ID: 1106415265

View in Genome Browser
Species Human (GRCh38)
Location 13:29541007-29541029
Sequence GAGTGTGCACAGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106415258_1106415265 30 Left 1106415258 13:29540954-29540976 CCTCATGGCTGGCATGTGGGCAG 0: 1
1: 0
2: 2
3: 38
4: 297
Right 1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG 0: 1
1: 0
2: 4
3: 37
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106415265 Original CRISPR GAGTGTGCACAGAAGGGGCA GGG Intronic
900175884 1:1291191-1291213 GGCCCTGCACAGAAGGGGCACGG + Intronic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
901218016 1:7565484-7565506 GAGTGTCCACATCAGGGGCTGGG + Intronic
901844392 1:11972785-11972807 GAGGGTGCACACATGGGGCCTGG - Intronic
902173173 1:14629540-14629562 GAGGGAGCAAAGAAGAGGCAGGG - Intronic
902743599 1:18457969-18457991 GAGTGTGGCCAGGAGTGGCATGG + Intergenic
903838161 1:26219364-26219386 GAGGGAGCACAGCAGGGGCGGGG - Intergenic
905452461 1:38065393-38065415 GGGTAAGCTCAGAAGGGGCAGGG + Intergenic
905721479 1:40206583-40206605 TTGTGTGCAGAGAAGTGGCATGG - Intronic
906237566 1:44221211-44221233 GAGGGGGCACAGGAGGGGCTTGG + Exonic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
908143101 1:61208345-61208367 GAGTGAGCTCAGAAGAGGAAGGG + Intronic
909477778 1:76100929-76100951 GGCTGTGCACGGATGGGGCAAGG - Intronic
912225544 1:107729547-107729569 CATGGTGCACTGAAGGGGCATGG + Intronic
912453727 1:109783856-109783878 GAGTGGGCACAGCAAGGGTAAGG + Intergenic
912469081 1:109894312-109894334 GAGTGGGAAGAGAAGGGGCCTGG - Intergenic
912568763 1:110607021-110607043 AAGAGTGCACAGAATGGGCTCGG - Intronic
912754207 1:112310774-112310796 GAGTGTGGCCAGCAGGGGCACGG + Intergenic
912878895 1:113390187-113390209 GAGGGCGCAGAGGAGGGGCAGGG - Intergenic
913150606 1:116038915-116038937 GAGTGTGCAAATAAGTGGGAGGG - Intronic
914805071 1:150985647-150985669 GATTGAGCCCAGAAGGGTCAAGG - Intronic
915457249 1:156048936-156048958 GAGTGTCCAAAGAAGTGTCAGGG + Intronic
917196055 1:172466910-172466932 GAGTCAGCTCAGAAGGGCCATGG - Intronic
919224598 1:194679722-194679744 CATTGTAAACAGAAGGGGCAGGG + Intergenic
919819746 1:201465628-201465650 AAGTGTGCAAAGAAAGGGCCTGG + Exonic
921957604 1:221000448-221000470 GAATGAGGACAGATGGGGCAGGG - Intergenic
922109745 1:222545519-222545541 GAGAGTGGACAGAATGAGCAAGG - Intronic
922192220 1:223329399-223329421 GAGAGTGCACATATGGGGAAAGG - Intronic
922449885 1:225728464-225728486 GAGTGTGCATTGAAAGGGGAGGG + Intergenic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
923975965 1:239263022-239263044 GAGTGTGCACATCAGGGGCCAGG + Intergenic
924032525 1:239900671-239900693 CAGTGTGCTCAGAAGAGGTATGG + Intronic
924379571 1:243449855-243449877 GAGTGTGGACCTAAGGGGAAAGG - Intronic
924808167 1:247378303-247378325 GAGTGTGCATATAAGAGGCGTGG + Intergenic
1062779639 10:190370-190392 GAGGGTGTGCAGAAGAGGCAGGG - Intronic
1063009778 10:2011161-2011183 GAGTGAGCACAGGTGGGGCTCGG + Intergenic
1063991962 10:11576266-11576288 GAGTGTACCCAGAAGAGGCATGG + Intronic
1064012213 10:11743630-11743652 GGGTGCCCACAGCAGGGGCAGGG + Intronic
1065209346 10:23388030-23388052 GAGGGTGCTCAGAAAGGCCATGG - Intergenic
1065435417 10:25699966-25699988 GAGTGAGAAGAGAAGGGGCAAGG + Intergenic
1067066924 10:43109375-43109397 CTGTGTGCACAGAAGAGGCCTGG + Intronic
1067687508 10:48476038-48476060 CAGTGGGGACAGAAGAGGCAGGG - Intronic
1067828008 10:49593361-49593383 GAATCTGGACAGAAGGGCCATGG + Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068142915 10:53028764-53028786 GTGGGTGCACGGCAGGGGCAAGG - Intergenic
1069723884 10:70565536-70565558 GAGTGGGCACAGGAAGGGTATGG + Intronic
1070001639 10:72382536-72382558 GAGTTAGAACAGAAGGTGCAGGG + Intronic
1070543201 10:77432132-77432154 GAAGGTGCTCAGAAGGGGAAAGG - Intronic
1070641078 10:78170606-78170628 GATTGGGCACAGAAGGGGAGGGG + Intergenic
1072101248 10:92231492-92231514 GAGAGTGGACAGAAGGGAAAAGG - Intronic
1072323661 10:94275088-94275110 GACTGTGCACAGAATGGAAAAGG - Intronic
1072792363 10:98327442-98327464 GGGAGGGCACAGAAGGGGCCAGG + Intergenic
1073047082 10:100645853-100645875 GAGTGTGTGCGGCAGGGGCAGGG - Intergenic
1073118689 10:101108200-101108222 GAGGGGTCACAGCAGGGGCAGGG + Intronic
1075091691 10:119447373-119447395 GAGGGTGCAGAGATGGGTCAAGG - Intronic
1075213895 10:120515308-120515330 GAGTGTGAGGAGAAGAGGCAAGG - Intronic
1075614924 10:123883887-123883909 CAGTGTGCAGAGAAGGGGCCAGG + Intronic
1075736688 10:124668750-124668772 AAGTGTGCACAGAACAGGCCTGG + Intronic
1076314802 10:129532607-129532629 GAGTGTGCAGAGACAGGGCCAGG - Intronic
1076340786 10:129743533-129743555 GAGTGTGCGGACAATGGGCAGGG - Intronic
1076570957 10:131432538-131432560 GAGAGTGCACAGAGGGGAGAGGG + Intergenic
1078023611 11:7674057-7674079 GCGTGTGCAGGGAAGGGGCCAGG - Exonic
1078672451 11:13377146-13377168 CAGCGTGGACAGCAGGGGCAGGG - Intronic
1079139115 11:17795842-17795864 GCATGTGTACACAAGGGGCATGG + Intronic
1080015315 11:27500107-27500129 GAGTGGGCACTGAATGGGCTAGG - Intronic
1080604560 11:33854342-33854364 GAATTTGCAGGGAAGGGGCAAGG - Intergenic
1081320893 11:41690221-41690243 GAGGGTGCATGGAAGGGGAATGG - Intergenic
1081535574 11:43993698-43993720 GGGTGTGCACAGAAGGGGGCAGG - Intergenic
1081735058 11:45397000-45397022 CAGTGTGCCCAGAGAGGGCATGG - Intergenic
1083608205 11:63991661-63991683 GAGTGTGCTCACAATGGCCATGG + Intronic
1083892020 11:65600184-65600206 GTGGGTGGGCAGAAGGGGCAGGG - Intronic
1083928334 11:65823185-65823207 GAGTGCCCACAGGAGGCGCACGG - Intronic
1083952346 11:65963864-65963886 GAAGGTGCACAGAAGAGGCAGGG + Intronic
1085371067 11:76005917-76005939 TGATGTGCACAGACGGGGCATGG - Intronic
1085976826 11:81665913-81665935 GAGTGTGTAGAGGAGAGGCAGGG + Intergenic
1086408127 11:86516893-86516915 GAGTGGCCAGAGAAGGGGCATGG + Intronic
1087267771 11:96079636-96079658 GAGTATGCAAAGAAGGGATAAGG - Intronic
1087272279 11:96123725-96123747 CAGTGTGCACAGATGGGGAAGGG + Intronic
1090444888 11:126755749-126755771 AAAAGTGCAAAGAAGGGGCATGG - Intronic
1090934969 11:131333183-131333205 GAGTGTGCCCTGAAGAGGAATGG - Intergenic
1091175633 11:133554929-133554951 GAATGGGCACAGAAGGCGCACGG + Intergenic
1092777818 12:11959514-11959536 GGGTGAGGACAGAAGGGTCAGGG + Intergenic
1093305911 12:17518035-17518057 GAGTTTGCACAGAAAGGGGTAGG + Intergenic
1093906897 12:24703796-24703818 GAGAGTGGACAGAAGAGGTAAGG - Intergenic
1095786782 12:46118660-46118682 GTGTGTGCCCAAAAAGGGCATGG + Intergenic
1096216764 12:49802065-49802087 GTGTGTGCCCAGAAGGGTCCTGG - Intronic
1096670739 12:53196926-53196948 GAGGGTGCACCTAGGGGGCAGGG + Intronic
1101809872 12:108098444-108098466 GAGTGTGGGCAGATGGGGCAGGG - Intergenic
1102490200 12:113286012-113286034 GGGTGTGCAGAGAAGGGTCTGGG - Intronic
1104227585 12:126850842-126850864 TAGTGAGCACTGAAGGGGAAAGG + Intergenic
1104846635 12:131850343-131850365 AAGTGTGCCCAGACGAGGCATGG - Intronic
1106248508 13:27967536-27967558 GAGTGTGCCTAGAGGTGGCAAGG - Intronic
1106415265 13:29541007-29541029 GAGTGTGCACAGAAGGGGCAGGG + Intronic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107917536 13:45168259-45168281 TAGTGTGCACAGTAACGGCAAGG - Intronic
1108638160 13:52356777-52356799 TAGTGTGCCCAGAGGGGACATGG + Intergenic
1110455552 13:75686618-75686640 GAATGTGTACAGAAGGGTCTAGG + Intronic
1111037984 13:82704539-82704561 TGGTGTGCCCAGAGGGGGCATGG + Intergenic
1111412620 13:87896125-87896147 TAGTGTGCCCAGACAGGGCATGG - Intergenic
1112351730 13:98640797-98640819 GAGTTTGCACAGGCTGGGCACGG - Intergenic
1112668956 13:101612954-101612976 GCGTGTGCTCTGAGGGGGCAGGG + Intronic
1113517554 13:110915062-110915084 GAGCGCGCACAGAGGGGGCGGGG + Exonic
1114458246 14:22871339-22871361 CAGTTTGCAGAGAAGGGGCGGGG + Intergenic
1117293265 14:54353987-54354009 GAGTGTGGACACAAAGGGCGAGG + Intergenic
1117458550 14:55921868-55921890 TAGTGAGCTTAGAAGGGGCAGGG + Intergenic
1119186802 14:72648941-72648963 GAGTGTGGAAAGGAGGGGCATGG - Intronic
1119437032 14:74604358-74604380 GAGTGGGCACTGAAGGAACAGGG + Intronic
1119835565 14:77746902-77746924 GACCGTGCACAGAAGGGGGGAGG - Intronic
1120156639 14:81100778-81100800 GTGTGTGCCCAGAGAGGGCATGG - Intronic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1121929113 14:97956258-97956280 TACTGTGCACACAGGGGGCATGG + Intronic
1122136400 14:99635361-99635383 GATTCTTCACAGCAGGGGCAGGG - Intergenic
1122231823 14:100309945-100309967 GAGAGTGCACAGAAGGGCTCTGG + Intergenic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1124596070 15:31092198-31092220 GAGTGGGAACAGCAGGGGCAAGG + Intronic
1125589339 15:40844616-40844638 GAGCGTGCACAGAAGCCACAAGG - Exonic
1126254222 15:46606134-46606156 GAGCGTGGAGAGAAGAGGCAAGG + Intergenic
1129292768 15:74581083-74581105 TGGTGTGCCCAGATGGGGCAGGG - Intronic
1129342055 15:74892568-74892590 GAGGGTGGACAGCAGGGGCTAGG + Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130388731 15:83436073-83436095 CAGTGTGCACAGAACGTGCCAGG - Intergenic
1131175445 15:90206391-90206413 GAATGTGAAGAGGAGGGGCAGGG - Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132379437 15:101356305-101356327 CACTGTGCACTGCAGGGGCAAGG + Intronic
1132525451 16:411967-411989 GAGTGTTCAGAGGAGGGGCTGGG - Exonic
1132988199 16:2778966-2778988 GAGTGTGGACAGTGGGGGCCAGG + Intergenic
1133333950 16:4994712-4994734 GAGCGTGCACAGGAGGGGGCAGG - Intronic
1133970139 16:10561481-10561503 GAGTGGGCACAGAGGTGGGAGGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136277715 16:29188761-29188783 GGATGTGCACAGGAGTGGCACGG + Intergenic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1142082089 16:88154803-88154825 GGATGTGCACAGGAGTGGCACGG + Intergenic
1142110331 16:88327689-88327711 GAGTGTGCACGGAAGGTGGGAGG - Intergenic
1142111149 16:88332404-88332426 GAGCCGGCACAGAGGGGGCAGGG - Intergenic
1142204560 16:88776700-88776722 GAGTGACCGCAGAAGGGCCAGGG + Intronic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143813654 17:9493409-9493431 CACTGTGCACTGAAGGGGCCAGG - Intronic
1143972034 17:10803026-10803048 GTGTGTGCACTGAGTGGGCATGG + Intergenic
1144543702 17:16172118-16172140 GGGTGGGAACAGAAGGGGTACGG - Intronic
1144664343 17:17091715-17091737 GAGGGTGCAAAGAATGGGGAGGG + Intronic
1146681248 17:34810020-34810042 GAGTGTGCATGGTAAGGGCAGGG - Intergenic
1149454562 17:56777403-56777425 GAGCTTGCAGAGATGGGGCAGGG - Intergenic
1149505129 17:57187993-57188015 GAGTGTGCTCAGAAGATGCAAGG - Intergenic
1150127180 17:62644950-62644972 CAGTGTTCACAGAAGGGGAGGGG + Intronic
1151642277 17:75405191-75405213 GGGTTTGCACGGAAGGGGCCCGG - Exonic
1151817172 17:76477083-76477105 CAGGGTGCTCAGAAGGGGCTTGG + Intronic
1151851868 17:76695552-76695574 GAGTGTGCACGGTGGGGGCCTGG + Intronic
1152341541 17:79728570-79728592 CGGGGTGCACAGAAGGGGCCTGG - Intergenic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1153222562 18:2874566-2874588 TACTCTGCTCAGAAGGGGCATGG - Intronic
1153638069 18:7130244-7130266 GACTGTGCAGAGAAAGGTCATGG + Intergenic
1155390683 18:25333382-25333404 GAGGGTGGGCAGAAGGGCCAGGG + Intronic
1155547631 18:26931328-26931350 GACTGTCCACTGAAGGGGTAAGG + Intronic
1156503918 18:37577193-37577215 GAGTGAGCCCAGAAGGGAAAGGG - Intergenic
1156920207 18:42513135-42513157 TAGTGTGGAAAGAAGGAGCAGGG + Intergenic
1159412630 18:68101007-68101029 GAGAGTCCAGAGAAGTGGCAAGG - Intergenic
1160035363 18:75296716-75296738 GTGTGTGCAGAGCAGGGGGACGG + Intergenic
1160486655 18:79299484-79299506 GAGACTGCAGAGAGGGGGCAGGG - Intronic
1160613750 18:80109035-80109057 GAGTTTGCACAGATGTGGAAAGG + Exonic
1161389270 19:4012759-4012781 GAGGGGGCACCGTAGGGGCAGGG + Intronic
1161503862 19:4633404-4633426 GAGAATGCACTGAAGAGGCAGGG + Intergenic
1161551033 19:4912212-4912234 GTGTGTGCAGAGAAGAGGCAGGG + Intronic
1162354568 19:10174015-10174037 GAGTGGGAAAAGAAGGGGCCTGG + Intronic
1162548969 19:11347943-11347965 GAGTGTGAGCAGGAGAGGCAGGG - Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1163127637 19:15252885-15252907 GTGTGTGCACAGATGGGGTGGGG - Intronic
1163338592 19:16689584-16689606 GAGTGTGCACAGTTGGGACCTGG + Exonic
1163686919 19:18717079-18717101 GAGTGTGCACACATGTGGCTGGG + Intronic
1164675189 19:30095943-30095965 GACTGTGCTCAGCAGGCGCATGG - Intergenic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1165757768 19:38304297-38304319 GAGTGTGGACTGGAGGTGCAGGG + Intronic
1166563095 19:43746524-43746546 GAGTGGACACAGAAGTGGCAGGG + Intronic
1167521682 19:49959335-49959357 GAGTGTGCCTAGCAGGGGCCTGG - Intronic
1167523701 19:49971387-49971409 GAGTGTGCCTAGCAGGGGCCTGG + Intergenic
1167578096 19:50327376-50327398 GAGTGAACACAGAGGGGGCCTGG + Intronic
1167723974 19:51198804-51198826 GTGTGAGCAGAGAAGGGGAATGG - Intergenic
1167756367 19:51415873-51415895 GAGTGTGCCCAGCAGGGGCCTGG - Intronic
1167768642 19:51500403-51500425 GTGTGAGCAGAGAAGGGGGAGGG + Intronic
1168042247 19:53768058-53768080 AAGTGTGAACAGAAGGGCAAAGG - Intergenic
1168130544 19:54315918-54315940 AAGTGTGCACAGAAAAGGCAGGG + Intergenic
925458915 2:4043213-4043235 GCATGTGCACGGAAGGGGCAGGG + Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
927490143 2:23515884-23515906 TAGTGGGCACAGAAGGAGCCTGG + Intronic
928023209 2:27720214-27720236 GTGTGTGCAGGGAAGGGGCAAGG + Intergenic
928178713 2:29052820-29052842 GAGTGGGCACAGCACGGGCCAGG + Exonic
928700845 2:33897000-33897022 AATTGTGCCCAGCAGGGGCAAGG - Intergenic
929628117 2:43431352-43431374 GAGTTTGCTGGGAAGGGGCATGG - Intronic
930540664 2:52702665-52702687 GAGTGTGCAGAGACATGGCAAGG + Intergenic
931078261 2:58740841-58740863 GTGTGTGTACACCAGGGGCAAGG + Intergenic
932284689 2:70522278-70522300 GAGGGTGTACAGATGGGGAATGG + Intronic
932344636 2:70987611-70987633 AAGAGTGCACAGACGGGCCAGGG + Exonic
932490900 2:72119633-72119655 GAGAATGAAGAGAAGGGGCATGG - Intergenic
935765754 2:106366335-106366357 GAATGTGGTCAGAAGGGGCCAGG - Intergenic
935836626 2:107062212-107062234 GAATGTGTGCAGAAGAGGCAAGG + Intergenic
936473782 2:112822360-112822382 GTGAGTGCAGAGACGGGGCAGGG - Intergenic
936855644 2:116954100-116954122 GAATGAGCAAAGAAGGGGAAAGG - Intergenic
937286805 2:120758970-120758992 GATTGGGCACAGAAAGGGCCTGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
937908083 2:127062061-127062083 CTGTGTGCACGGCAGGGGCAGGG - Intronic
938278098 2:130045436-130045458 GCGTGTGCCCTGAAGGCGCAGGG - Intergenic
938329068 2:130436237-130436259 GCGTGTGCCCTGAAGGTGCAGGG - Intergenic
938360877 2:130685256-130685278 GCGTGTGCCCTGAAGGTGCAGGG + Intergenic
938406053 2:131033821-131033843 GTGTGTGCAGAGAAGTGTCAGGG - Intronic
938437281 2:131291949-131291971 GCGTGTGCCCTGAAGGTGCAGGG + Intronic
938564516 2:132506627-132506649 GAGTGTTCAGCGAAGGGGGAAGG + Intronic
941178618 2:162232056-162232078 GAGTGAGCACCACAGGGGCAAGG + Intronic
942209125 2:173652920-173652942 GAGCAAGCACAGAAGGGGTACGG - Intergenic
942785178 2:179692837-179692859 TCCTGTGAACAGAAGGGGCAAGG - Intronic
944083599 2:195818685-195818707 GAGTGTGCAGAGGCAGGGCAGGG - Intronic
944354015 2:198763569-198763591 GAGTGTGTGCAGAAGGGAGATGG - Intergenic
944357134 2:198804069-198804091 GTGTGTGCACAGAATGAGCCCGG - Intergenic
945916460 2:215709613-215709635 GACTGGACACAGAAGAGGCAGGG - Intergenic
946021580 2:216644008-216644030 GAGTGGCCAGAGAAGGGGGAGGG - Intronic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
946401653 2:219471733-219471755 GAGTGGGCAAGGATGGGGCAAGG - Intronic
947983135 2:234426719-234426741 GAGTGTCAACAGATGGGGGAGGG + Intergenic
948613028 2:239181440-239181462 GCGTGTGCGCAGGAGGGGCAGGG + Intronic
949000176 2:241608849-241608871 AAGTGTGCACAGACCAGGCAGGG + Intronic
949004096 2:241635805-241635827 TAATGTGCACATAAGGGACAGGG + Intronic
1169340943 20:4795790-4795812 GAGTGAGGAGAGACGGGGCAGGG - Intronic
1169495294 20:6109385-6109407 GAGTGTGCACCCAGGCGGCACGG + Intronic
1170907166 20:20527055-20527077 GGGAGAGCACAGAAGGGACAAGG + Intronic
1171407101 20:24918813-24918835 GAGTGTGCACAAAGTGTGCAGGG - Intergenic
1171869580 20:30514301-30514323 GAGAGTGGACAGGAGTGGCAGGG - Intergenic
1172263888 20:33593842-33593864 ATGTGTGGACAGAAGGGGAAAGG - Intronic
1173061905 20:39670582-39670604 GAGTGTACAGAGTAGAGGCAAGG - Intergenic
1174114135 20:48215332-48215354 GAGTGTGTACAGGTGGGACAGGG - Intergenic
1175393665 20:58643949-58643971 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393671 20:58643975-58643997 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393677 20:58644001-58644023 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393683 20:58644027-58644049 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393689 20:58644053-58644075 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393695 20:58644079-58644101 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393701 20:58644105-58644127 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175393707 20:58644131-58644153 GAGTGTGCGCAGGAGGCCCATGG + Intergenic
1175842326 20:62036925-62036947 GAGTGTGGAAGGAAGGGGCAAGG - Intronic
1175922203 20:62455544-62455566 CAGGGTGCAGAGAAGGGGCCTGG - Intergenic
1176124119 20:63467594-63467616 GAGTGTGCACACAGGGGCCATGG + Intronic
1176520201 21:7818521-7818543 GAGTGAGCACAGAAGTGACAAGG + Exonic
1178654227 21:34448533-34448555 GAGTGAGCACAGAAGTGACAAGG + Intergenic
1179068831 21:38052988-38053010 GATTGTGCACTTAAGGGTCAGGG - Intronic
1179578208 21:42320956-42320978 ATGTGAGCACAGACGGGGCAGGG + Intergenic
1179626239 21:42651087-42651109 GAGGGTGCATGGAAGGGGCCAGG - Intergenic
1179808398 21:43854612-43854634 CTGGGTGCACAGAAGGGCCAAGG + Intergenic
1179994185 21:44966490-44966512 GGGTCTGGACAGAAGGGGTATGG - Intronic
1180800098 22:18627693-18627715 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1180851331 22:19023258-19023280 GAGGGTGTGCACAAGGGGCAGGG - Intergenic
1181221617 22:21367573-21367595 GAGGGTGTGCACAAGGGGCAGGG + Intergenic
1181221630 22:21367603-21367625 GAGGGTGGGCACAAGGGGCAGGG + Intergenic
1181610717 22:24009746-24009768 GAGTGTGGACACAAAGGGTAAGG - Intergenic
1181856447 22:25784699-25784721 GAGTGTGATTCGAAGGGGCAGGG + Intronic
1182116701 22:27760757-27760779 GGGAGGGCAGAGAAGGGGCAGGG - Intronic
1183212958 22:36462250-36462272 GAGTGCGCTCAGAAGTGGCTGGG + Intergenic
1184103753 22:42355479-42355501 GAGTGGGCACAACAGGGTCATGG + Intergenic
1184732560 22:46378723-46378745 GAGAGGACAGAGAAGGGGCAGGG + Intronic
1184859704 22:47166195-47166217 CAGTGTGCACAGAGGGTCCAGGG + Intronic
950918385 3:16668021-16668043 GAGGGGGCACTGAAAGGGCAAGG + Intronic
951476555 3:23112679-23112701 GGGTGTGGCCAGTAGGGGCAGGG + Intergenic
951484335 3:23194789-23194811 GAAGGTTCACAGAAGGGGAAGGG + Intergenic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
955754937 3:62217124-62217146 GCCTGTGCACAGTAGGGGCTTGG + Intronic
957049905 3:75403553-75403575 AAATGAGCACAGAAGAGGCAAGG + Intergenic
961859957 3:129908516-129908538 GAGTGTACACAGGCTGGGCAAGG + Intergenic
963132917 3:141875574-141875596 GAATTTGCACAGAAGGTGCGGGG - Intergenic
964268848 3:154932917-154932939 GAGTCTGCAAAGAAGAGTCATGG + Intergenic
966942950 3:184758422-184758444 AAATGTGCACAGAAGGGTCTGGG - Intergenic
967199983 3:187064457-187064479 GAGTGTGCTCAGAAAATGCATGG + Intronic
967312721 3:188121326-188121348 GGGTGTGGCCAGATGGGGCATGG + Intergenic
969640627 4:8396282-8396304 GAGTGTGCACAGGGCGTGCAAGG + Intronic
971028092 4:22608048-22608070 GACTGTCCACAGAAGGGGTAAGG + Intergenic
972930212 4:44063284-44063306 AAGTGTTCAAAGAAGTGGCATGG + Intergenic
973792466 4:54391134-54391156 CAGTGTTCACAGCAGGGCCATGG - Intergenic
975202701 4:71609904-71609926 TGGTGTGCCCAGATGGGGCATGG + Intergenic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
985588131 5:751345-751367 GGGTGTGCACAGGGTGGGCAGGG + Intronic
986168585 5:5296934-5296956 GAAGGGGCACAGAAGCGGCAAGG + Intronic
986722088 5:10566535-10566557 GAATGGGCACAGGAGGGGCCTGG + Intronic
989415710 5:41172870-41172892 GAGTGTTCACGGAAGAAGCATGG - Intronic
993266471 5:85732338-85732360 CAGTGTAAACAAAAGGGGCAGGG + Intergenic
993478074 5:88389351-88389373 GAGTGTGCACAAGATGGGGAAGG - Intergenic
993575728 5:89598006-89598028 GTGTGTTCACAGAAGTGGTAAGG + Intergenic
993718092 5:91295240-91295262 CAGTGTGCCCAGAAAAGGCATGG + Intergenic
994639785 5:102393163-102393185 GAGAATGCACAGAAGGGATAAGG - Intronic
996150909 5:120033615-120033637 GAGTGTGAACAGAAAAGGCAAGG - Intergenic
997352118 5:133238635-133238657 GAGTGTGCACACATGGGGGAGGG + Intronic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
998562202 5:143182102-143182124 GTGTGGGGACAGAAGGGTCAGGG - Intronic
999329064 5:150660562-150660584 CACTGGGCAGAGAAGGGGCATGG - Intergenic
999386181 5:151156008-151156030 GAGTGTGCAGAGGAGGGGCCAGG - Intronic
999733944 5:154498674-154498696 GAAAGTCCTCAGAAGGGGCAGGG - Intergenic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001308803 5:170595597-170595619 GAATGTGGGAAGAAGGGGCAAGG + Intronic
1001568219 5:172714054-172714076 GAGTGGGCACAGAAGGTGCAAGG - Intergenic
1001810257 5:174622190-174622212 GAGTCTGCACAGAAAAGGCAAGG + Intergenic
1002439934 5:179259024-179259046 GGGTGAGCACGGAAGAGGCAGGG - Intronic
1002453189 5:179331238-179331260 GGGAGAGGACAGAAGGGGCAGGG + Intronic
1003127539 6:3367539-3367561 GAGAGTGCATAGCAGGGGCCAGG + Intronic
1003411868 6:5872021-5872043 CAGTGTGCCCAGAAGAGGAATGG - Intergenic
1004010497 6:11681333-11681355 GAGTGAGCAGAGGAGGGGGATGG + Intergenic
1004295222 6:14403981-14404003 GAGTGAGCACAGAATGAGGAAGG - Intergenic
1005882619 6:30072459-30072481 GAGTGAGGAAAGAAGGGTCAAGG + Intronic
1006341231 6:33448251-33448273 GAGTGAGCAAAGAAGGGGCAGGG - Intronic
1009477801 6:64115517-64115539 GAGTATCCACAGTAGTGGCAAGG - Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012370022 6:98492922-98492944 GAGTGATCAAAGAAAGGGCAAGG - Intergenic
1014161776 6:118178121-118178143 GAATTTGAACAGAAGGGACATGG - Intronic
1015076497 6:129164939-129164961 GACTGTGCACAGAATAGGTAAGG - Intronic
1015123521 6:129727155-129727177 GTGTGTGCACAGCAGAGGAAAGG - Intergenic
1015940938 6:138451220-138451242 GAGTGTGCATGGAAGGTACAAGG - Intronic
1017427020 6:154332665-154332687 AAGTCTGCACAGATGGGACAGGG - Intronic
1018178553 6:161200100-161200122 GAATGTGCACAGAAAGAGGAAGG + Intronic
1018345346 6:162893320-162893342 CAGTGTGGACAGACAGGGCAGGG + Intronic
1018485313 6:164235694-164235716 GACTGTGGACAGATGGGGAAAGG - Intergenic
1018607328 6:165611518-165611540 GGCTGTGCCCAGAAGGGGCGGGG + Intronic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1019067564 6:169315118-169315140 GAGTGTGCAGAGATGGGGATTGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1020603942 7:10311242-10311264 AAGTATGAACAGACGGGGCAAGG + Intergenic
1021636817 7:22702098-22702120 CATTGTGCCCAGAAGGGGAATGG - Intergenic
1022287922 7:28973333-28973355 GAGGGAGCACAGAAGGGACAAGG - Intergenic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1024161660 7:46682317-46682339 GACTCTGCCCAGCAGGGGCATGG - Intronic
1027450984 7:78331210-78331232 GAGTGGGGACAGTCGGGGCAAGG + Intronic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1030087874 7:105832573-105832595 GTTGGTGCACAGAAGGTGCAGGG - Intronic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1034009622 7:147515035-147515057 GAGTGAGCAAACAAGGGGAAGGG - Intronic
1034235099 7:149560578-149560600 GAGTGTGCAGAGCAGGGGGTGGG + Intergenic
1034323269 7:150204889-150204911 GAGAGTGCAGAGGAGGAGCAAGG + Intergenic
1035479835 7:159172681-159172703 GAGTGTTCACAGGAGGGACCTGG - Intergenic
1036776797 8:11618300-11618322 GACTGGGCAGAGAAGGGGCTGGG - Intergenic
1037643461 8:20769611-20769633 GAGTGAGCATAGAAGGGGAAGGG + Intergenic
1041231799 8:55759908-55759930 CAGTGTGGAAGGAAGGGGCAGGG - Intronic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1042189231 8:66168571-66168593 GAATGTGGACAGGAGGGGTACGG - Intronic
1047974539 8:130116257-130116279 GAATGTGCACAGGAAGGGGAGGG + Intronic
1048573348 8:135672539-135672561 GAGGGTGCTCAGAAGGAGCGGGG - Intergenic
1048777834 8:137967214-137967236 GAATGTGCAAAGATGAGGCAAGG - Intergenic
1049366340 8:142238665-142238687 GAGTGTGCAGGGGAGGGGCTGGG - Intronic
1049529498 8:143147306-143147328 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049529514 8:143147381-143147403 GAGTTTGGAGAGAAGGGGGATGG + Intergenic
1049661427 8:143821273-143821295 GGCTGTGCACAGCTGGGGCAGGG + Intronic
1052030467 9:23622379-23622401 CAGTGTGCACTGAAATGGCAGGG + Intergenic
1053311550 9:37023980-37024002 GAGGGTTCACAGAAGGGGAGAGG - Intronic
1056884169 9:90424107-90424129 GAGTGTGCAGTGAAGGGGGAAGG - Intergenic
1057008186 9:91578949-91578971 CAGTCTGCTCAGAAGGGGCCAGG + Intronic
1057779373 9:98037080-98037102 AAGTGGGCAAAGAAGGGGCCGGG + Intergenic
1058409060 9:104710415-104710437 GAGTTGGCACAGCAGGGTCAGGG + Intergenic
1060775798 9:126373325-126373347 GCGTGGGCACAGCAGAGGCAAGG - Intronic
1060946239 9:127570735-127570757 GAGTGGGGACAGCATGGGCAGGG + Intronic
1061200654 9:129136657-129136679 GAGGGAGCGCAGGAGGGGCAGGG - Intronic
1061231263 9:129317180-129317202 AAGTGTGCAGAGAAGGAACAAGG - Intergenic
1062126951 9:134869117-134869139 GAGTGGGCAGAGCAGGGGCCAGG - Intergenic
1062481465 9:136754431-136754453 CAGGGTGCCCAGGAGGGGCAGGG + Exonic
1185645262 X:1611060-1611082 GGGTGTGGACAGAAGGGGAGGGG - Intergenic
1187246789 X:17560088-17560110 GAGTGTGCACTCTAGGGGTAAGG - Intronic
1188746370 X:33849765-33849787 GTATGTGCACAGAATGGGTATGG - Intergenic
1192245635 X:69369472-69369494 GACTGTGCACACAGGTGGCATGG + Intergenic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1194738031 X:97537637-97537659 GAGTGAGCACAGAAGATGGAAGG - Intronic
1195888134 X:109662911-109662933 GAGTGTAGAGAGAATGGGCAGGG - Intronic
1196376557 X:115039700-115039722 GAGTGACCACAGAAGCAGCATGG + Intergenic
1196735380 X:118976968-118976990 GAATGAGGACTGAAGGGGCAAGG + Intronic
1197976847 X:132174865-132174887 GAGTGGGCATAGAAGGGAGATGG + Intergenic
1198804584 X:140481274-140481296 GAGTGAGCGCAGAAGGGCAATGG - Intergenic
1198962497 X:142197018-142197040 GTGCGTGCACACATGGGGCAGGG - Intergenic
1199342847 X:146702367-146702389 GAGGGTGTACGGAGGGGGCAAGG - Intergenic
1200080510 X:153573871-153573893 GAGTGTGCACACAAGGTGGGAGG + Intronic
1201770718 Y:17614800-17614822 GAGTGGGCGGGGAAGGGGCAGGG - Intergenic
1201830837 Y:18291186-18291208 GAGTGGGCGGGGAAGGGGCAGGG + Intergenic