ID: 1106410014

View in Genome Browser
Species Human (GRCh38)
Location 13:29504999-29505021
Sequence GCATCTCCAGCCAACCTCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106410003_1106410014 21 Left 1106410003 13:29504955-29504977 CCTGGCCCTAGGATGAGTCCACG 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209
1106410002_1106410014 22 Left 1106410002 13:29504954-29504976 CCCTGGCCCTAGGATGAGTCCAC 0: 1
1: 0
2: 0
3: 13
4: 103
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209
1106410005_1106410014 16 Left 1106410005 13:29504960-29504982 CCCTAGGATGAGTCCACGCTGGG 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209
1106410012_1106410014 -10 Left 1106410012 13:29504986-29505008 CCGGGCCTCAGGTGCATCTCCAG 0: 1
1: 0
2: 2
3: 99
4: 1879
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209
1106410010_1106410014 3 Left 1106410010 13:29504973-29504995 CCACGCTGGGCTTCCGGGCCTCA 0: 1
1: 0
2: 2
3: 22
4: 220
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209
1106410007_1106410014 15 Left 1106410007 13:29504961-29504983 CCTAGGATGAGTCCACGCTGGGC 0: 1
1: 0
2: 2
3: 9
4: 128
Right 1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG 0: 1
1: 0
2: 0
3: 26
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106410014 Original CRISPR GCATCTCCAGCCAACCTCCA AGG Exonic
900176853 1:1294889-1294911 GGAACTCCACCCACCCTCCAGGG + Intronic
902368134 1:15990480-15990502 GCACCTCCAGCCAGGCTCCAGGG + Intergenic
904715554 1:32465167-32465189 CAATCTCCAGCCAGCCTCCCGGG - Intronic
905225038 1:36473424-36473446 GCATCACCCACCAACATCCATGG + Exonic
907914253 1:58854028-58854050 TCATCTCAATCCACCCTCCATGG - Intergenic
908422112 1:63969234-63969256 GCATCTCCTTCCAACCCCAATGG - Intronic
909353782 1:74683847-74683869 TCATCTCCAACCACCCTCCATGG - Intergenic
913243095 1:116847545-116847567 GTATCTCCTCCAAACCTCCATGG + Intergenic
913276915 1:117147019-117147041 GCATCCCCACCAAGCCTCCAGGG - Intronic
914397536 1:147285190-147285212 GCATCTCCACACACCCTGCATGG - Intronic
915120513 1:153627443-153627465 TGATCTCCAGCCTCCCTCCAGGG + Intronic
915357993 1:155268125-155268147 GCCTCTCCTGCCAACTTACAGGG - Exonic
919919531 1:202160008-202160030 ACACCTCCAGCCTACCTCCCTGG - Intronic
920014492 1:202895507-202895529 GCACATCCAGCCTACCTCCCAGG + Exonic
920338930 1:205263228-205263250 GCATCTCCAGCCTTCCTCACTGG - Intronic
920560250 1:206933519-206933541 CCATCGCCAGGCTACCTCCAGGG - Intronic
921137294 1:212273119-212273141 TCATCTCCAGCCAATCTCTTTGG + Intergenic
923856302 1:237848745-237848767 GCCTCACTGGCCAACCTCCAGGG - Intergenic
924019256 1:239763803-239763825 CCATGTCCAGCCAGCCCCCAAGG - Intronic
924707905 1:246513230-246513252 GCACCTCCAGCCAGGCTCCAGGG - Intergenic
1065304804 10:24357868-24357890 GCCTCACCAGCCAACCTGCTGGG - Intronic
1066410404 10:35163128-35163150 GCAGCTTCAATCAACCTCCAGGG - Intronic
1067352036 10:45485132-45485154 GCATGTACTGACAACCTCCAGGG + Intronic
1072670578 10:97426289-97426311 GCATCCCCAGCCCGCCGCCATGG + Exonic
1074715885 10:116218292-116218314 GCATCTCAAGCCACACTCCCTGG + Intronic
1074856919 10:117480569-117480591 GCATCTCCATCCTCCCTCCTAGG + Intergenic
1077797659 11:5508674-5508696 CCACCACCAGCCAACCTTCAAGG - Exonic
1078725988 11:13931451-13931473 ACACCTCCAGCCAACTTCCAGGG - Intergenic
1078843424 11:15100385-15100407 CAGTCTCCAGCCTACCTCCACGG - Intergenic
1080584070 11:33665918-33665940 GCAGCTGCAGCCACCCTCCCAGG - Intronic
1084774971 11:71369126-71369148 GCTTCCCCAGCCAAGCGCCATGG + Intergenic
1087270583 11:96107675-96107697 GCTTCACCACCCAACCTCCAGGG + Intronic
1089731652 11:120523073-120523095 GCATCCCCACCCAGCCTCCTAGG - Intronic
1089811252 11:121133688-121133710 GCATCTCCACTCAGCCTCCCGGG + Intronic
1090417342 11:126549641-126549663 CCATCCCCAGCCAGCCTCAAAGG - Intronic
1090876919 11:130798424-130798446 GCATTTCCAGGGAAACTCCATGG - Intergenic
1092447191 12:8568331-8568353 GCCTCTGCAGCCACCCTCCCAGG - Intergenic
1092654699 12:10672661-10672683 CCATCTCCCGCCAACCTCATCGG + Intronic
1096273857 12:50189043-50189065 GCAGCATCAGCCAACCTTCAAGG + Intronic
1096839583 12:54371954-54371976 GCCTCACCAGCCTACCTTCAGGG + Intronic
1100337113 12:93641583-93641605 GCATCCCCAGCCCGCCGCCATGG - Intergenic
1101211941 12:102543529-102543551 CCAGCACCAGCCAACCTCCAGGG - Intergenic
1101361350 12:104030760-104030782 GCATCCCCAGCCCGCCGCCATGG + Intronic
1101957503 12:109223897-109223919 GCCTCTCCTGCTTACCTCCAAGG - Exonic
1102013437 12:109632791-109632813 TCCTCTCCTGCCCACCTCCACGG - Intergenic
1102873558 12:116432513-116432535 CCAGCTCCAGTCAAGCTCCAGGG + Intergenic
1103539513 12:121656096-121656118 GCTTCTCAACCCAACCTCCTCGG - Intronic
1103847190 12:123909625-123909647 GCATCCCCAGCCACTCTCCCTGG - Intronic
1103878905 12:124150831-124150853 AGATCTCCAGCCAACAACCAGGG + Intronic
1103942833 12:124510231-124510253 GCTTCTCCTCCCGACCTCCATGG + Intronic
1105835069 13:24203045-24203067 TGATCTGCAGCCAACCACCATGG - Intronic
1105860126 13:24401953-24401975 TGATCTGCAGCCAACCACCATGG + Intergenic
1106015445 13:25864836-25864858 TCATCTCTAGCCTTCCTCCAGGG + Intronic
1106410014 13:29504999-29505021 GCATCTCCAGCCAACCTCCAAGG + Exonic
1107720884 13:43246787-43246809 GCTTCTCCAGCCACACCCCAAGG + Intronic
1111706941 13:91761873-91761895 GCCCCTCCCACCAACCTCCAGGG - Intronic
1115149117 14:30263079-30263101 TCATCTCCATCCAAACTCCTTGG - Intergenic
1116478136 14:45365345-45365367 GCCTGTCCTTCCAACCTCCAAGG - Intergenic
1117579540 14:57138190-57138212 GCATCTCCTGCAGACCTACAGGG - Intergenic
1119396011 14:74326846-74326868 GCAACTCCCCTCAACCTCCAGGG - Intronic
1120612839 14:86664177-86664199 TCAACTCCACCCAACCTCCAGGG - Intergenic
1120862824 14:89270084-89270106 GCAATTCCAGCCCATCTCCAAGG + Intronic
1122677306 14:103426429-103426451 GCATCTATAGCCAAAGTCCAGGG - Intronic
1123088441 14:105730352-105730374 GCATCTCCACAGAGCCTCCAGGG + Intergenic
1123094385 14:105759723-105759745 GCATCTCCACAGAGCCTCCAGGG + Intergenic
1124706386 15:31970136-31970158 TCCTCTTCAGCCAAACTCCATGG + Intergenic
1124912500 15:33936285-33936307 GCATCTGCAGACAAACTGCAAGG + Intronic
1125391428 15:39196850-39196872 GCATCACCAGCAATCCTCCCTGG + Intergenic
1126882450 15:53113944-53113966 ACAGCTCCACCCAACCTCCTAGG + Intergenic
1127724796 15:61738838-61738860 GCATCTCCATCAAAGCTCTAGGG + Intergenic
1130074159 15:80674443-80674465 GCCTCACCCACCAACCTCCAGGG + Intergenic
1130243879 15:82225027-82225049 TCATATCAAGCCAACCCCCAGGG - Intronic
1130456598 15:84116260-84116282 TCATATCAAGCCAACCCCCAGGG + Intergenic
1130692465 15:86095321-86095343 GCCTCACCTCCCAACCTCCAGGG - Intergenic
1131853089 15:96563571-96563593 GCACATCCAGCCAACCTCTGGGG - Intergenic
1133052186 16:3123639-3123661 CCATCTGCAGGCACCCTCCACGG - Intergenic
1137599094 16:49744027-49744049 GCAGCCTCAGCCCACCTCCAAGG + Intronic
1138195241 16:55047048-55047070 GCATCTCCAGCGTATCTCCCTGG + Intergenic
1138947113 16:61864710-61864732 TCATCCCCAGCCAAGCTCTAGGG + Intronic
1140525046 16:75615754-75615776 GCATTTCTAGCCAACTCCCAAGG - Intronic
1140859289 16:79005254-79005276 CGATCTCCAGCCAAAGTCCAAGG + Intronic
1142158584 16:88545520-88545542 GCATCTCCCGGCAGCGTCCATGG - Intergenic
1142319191 16:89370181-89370203 GCAGCTCCACCCCAGCTCCAGGG - Intronic
1142349728 16:89574669-89574691 GCCTCTTTAGCCAACCTCCCGGG + Intergenic
1143205245 17:5136447-5136469 GAACCTCCAGCCAGGCTCCAGGG + Intronic
1143675524 17:8429701-8429723 GCAACTCCAGCCCACTTCTACGG - Intronic
1143792927 17:9312862-9312884 GCGTCCCCAGGCATCCTCCAGGG + Intronic
1144620510 17:16815685-16815707 GCCTCTCCAGCCAACATGCAAGG + Intergenic
1144873025 17:18382183-18382205 ACACCTCCAGCCAAGCTCTAGGG - Intronic
1144876296 17:18399140-18399162 GAACCTCCAGCCAGGCTCCAGGG + Intergenic
1145155933 17:20545280-20545302 GAACCTCCAGCCAGGCTCCAGGG - Intergenic
1145760941 17:27425282-27425304 GCACCTCCAGCCAGGCTCCAGGG + Intergenic
1146160981 17:30559439-30559461 GCACCTCCAGCCAGGCTCCAGGG + Exonic
1146843387 17:36169347-36169369 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1146855697 17:36257286-36257308 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1146864924 17:36331089-36331111 GAACCTCCAGCCAGGCTCCAGGG + Intronic
1146871603 17:36381197-36381219 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1146878963 17:36432279-36432301 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1146882903 17:36453425-36453447 GAACCTCCAGCCAGGCTCCAGGG - Intergenic
1147067783 17:37931683-37931705 GAACCTCCAGCCAGGCTCCAGGG + Intronic
1147074489 17:37981821-37981843 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1147079314 17:38011238-38011260 GAACCTCCAGCCAGGCTCCAGGG + Intronic
1147086012 17:38061360-38061382 GAACCTCCAGCCAGGCTCCAGGG - Intronic
1147095254 17:38135180-38135202 GAACCTCCAGCCAGGCTCCAGGG + Intergenic
1147101957 17:38185325-38185347 GAACCTCCAGCCAGGCTCCAGGG - Intergenic
1147241332 17:39092556-39092578 GCAGCTCCAGGGAACCTGCAAGG - Intronic
1149846549 17:60011835-60011857 GAACCTCCAGCCAGGCTCCAGGG - Intergenic
1150084895 17:62268410-62268432 GAACCTCCAGCCAGGCTCCAGGG - Intergenic
1150147285 17:62779566-62779588 GCAAATCGAGCCAGCCTCCACGG + Intronic
1151361625 17:73592680-73592702 GCATCCTCAGCCAGCCACCAAGG - Intronic
1151367879 17:73628926-73628948 GCTTCTCCAGCTCACGTCCAGGG - Intronic
1152811514 17:82384879-82384901 GCAGCTCCAGCCATCCTCCCCGG - Intergenic
1152907709 17:82977970-82977992 GAACCTCCAGCCAAGCCCCAGGG - Intronic
1153282267 18:3425659-3425681 GCATCCCCAGCCAATCCGCATGG + Intronic
1159917537 18:74200123-74200145 GCAGCTCCACCCAGCCTCCTCGG + Intergenic
1160343834 18:78112911-78112933 GCATATCAAGCCAAGTTCCACGG + Intergenic
924980566 2:216200-216222 GCATTTCCAGCCACACTGCATGG + Intergenic
926655428 2:15399342-15399364 GCATCTCTTGTCACCCTCCAGGG + Intronic
927183695 2:20467228-20467250 GCAGCTCGAGCCCACCTCCTTGG - Intergenic
927206164 2:20611875-20611897 GCACCTACAACCACCCTCCATGG + Intronic
936854344 2:116938373-116938395 ACATCTGCAGCAAACCCCCATGG - Intergenic
936889684 2:117354731-117354753 GCTTTTCCAGCCCACCTCCCAGG - Intergenic
938080876 2:128369438-128369460 GCATCTCCCACCAGCCTGCAGGG - Intergenic
938324732 2:130390902-130390924 GGTTCCCCAGCCAACCTCCTGGG - Intergenic
940391081 2:153133308-153133330 GGATCCCCAGAGAACCTCCAAGG + Intergenic
940901717 2:159131944-159131966 GCCTCTGCAGCCAGCGTCCATGG + Intronic
940908123 2:159186827-159186849 GCATCTCCTTCCCACCTGCAGGG - Intronic
942216275 2:173722201-173722223 GCATCTCCAGTAATCCTCAAAGG + Intergenic
942493928 2:176519130-176519152 AGCTCTCCAGCCAGCCTCCAGGG - Intergenic
946427678 2:219608190-219608212 GCACCTCCAGCCAGCTCCCAGGG + Exonic
946789451 2:223285421-223285443 GCAGCTGCAGCCACCCTCCCAGG - Intergenic
948880784 2:240856203-240856225 GGATTTCCAGGCAGCCTCCAGGG - Intergenic
1170651843 20:18250232-18250254 GATTCTGGAGCCAACCTCCAGGG + Intergenic
1171555798 20:26081690-26081712 GCATCTCCAGCCAGCATCGCGGG + Intergenic
1173988078 20:47278267-47278289 GCCGCTGCACCCAACCTCCAAGG + Intronic
1174104764 20:48154381-48154403 ACATCTCCAGCCTAGCTTCAGGG - Intergenic
1174119252 20:48249979-48250001 CCTTCCCCAGCCACCCTCCATGG + Intergenic
1174163212 20:48566218-48566240 GTTTCTCCACCCAACATCCAGGG - Intergenic
1175408001 20:58747461-58747483 GCATCAACAGCCAGCCCCCAAGG - Intergenic
1175759250 20:61550130-61550152 GCCTCCCTAGCCTACCTCCATGG + Intronic
1176210088 20:63915571-63915593 GCGTCTCCAGCCTACCTTCAAGG - Intronic
1180140820 21:45892598-45892620 GCAGGTCCAGCCAACCCACAGGG + Intronic
1181477144 22:23175774-23175796 GCTTCTGCAGCCAAGTTCCAGGG + Intergenic
1181895752 22:26106024-26106046 CCATCTCCAGCCCAGCACCAGGG + Intergenic
1184197909 22:42944214-42944236 GCACCCCCAGCCATCCTACAAGG + Intronic
1184324678 22:43774379-43774401 GGGTCTGCAGCCAATCTCCATGG - Intronic
1184613503 22:45622053-45622075 GCTTCTGCAGCCACCCTCCCAGG + Intergenic
1184660573 22:45963803-45963825 CCAGCCCCAGCCACCCTCCAAGG + Intronic
1184663917 22:45977654-45977676 GCCACTCCAGCAAACCTCAATGG + Intergenic
1185400511 22:50613173-50613195 GCAGATCCAGCTGACCTCCAGGG + Intronic
949964989 3:9348424-9348446 GCATCCCCAGCCCGCCACCATGG + Intronic
953751976 3:45615982-45616004 GCATCTTCAGCCAGCCTTCAGGG + Intronic
953767706 3:45756607-45756629 ACATCTCCGGCCAACGTCCCAGG + Exonic
954154952 3:48680276-48680298 CCATCTCCAGGGAGCCTCCAAGG + Intronic
954301886 3:49704690-49704712 GGAGCTCCAGTCAACCGCCATGG + Exonic
954347572 3:50013148-50013170 GCACCTCCATCCAACCTCAAAGG - Intronic
956163151 3:66375744-66375766 TCATCTCCAGCAGAACTCCAGGG - Intronic
957268366 3:77997056-77997078 CTATCTCCAGGCAGCCTCCATGG - Intergenic
959521399 3:107326605-107326627 GTATCTCAAGCCCACCTCAAAGG + Intergenic
961644787 3:128387108-128387130 GCAACACCAGCCACCCTCCTCGG + Intronic
963261966 3:143201988-143202010 ACTTTTCCAGCCACCCTCCATGG + Intergenic
963844360 3:150140536-150140558 CCATCTCCTGCCATCCTCCTAGG - Intergenic
967129604 3:186458438-186458460 GCCTCAGCAACCAACCTCCAGGG - Intergenic
968619204 4:1596160-1596182 GAATCACCAGGCCACCTCCAGGG + Intergenic
968843826 4:3028372-3028394 GCAGTGCCAGCCAACCCCCAGGG + Intronic
969449762 4:7266276-7266298 GCATCTTCTCCCAACTTCCACGG - Intronic
969832666 4:9810403-9810425 GCATCTCCAGCCAGGCCTCAGGG + Intronic
970652071 4:18189882-18189904 GCATTTCCAGCAAGCCCCCAGGG + Intergenic
975992051 4:80267316-80267338 GCATCTCCACCCAACCCGCCCGG - Intronic
977617679 4:99104445-99104467 GCATCCCCTGCCAACCTACAGGG - Intergenic
979512185 4:121567341-121567363 GCATCCCCAGTCGCCCTCCATGG - Intergenic
981734056 4:147930923-147930945 GCTTCTCCAGCCCACCTACAGGG + Intronic
981854688 4:149274256-149274278 GCATCTTCTGCCATCATCCATGG - Intergenic
983183488 4:164675999-164676021 GCATTTCCAACCAACCTACCAGG + Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
986293002 5:6415399-6415421 GCATCTACAGAATACCTCCACGG + Intergenic
986741697 5:10710644-10710666 CCTTCTCCAGCCACCCTCCCAGG - Intronic
986960360 5:13203063-13203085 GCAGCTCCAGCCAATCTGAAAGG - Intergenic
991470829 5:66967318-66967340 CCATCTCCAGCGGAACTCCAGGG + Intronic
992158535 5:73978539-73978561 CCATCTCCACCCCACTTCCACGG - Intergenic
993015754 5:82532736-82532758 GCCTCTGCAGCCAACCTCTCTGG - Intergenic
994016100 5:94967208-94967230 CCATCTCTACCCAACCTTCAGGG - Intronic
994603963 5:101943197-101943219 CCATCTCCATCTAATCTCCAGGG + Intergenic
997527758 5:134564438-134564460 TCATCCCCAGCCTGCCTCCAGGG - Intronic
997844597 5:137275435-137275457 GCATCCCCAGCCATCAGCCAAGG - Intronic
997856695 5:137379101-137379123 CCATCACCAGCTAACCTCCAAGG + Intronic
999409824 5:151341077-151341099 GTATCTCCAGCAAACCACCATGG - Intronic
1001801595 5:174549015-174549037 TCACCTTCAGCCAACCTTCAGGG - Intergenic
1009513084 6:64577891-64577913 GCATCTTAAGCCACCCTCTAAGG - Intronic
1009953764 6:70426672-70426694 TCATGTCCTGCCAACATCCATGG - Intronic
1011239803 6:85258788-85258810 GCCCCTCTACCCAACCTCCAGGG - Intergenic
1011517499 6:88168182-88168204 GCATTTTTAGCCCACCTCCATGG + Intergenic
1013285013 6:108673687-108673709 GCATTTCCACCCACCCTCCAGGG + Intronic
1014635635 6:123843358-123843380 TCATCCCCAGCCAAACTCCAGGG - Intronic
1018226547 6:161634679-161634701 GCATCTCCAGGTAAATTCCACGG - Intronic
1019296192 7:276630-276652 GCAGCTGCAGCCACCCTCCAAGG + Intergenic
1019860432 7:3653525-3653547 GCTTCTCCTGCCACCCTCCCTGG - Intronic
1022529127 7:31056270-31056292 GAGTGTCCAGCCATCCTCCAAGG - Intronic
1024254682 7:47531898-47531920 GCAGCTGCAGCCACCATCCACGG + Intronic
1024254704 7:47531992-47532014 GCAGCTGCAGCCACCCTCCCAGG + Intronic
1024263269 7:47587579-47587601 CCCTCTCCAGCCAATCTCCAAGG - Intergenic
1024296286 7:47845305-47845327 GCATCTCAGGACAGCCTCCATGG - Intronic
1027516627 7:79149668-79149690 ACATTTCCAGCCAAGATCCAGGG + Intronic
1028368252 7:90060277-90060299 GCATTTCCAGCCTACCTCTCTGG - Intergenic
1030196319 7:106857121-106857143 TCCTCTCCATCCAACCTGCATGG + Intergenic
1032751046 7:134841992-134842014 CCCTCACCATCCAACCTCCAGGG + Intronic
1035266589 7:157692998-157693020 GCGTCCCCAGCCAGGCTCCAGGG + Intronic
1037982355 8:23263267-23263289 GACTCTCCAGCCACCCTCCCAGG - Intergenic
1039039695 8:33395468-33395490 CCATCCCCGGCCAAACTCCAGGG + Intronic
1043219673 8:77644858-77644880 GCAGCTCCAGCCAAAGTCTAAGG + Intergenic
1045410015 8:101907749-101907771 GCTTCTCCAGGCAACTTCCAAGG + Intronic
1048932204 8:139324248-139324270 GCAGCTCCAGCCTAGCTGCAAGG + Intergenic
1049817904 8:144616544-144616566 GCCCCCCAAGCCAACCTCCAGGG + Intergenic
1052441305 9:28499163-28499185 GCATCTCCAACTGACCTCCCAGG - Intronic
1053178101 9:35943931-35943953 GCATCCCCAGCCCACCGCCATGG - Intergenic
1057183134 9:93040488-93040510 GTACCTCCAGTCTACCTCCAGGG + Intergenic
1058959684 9:109980726-109980748 GCAGCTCCAGCCCATCACCATGG - Intronic
1061333948 9:129916935-129916957 GCATCAGCAGACACCCTCCACGG - Intronic
1061502686 9:131012967-131012989 GCAGCCCCAGCCCACCACCAAGG + Intronic
1062151120 9:135019538-135019560 CCATCTCCAGCCCAGCTCAAGGG - Intergenic
1062337713 9:136079699-136079721 GCTTCTGCAGCCACGCTCCAGGG - Intronic
1062550904 9:137086177-137086199 TCATCTCAAGCTGACCTCCAAGG + Intergenic
1062558935 9:137130431-137130453 TCATCTCAAGCTGACCTCCAAGG - Intergenic
1185590297 X:1271885-1271907 TCATCTACAGCAAACCTACAGGG - Intronic
1186538327 X:10372927-10372949 GTATCTCCAGCCCAACTCCAAGG + Intergenic
1186713166 X:12221782-12221804 GCATCTCCACCCAGCATTCAGGG - Intronic
1187032844 X:15505718-15505740 CCTTCTCCAGTAAACCTCCAAGG - Intronic
1187529201 X:20081348-20081370 ACCTTTCCAGCCAATCTCCATGG + Intronic
1190290569 X:48989519-48989541 GACTCCCCAGCCAGCCTCCATGG + Intronic
1192635010 X:72807967-72807989 GCATCTCCGGCCCTCTTCCATGG + Intronic
1192646705 X:72912836-72912858 GCATCTCCGGCCCTCTTCCATGG - Intronic
1192926315 X:75758692-75758714 GAACCTCCAGCCACCCTCGAGGG + Intergenic
1194918598 X:99735087-99735109 CCATCACCACCCAATCTCCATGG + Intergenic
1197729222 X:129795668-129795690 TCATCTCCATCCTACCTCCCAGG - Intergenic
1199822496 X:151462965-151462987 ACATGCCCAGCCAACCTCCACGG - Intergenic
1201054885 Y:9978752-9978774 GCATCCCCAGCTAATGTCCAGGG - Intergenic