGGCGG + Intronic
1160989149 19:1853497-1853519 TGCCCTCCCTGGCCTGCAGGTGG - Exonic
1161608872 19:5229852-5229874 GCCCCTCCCAGGGCTGTGGGGGG - Intronic
1162020662 19:7867016-7867038 CCACCTCCCAGGGGTGCAGGTGG + Intergenic
1162515697 19:11146184-11146206 TCTCCTCCCACTGCTGACGGAGG - Exonic
1162567374 19:11451760-11451782 TCCCCTCCCAGTCTTGGGGGTGG + Exonic
1162574717 19:11492469-11492491 ACCTCTCCCAGTGCTTTAGGAGG - Intronic
1162934799 19:13976538-13976560 TCCCCACCCAGTGATGCATAGGG - Intronic
1163125742 19:15243326-15243348 ACCCCCCCAAGTGCTGCTGGAGG - Exonic
1163567309 19:18059270-18059292 TCCCCATCCAGTGCTCCTGGGGG + Exonic
1163686730 19:18716036-18716058 TCCCCTTGCTGGGCTGCAGGTGG + Intronic
1166690314 19:44818529-44818551 TCCCCTCGCTGAGCTCCAGGGGG - Exonic
1167038374 19:47007775-47007797 TGCCCTCCCAGTGCTTTGGGAGG - Intergenic
1167851615 19:52206578-52206600 TAACCTCTCAGTGCTCCAGGTGG - Intronic
1168267588 19:55230989-55231011 GCCCCTCCCCGTGGGGCAGGTGG - Intronic
1168464267 19:56589402-56589424 GCCCCTACCAGAGCAGCAGGTGG - Intergenic
1168669355 19:58229217-58229239 TTCCCTCCCAGCTCTGCAGCAGG - Intronic
925088620 2:1134672-1134694 TCCCCCACCGGGGCTGCAGGTGG + Intronic
926795017 2:16611967-16611989 GCCTGTCCCAGTCCTGCAGGGGG + Intronic
927900477 2:26814773-26814795 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
927966787 2:27275394-27275416 TCCCCACCCAGTGCTTCCGGGGG + Intronic
928753268 2:34494707-34494729 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
929051261 2:37838843-37838865 TCCTTGCCCAGTGCTGCAGTAGG - Intergenic
929137947 2:38643017-38643039 TCCCTCCCCAGGGCCGCAGGAGG + Intergenic
929379761 2:41336004-41336026 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
929382022 2:41364931-41364953 TGCCCTGCCACTGCTGCAGCAGG + Intergenic
929996122 2:46827198-46827220 GCCCCACCCACTCCTGCAGGTGG + Intronic
930038087 2:47100146-47100168 TCCCACACCAGGGCTGCAGGTGG - Intronic
930039287 2:47107693-47107715 TCCCGCACCAGGGCTGCAGGTGG - Intronic
931629279 2:64284832-64284854 TCCCCTCCTAGAGCTGCAGCTGG - Intergenic
931811225 2:65856861-65856883 TCTCCTCCCATTGCCTCAGGAGG - Intergenic
933487181 2:82938388-82938410 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
933536743 2:83584938-83584960 GCCCCTCCCTGTGCTGGGGGTGG + Intergenic
936172638 2:110190179-110190201 TCCCGCACCAGGGCTGCAGGTGG + Intronic
937106949 2:119324730-119324752 ACCCTTCTCAGTGCTGCAGGAGG - Intronic
937195955 2:120156502-120156524 TGCCCTGCCACTGCTGCAGCAGG + Intronic
937219683 2:120335317-120335339 TTACATCCCAGTGCTGCAGCAGG - Intergenic
939281826 2:140074193-140074215 TCCCGTACCTGGGCTGCAGGTGG - Intergenic
940214437 2:151289676-151289698 TCCCCTCCCAGTGCCTCCCGGGG - Exonic
941309857 2:163914031-163914053 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
941673608 2:168321025-168321047 TCCCCTCCCTGTGCTTGGGGTGG - Intergenic
941712048 2:168724844-168724866 TCCCCCACCGGGGCTGCAGGTGG + Intronic
943153035 2:184138327-184138349 TGCCCTGCCATTGCTGCTGGTGG - Intergenic
943494674 2:188606341-188606363 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
944159600 2:196644400-196644422 TCCCCACCCAGTGCTGTTGGTGG + Intronic
945745852 2:213718905-213718927 TCCCGCACCAGGGCTGCAGGTGG - Intronic
946361125 2:219219953-219219975 TTCTCGCCCAGTGCTGCAGCCGG - Exonic
947026706 2:225744547-225744569 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
947499885 2:230664262-230664284 TCTCCTCCCAGTCCTGGGGGTGG - Intergenic
948594923 2:239073762-239073784 TCCCCTCCCAGCCCTGCGGCGGG - Intronic
948668730 2:239552737-239552759 GCAATTCCCAGTGCTGCAGGTGG + Intergenic
948897547 2:240934337-240934359 TCTCCTCCAGCTGCTGCAGGCGG - Intronic
1169065777 20:2693425-2693447 TCCCCGCCCAGCGCCCCAGGAGG + Intronic
1169306447 20:4494994-4495016 TCCCATGCCAGTGCTTCAGAAGG + Intergenic
1172165286 20:32895049-32895071 TTCCCTCCCAGGGATGGAGGAGG - Intronic
1172215197 20:33230695-33230717 CCACCTCCTAGGGCTGCAGGAGG - Intergenic
1172393586 20:34583346-34583368 TCCCTGTGCAGTGCTGCAGGAGG - Intronic
1173841402 20:46159541-46159563 TCCCCTCCCTGTGCCCCAGCTGG - Intergenic
1173851702 20:46222674-46222696 TCCCCTCCAAATGCTGCAAAAGG + Intronic
1175211186 20:57356980-57357002 TCTCCTGCCATTGCTGCTGGTGG + Intronic
1175315731 20:58045316-58045338 CCTCCTCCCAGGGCAGCAGGAGG + Intergenic
1175821015 20:61908855-61908877 TGACCTTCCAGGGCTGCAGGTGG - Intronic
1175875592 20:62227885-62227907 TCACCGCCCAGGGCTGCTGGAGG + Intergenic
1176069200 20:63217280-63217302 GCCTCTCACACTGCTGCAGGAGG + Intergenic
1177460569 21:21403428-21403450 TGCCCTCCCAGAGCTGCAGATGG + Intronic
1177775528 21:25562164-25562186 TCCCTTCCCGAGGCTGCAGGCGG - Intergenic
1177798669 21:25806075-25806097 CCATCTCCCAGTGCTGCAGAGGG + Intergenic
1178833903 21:36079839-36079861 AATCCTCCCAGTGCTGGAGGTGG + Intergenic
1178878083 21:36427975-36427997 TCCCCACCCCATGCAGCAGGTGG + Intergenic
1179511603 21:41877441-41877463 TCCCCTCACAGTGCTGGTGTGGG - Intronic
1179916898 21:44483528-44483550 TCCCCTCCCACTGGTGCCGAGGG - Intergenic
1181966359 22:26658764-26658786 TCCCCTCCCGCCGCAGCAGGTGG - Intergenic
1182352921 22:29709033-29709055 TCCCCTCCCAGGCTGGCAGGTGG + Intergenic
1183254973 22:36756394-36756416 TCGCCACCCTGTGCTGCAGCTGG + Intergenic
1183312080 22:37115691-37115713 TTCTCTCCCAGTTCTGGAGGCGG + Intergenic
1183641602 22:39096248-39096270 TCCCCTCCCAGTGCTATCTGGGG + Intergenic
1183731656 22:39621830-39621852 TCCCCTCCCTGTGCCCAAGGGGG - Intronic
1183745198 22:39687969-39687991 CCCCCTCCGAGGGCTTCAGGGGG + Exonic
1184383591 22:44161694-44161716 TCCCCTCCCAGCCCTGTACGAGG - Intronic
1184727520 22:46355519-46355541 TCCCGGACCAGTGCTGCGGGAGG - Exonic
1184749175 22:46474364-46474386 TCCCCTCGGGCTGCTGCAGGTGG + Intronic
1185215805 22:49599396-49599418 TGCCCTCCCAGCGCTCCAGCCGG - Intronic
1185369937 22:50456359-50456381 CCAGCTCCCACTGCTGCAGGGGG + Exonic
951837793 3:27002052-27002074 CCTCCTCCCACTGCTGGAGGGGG - Intergenic
953725555 3:45394861-45394883 ACCCCTCCCAATAGTGCAGGTGG - Intronic
954759386 3:52862999-52863021 TCCTCTCCCAGAGCTGCTGGAGG + Intronic
955353270 3:58209701-58209723 TCACCAGCCAGTGCTACAGGTGG + Intronic
957919607 3:86731457-86731479 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
958022713 3:88016102-88016124 TCCCCCACCGGGGCTGCAGGTGG - Intergenic
959066324 3:101660878-101660900 TCTCCTCCCAGTACAGCTGGGGG - Intronic
960298183 3:115968922-115968944 ACCCCAGCCAGTGCTGCTGGAGG - Intronic
960854890 3:122092686-122092708 TTCCCTCTCAGGCCTGCAGGTGG - Intronic
961451764 3:127005386-127005408 TCCACTCCCAGACCAGCAGGTGG - Intronic
962758325 3:138485063-138485085 TCCCACACCAGGGCTGCAGGTGG - Intergenic
962826018 3:139101574-139101596 TCCCCTCCCCTCTCTGCAGGTGG - Intronic
963036605 3:141035531-141035553 TGCAATCCCAGTGCTGTAGGAGG - Intergenic
963231071 3:142909310-142909332 TTCTCTCCCAGAGCTGCTGGTGG + Intergenic
963397288 3:144750222-144750244 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
963397967 3:144757308-144757330 TCCCGAGCCAGGGCTGCAGGCGG - Intergenic
964032398 3:152152833-152152855 TCCCTTACCGGGGCTGCAGGTGG - Intergenic
965288117 3:166843225-166843247 TCCCACACCAGGGCTGCAGGTGG - Intergenic
965837446 3:172867196-172867218 TCCCACACCAGGGCTGCAGGTGG - Intergenic
968088626 3:195886024-195886046 TCACCTCCCGGGGCTGCAGGAGG - Intronic
968353170 3:198080139-198080161 TCTCCACCAAGTGCTCCAGGCGG + Intergenic
968605141 4:1531910-1531932 TCCCCGCCCTGGGCAGCAGGAGG + Intergenic
968652260 4:1764916-1764938 ACCCCTCGCAGGGCTGGAGGTGG - Intergenic
968662412 4:1804231-1804253 TCCGCTCCCAGTGGTGCCTGCGG + Intronic
968781721 4:2587401-2587423 ACCACACCCAGTGCTGGAGGTGG - Intronic
968928509 4:3562747-3562769 GCCACTCCCAGGACTGCAGGGGG + Intergenic
969362428 4:6673137-6673159 TCCCACACCAGGGCTGCAGGTGG - Intergenic
969556729 4:7916606-7916628 ACCCTTCCCACTCCTGCAGGAGG - Intronic
970817811 4:20178957-20178979 TCCCGTACTAGGGCTGCAGGTGG + Intergenic
972022714 4:34335586-34335608 TCCCACACCAGGGCTGCAGGTGG + Intergenic
972511324 4:39770748-39770770 CCCCCTCCCAGGCCTCCAGGGGG + Intronic
972900199 4:43672772-43672794 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
973144194 4:46804776-46804798 TCCCCTACCGGGGCCGCAGGTGG + Intronic
973275225 4:48299944-48299966 TCCCCTCTCTCTGCAGCAGGAGG - Intergenic
973322835 4:48827796-48827818 TCCCATGCCGGGGCTGCAGGTGG - Intronic
973587688 4:52409691-52409713 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
973736038 4:53872520-53872542 TTCCCTAGCAGTGGTGCAGGAGG - Intronic
974083252 4:57234092-57234114 TCCCCGCCCCATGCTGCAGATGG + Intergenic
975595113 4:76043240-76043262 TCCCGCACCAGGGCTGCAGGTGG + Intronic
975596291 4:76050602-76050624 TCCCGCACCAGGGCTGCAGGTGG + Intronic
976520558 4:86021553-86021575 TCCCGTACCAGGGCTGCAGGTGG + Intronic
977717276 4:100196466-100196488 TCCCGAACCAGGGCTGCAGGTGG + Intergenic
979308395 4:119174200-119174222 TCCCGCACCAGGGCTGCAGGTGG - Intronic
979991538 4:127380355-127380377 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
982408300 4:155044717-155044739 TCCCACACCAGGGCTGCAGGTGG - Intergenic
982728262 4:158928116-158928138 TCCCACACCTGTGCTGCAGGTGG - Intronic
983026169 4:162739955-162739977 TCCCACACCAGGGCTGCAGGTGG - Intergenic
983834166 4:172369427-172369449 TCCCGTGCCAGGGCTGCGGGTGG + Intronic
984776034 4:183482634-183482656 TCCCCCACCGGGGCTGCAGGTGG + Intergenic
984918179 4:184741618-184741640 TCCCACACCAGGGCTGCAGGCGG - Intergenic
985520363 5:371302-371324 GCAGCACCCAGTGCTGCAGGTGG + Intronic
986551253 5:8958518-8958540 TCCCCTTCGTGAGCTGCAGGAGG + Intergenic
986950705 5:13080905-13080927 TGCCCACCCAGTGCTGGTGGAGG - Intergenic
987043200 5:14082554-14082576 TCCCCTCCCAGTACTTCCTGGGG - Intergenic
987156688 5:15096461-15096483 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
987315365 5:16718366-16718388 TCCCGCACCAGGGCTGCAGGTGG - Intronic
987355915 5:17062604-17062626 TCCCATACCAGGGCCGCAGGTGG - Intergenic
988035503 5:25823263-25823285 TCCCATGCCAGGGCTGCAGGAGG + Intergenic
988177344 5:27743875-27743897 TCCCACACCAGGGCTGCAGGTGG - Intergenic
988489073 5:31691959-31691981 TCCCACACCAGGGCTGCAGGTGG + Intronic
988836853 5:35041521-35041543 TTCCATCCCACTGCTGCAGGGGG - Intronic
990461595 5:56035904-56035926 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
991044185 5:62205931-62205953 TCCTCACCCAGTGATGGAGGAGG - Intergenic
991609499 5:68435812-68435834 TCCCTGCCCTGTGCTGCCGGAGG - Intergenic
992638575 5:78748903-78748925 TGCAATCCCAGTGCTTCAGGAGG - Intronic
992947521 5:81824128-81824150 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
993306421 5:86280679-86280701 TTCGGTCCCAGTGCTGAAGGAGG + Intergenic
993678533 5:90847463-90847485 TCCCGCACCAGGGCTGCAGGTGG + Intronic
994647690 5:102491337-102491359 TCCCCTACCGGGGCCGCAGGTGG + Intronic
994701629 5:103141980-103142002 TCCCGCACCAGGGCTGCAGGTGG + Intronic
995388259 5:111612097-111612119 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
995400729 5:111738343-111738365 TCCATTCCCAGTGCTGGATGTGG + Intronic
995513223 5:112928518-112928540 CACCCTCCCTCTGCTGCAGGAGG + Intergenic
995872173 5:116755237-116755259 TCTCCTCACAGGGCAGCAGGAGG - Intergenic
996107117 5:119517519-119517541 TCCCACACCAGGGCTGCAGGTGG - Intronic
996954231 5:129164206-129164228 TGCCCTGCCACTGCTGCAGCAGG - Intergenic
997418356 5:133747015-133747037 TCCCCTCACAGTGCCCCTGGTGG - Intergenic
997626010 5:135330971-135330993 GCCCCTCCCAGTCCTGGGGGTGG - Intronic
999149791 5:149419287-149419309 TCTAATCCCAGTGCTTCAGGAGG + Intergenic
999875002 5:155794625-155794647 TATCCTCTCTGTGCTGCAGGTGG - Intergenic
1000668877 5:164034766-164034788 GCAACTCCCAGTGCTGGAGGTGG - Intergenic
1000872955 5:166600115-166600137 TCCCCTCGCAGTCCTCCAGAGGG + Intergenic
1001447059 5:171793954-171793976 TCCCCCCCCAGTGCTGGTGTGGG + Intronic
1001833162 5:174806480-174806502 TCCAATCCCAGTGCTTTAGGAGG - Intergenic
1002060093 5:176620840-176620862 CCCCATCCCGGTGATGCAGGAGG - Exonic
1002093351 5:176817382-176817404 TCCCCAGCCAGGGCGGCAGGTGG + Intronic
1002280414 5:178126634-178126656 GCCCCTCCCTGCGCTTCAGGAGG - Intergenic
1002842173 6:915605-915627 TCACCTTCCAGGGGTGCAGGTGG - Intergenic
1002900040 6:1402586-1402608 TCCTCTCCCGGTCCTGCGGGCGG - Intergenic
1002906953 6:1456916-1456938 TCCCCTACCGGGGCTGCAGGTGG + Intergenic
1002956085 6:1866089-1866111 TCACCTCCCTGTGCTTGAGGTGG - Intronic
1003224395 6:4191233-4191255 TCTCGTACCAGGGCTGCAGGTGG + Intergenic
1003270458 6:4603293-4603315 GCCCCTCCCAGGGCTCCTGGAGG - Intergenic
1003908204 6:10721004-10721026 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1004085906 6:12448828-12448850 TCACTTCCCAGGGCTGCAAGAGG - Intergenic
1004506421 6:16250388-16250410 TCAATTACCAGTGCTGCAGGGGG + Intronic
1005042197 6:21609845-21609867 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1005945179 6:30590130-30590152 TCCCCTTCCTTTGCTACAGGTGG + Exonic
1006136775 6:31900611-31900633 CCCCCTCCCAGGCCTCCAGGGGG + Exonic
1006226995 6:32547869-32547891 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1006285919 6:33094076-33094098 TCCCCTCCCAGCCCAGCATGGGG + Intergenic
1006749245 6:36366384-36366406 TCCTCTCCCAGGGGTGCAGTAGG + Exonic
1007492047 6:42230759-42230781 TCCCATCCCTGTGCTTCATGGGG + Intronic
1008771071 6:54979651-54979673 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1009470341 6:64024149-64024171 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1009857391 6:69282093-69282115 TCCCCTCCCAGTCTCTCAGGGGG + Intronic
1011002516 6:82606892-82606914 ACCCATCACAGTGCTGCAGCAGG - Intergenic
1011246593 6:85326383-85326405 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1011546178 6:88483745-88483767 TCCCTTCTCACTGCTGCAGTAGG - Intergenic
1013081410 6:106816707-106816729 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1013963377 6:115928027-115928049 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1015600421 6:134905145-134905167 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1016733453 6:147450915-147450937 TCCCTTCCCACTGCTGCCAGAGG - Intergenic
1017676585 6:156820592-156820614 TCACCTCGCAGTGTTGCTGGTGG - Intronic
1018154883 6:160976609-160976631 TCCTCTCCCAGTGCTGGACTCGG + Intergenic
1018778690 6:167043267-167043289 TCCCCACCCAATGCCACAGGAGG - Exonic
1018872848 6:167796412-167796434 TCCTCTCCTTGTGCTGCAGGAGG - Intronic
1019463754 7:1175266-1175288 TCCCCTCCCATGACCGCAGGTGG + Intergenic
1019505165 7:1386895-1386917 TCCCCTCCCCAGGCTGCAGACGG + Intergenic
1019773346 7:2897317-2897339 TTCCAGCCCAGTGCTGCAGGAGG - Intergenic
1020008099 7:4792848-4792870 CCCACACCCACTGCTGCAGGCGG - Intronic
1020485658 7:8716847-8716869 TTTCCTCCCACTGCTGCATGGGG + Intronic
1021558606 7:21946127-21946149 CTCCCTCCCTCTGCTGCAGGGGG - Intergenic
1022957890 7:35398395-35398417 TCGCCTCCCACCTCTGCAGGTGG + Intergenic
1023851499 7:44152701-44152723 TCCCAGCCCAGTTCTGCAGCTGG - Intronic
1024225076 7:47320481-47320503 TCCCCTCCCAGTCTAGCAGCTGG + Intronic
1024335559 7:48202858-48202880 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1024825355 7:53385106-53385128 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1024941322 7:54766008-54766030 TCCTCTCACAGTTCTGGAGGCGG - Intergenic
1025206556 7:56996478-56996500 TCACCTCCCAGTGGTCTAGGAGG + Intergenic
1025665382 7:63580449-63580471 TCACCTCCCAGTGGTCTAGGAGG - Intergenic
1026741765 7:72983298-72983320 TCTAGTCCCAGTGCTGTAGGAGG - Intergenic
1026801606 7:73403723-73403745 TCTAGTCCCAGTGCTGTAGGAGG - Intergenic
1026827999 7:73596023-73596045 TCCCATCCCAGTGCCTCAGTGGG - Intronic
1027101970 7:75381779-75381801 TCTAGTCCCAGTGCTGTAGGAGG + Intergenic
1027667463 7:81057428-81057450 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1028511143 7:91627338-91627360 TCCCGCACCAGAGCTGCAGGTGG + Intergenic
1029595130 7:101533646-101533668 TCCCTGCCCAGTGCTGCCTGGGG - Intronic
1033036408 7:137879913-137879935 TCGCCTGCCAGTGCTGCTGCAGG + Exonic
1033356166 7:140601911-140601933 TCCCCTCTCCGTGCTGAAGCAGG - Exonic
1034078311 7:148253539-148253561 TCCAGTCCCAGTGCTCAAGGTGG + Intronic
1034965232 7:155386730-155386752 TCATCTCCCAGGGCTGCAGAGGG - Intronic
1035064579 7:156095547-156095569 TCTCCTCCCACGGCTGCAGAAGG + Intergenic
1035382511 7:158448718-158448740 TCCCCTGGCACTGCTGCTGGGGG + Intronic
1037239432 8:16760486-16760508 TCCCACACCAGGGCTGCAGGAGG + Intergenic
1037263772 8:17036763-17036785 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1037807745 8:22067723-22067745 TCCCCACCCAGTGTGGCTGGGGG - Intronic
1038452983 8:27651642-27651664 TTCCCACCCCGGGCTGCAGGGGG + Intronic
1039637377 8:39180542-39180564 TCCCGCACCAGGGCTGCAGGTGG - Intronic
1039915151 8:41854681-41854703 TGCAATCCCAGTGCTTCAGGAGG + Intronic
1040003620 8:42600002-42600024 TCCCACGCCAGGGCTGCAGGCGG + Intergenic
1040324021 8:46332104-46332126 TCCCACACCAGAGCTGCAGGTGG - Intergenic
1040952638 8:52952802-52952824 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1041430479 8:57776240-57776262 TCTAATCCCAGTGCTTCAGGGGG + Intergenic
1041919000 8:63162404-63162426 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1043102168 8:76060398-76060420 TCCTGTGCCAGGGCTGCAGGTGG + Intergenic
1043640234 8:82441793-82441815 TCCCTTACCGGGGCTGCAGGTGG - Intergenic
1043674778 8:82937286-82937308 ACCCCTGCCAGTGCTGCTGCCGG + Intergenic
1043800898 8:84608332-84608354 TCCCATCCCAGTCCTGCATGAGG - Intronic
1044725304 8:95189958-95189980 CTCCCTCCCAGTGCTGTATGAGG + Intergenic
1045009567 8:97945873-97945895 TCCCCTCCCAGTGTCCCAGAGGG + Intronic
1045467689 8:102485459-102485481 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1046445412 8:114311765-114311787 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1046450781 8:114386570-114386592 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1046497846 8:115037106-115037128 TCCCCTGCCAGGGCAGCAGGCGG - Intergenic
1046794518 8:118356481-118356503 TTCCCTCCCTGAGCTGCAGGTGG - Intronic
1047513139 8:125530689-125530711 TCCCCTCCCAGTTCTAGGGGAGG + Intergenic
1048253685 8:132888343-132888365 TTCCCTTCCAGTGCTGCTAGTGG - Exonic
1049007240 8:139863344-139863366 CCTCCTCCCTGTGCTGCAGCTGG - Intronic
1049099646 8:140569710-140569732 TCACCTCCCAGAACTGGAGGTGG - Intronic
1049263870 8:141654571-141654593 TCCCCTCCCACTGTTTCAGAGGG - Intergenic
1049499968 8:142957112-142957134 GCCCCTCACAGTGCAGCCGGTGG + Intergenic
1049605267 8:143526396-143526418 TCCTCTCCCAGTCCTGCTGCTGG + Intronic
1049704402 8:144034076-144034098 TCCCCTCCCTCTTCTGCAGTTGG + Intronic
1051779862 9:20678576-20678598 CCCCTTCACAGTGCTGCAGGAGG + Intronic
1052370581 9:27659987-27660009 TCCACTGCCATTGCTGAAGGGGG + Intergenic
1052979623 9:34438360-34438382 TCCCGCACCGGTGCTGCAGGTGG - Intronic
1053067564 9:35079289-35079311 TCCCTTGCCACTGCTGCAAGGGG - Intronic
1053268705 9:36735089-36735111 TACCCTCCCAGCACTGCAAGTGG - Intergenic
1053426361 9:38012729-38012751 TGCCCTCCGTGTGCCGCAGGTGG - Intronic
1053436159 9:38075738-38075760 TCCTGTCCCGGGGCTGCAGGTGG - Intergenic
1053715507 9:40884390-40884412 TCCCATCCCTGGGCTGCAGAGGG - Intergenic
1053803391 9:41777889-41777911 GCCACTCCCAGGACTGCAGGGGG + Intergenic
1054077037 9:60546347-60546369 TCCCATCCCTGGGCTGCAGAGGG + Intergenic
1054141872 9:61537235-61537257 GCCACTCCCAGGACTGCAGGGGG - Intergenic
1054191683 9:61989199-61989221 GCCACTCCCAGGACTGCAGGGGG + Intergenic
1054461630 9:65468413-65468435 GCCACTCCCAGGACTGCAGGGGG - Intergenic
1054646687 9:67598513-67598535 GCCACTCCCAGGACTGCAGGGGG - Intergenic
1055086224 9:72316638-72316660 TCCACTCACAGGGCTGCAGCGGG - Intergenic
1055102498 9:72480185-72480207 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1055138882 9:72852614-72852636 GACCTTCCCATTGCTGCAGGCGG + Intergenic
1056380954 9:86056920-86056942 TGTAATCCCAGTGCTGCAGGAGG - Intronic
1056736003 9:89209773-89209795 TCCCACACCAGTGCTGCAGGTGG - Intergenic
1057255681 9:93545255-93545277 GGCCCTCCCAGTGCAGCATGAGG + Intronic
1058235625 9:102486929-102486951 TCCCATACCAGGGCTGCAGGTGG + Intergenic
1059070551 9:111131451-111131473 TCCACACCAAGTGCTGCTGGCGG - Intergenic
1059115605 9:111598376-111598398 TCCCCTACCGGTGCCGCGGGAGG + Intronic
1059335610 9:113566772-113566794 TCCTCTCCCAGTGCTAGAGTGGG + Intronic
1059413537 9:114149273-114149295 TCCCCACCCTGGGCTGCTGGGGG + Intergenic
1059759834 9:117327345-117327367 TCCCCTCCAGGTGCTGCTGTAGG - Intronic
1060112450 9:120916279-120916301 TCCCCACCCACAGCTCCAGGAGG - Intronic
1060594159 9:124838679-124838701 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1061479139 9:130887937-130887959 CCCACTCCCAGTGATGCCGGTGG - Intergenic
1061715381 9:132515359-132515381 CTCCCTCCCAGGGCTGCAGGAGG + Intronic
1061860883 9:133468284-133468306 TCCCCTCCCAGGTCTGCACCGGG + Intronic
1062031301 9:134363266-134363288 TCCTCTCCCAGTCCAGCATGTGG + Intronic
1062334151 9:136057653-136057675 TCCTCCCCCAGGGCTGCAGTAGG + Intronic
1062375987 9:136262154-136262176 TCCCCTCCCAGGGTGGCTGGGGG - Intergenic
1062381596 9:136289585-136289607 TCCCCCACAAGGGCTGCAGGAGG + Intronic
1062410600 9:136422213-136422235 GCCCCTCCCAGGGGTGCAGAGGG - Intronic
1062453996 9:136627193-136627215 GCCCCTCCCCGTGCTCCAGCTGG - Intergenic
1185511339 X:667079-667101 TTGCCTCCCAGAGCTGCAGCCGG + Intergenic
1186608576 X:11116102-11116124 TCCTCTCCCACTGCTTCAGTTGG - Intronic
1186639683 X:11442211-11442233 TCCCCTCTCATTGATGCCGGTGG - Intronic
1186997375 X:15138354-15138376 TCCCCTACCAGTGCTTCTAGAGG - Intergenic
1187005778 X:15231677-15231699 TCCCGTACGAGGGCTGCAGGTGG + Intergenic
1188811423 X:34657337-34657359 GCCCCTCCCCGGGCTGCGGGAGG + Intergenic
1189427014 X:40910716-40910738 CCCCCCCCCAGTGTTGGAGGTGG - Intergenic
1190101126 X:47523814-47523836 GCCCCTCCCAGCGCTGCGGCGGG + Intergenic
1191843903 X:65532308-65532330 TCCCCACCCAGTGCTACATTTGG + Intronic
1193803969 X:85972305-85972327 TCCCGCACCAGGGCTGCAGGTGG + Intronic
1196558902 X:117122996-117123018 TCCCCTGCCAGTGCTAAAGAGGG + Intergenic
1196771569 X:119300095-119300117 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1196775271 X:119332288-119332310 TCCCGCACCAGGGCTGCAGGTGG - Intergenic
1196845123 X:119891004-119891026 TCCCACACCAGGGCTGCAGGTGG - Intergenic
1197344763 X:125319009-125319031 TCCCGCACCAGGGCTGCAGGTGG + Intergenic
1200074949 X:153546271-153546293 TCCCGTCCCAGTGCAGAGGGAGG + Intronic
1200470826 Y:3584037-3584059 TCCCACACCAGGGCTGCAGGTGG + Intergenic
1201982554 Y:19923664-19923686 TCCCGCACCAGGGCTGCAGGTGG + Intergenic