ID: 1106415720

View in Genome Browser
Species Human (GRCh38)
Location 13:29544148-29544170
Sequence CACGCTGTAAAGATCGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 25}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106415720_1106415722 -5 Left 1106415720 13:29544148-29544170 CCCAGTGCGATCTTTACAGCGTG 0: 1
1: 0
2: 1
3: 0
4: 25
Right 1106415722 13:29544166-29544188 GCGTGAATCTGTTGCTGAAATGG 0: 1
1: 0
2: 0
3: 2
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106415720 Original CRISPR CACGCTGTAAAGATCGCACT GGG (reversed) Intronic
918993253 1:191726134-191726156 CAAGCTGTAAAGATTCCTCTGGG + Intergenic
921525956 1:216218533-216218555 CACACTGTAAAAATGGCAGTGGG - Intronic
922229496 1:223673546-223673568 CACACTTTTAAGATAGCACTAGG + Intergenic
1072770770 10:98135227-98135249 CAAACTTTAAAGATCGGACTTGG - Intronic
1074862319 10:117519912-117519934 AAAGCTGTCAAGATCACACTTGG - Intergenic
1100443487 12:94639802-94639824 CAGGCTATAAAAATCTCACTCGG + Intronic
1105958065 13:25302142-25302164 CACGCAGTCAAGACCCCACTAGG - Intronic
1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG + Intergenic
1106415720 13:29544148-29544170 CACGCTGTAAAGATCGCACTGGG - Intronic
1131727920 15:95247384-95247406 CACGCTGGAAGGAACGAACTCGG - Intergenic
1137335949 16:47549342-47549364 CACGCTGAAAATATGGCAATGGG - Intronic
1142531785 17:584177-584199 CACAGTCTAAAGAACGCACTCGG - Intronic
1148140103 17:45322163-45322185 CAGGCTGTAAGGAGCCCACTTGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
942680896 2:178477719-178477741 TACCCTGTAAAGATAGGACTGGG - Intronic
943210922 2:184964605-184964627 CACGCTGTAAAGATACTACCAGG - Intergenic
1173537585 20:43827967-43827989 GACTCTGTGAAGATCGCACCTGG + Intergenic
956340103 3:68212822-68212844 CACCAAGTAAAGATCGCACATGG - Intronic
969869914 4:10098164-10098186 GAAGCTGTAAAGATAGCCCTGGG - Intronic
970421899 4:15912768-15912790 CAAGCTGTAAAAATCCCACAAGG - Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
972088823 4:35254784-35254806 CACGCTTTAAAAAAAGCACTTGG + Intergenic
972995423 4:44873037-44873059 CAACCAGTAAAGATCTCACTGGG - Intergenic
1004008622 6:11659568-11659590 CATGGTGGAAAGATCACACTAGG + Intergenic
1007208933 6:40175926-40175948 CAAGCTGTAAAGATTTCTCTGGG - Intergenic
1029799954 7:102936049-102936071 CCAGCTGTAAAGATGGCACCTGG + Intronic
1056418105 9:86397144-86397166 CATGATGCAAAGATCACACTCGG + Intergenic