ID: 1106419844

View in Genome Browser
Species Human (GRCh38)
Location 13:29577151-29577173
Sequence CTCAATGGTCGGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106419837_1106419844 3 Left 1106419837 13:29577125-29577147 CCTGAATCGGCAAAAGGTACAGT 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1106419844 13:29577151-29577173 CTCAATGGTCGGATGGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106419844 Original CRISPR CTCAATGGTCGGATGGGGCA GGG Intronic
900188881 1:1345099-1345121 CTGGATGGTGGGAGGGGGCAGGG - Intronic
901114227 1:6828583-6828605 ATAAATGGTAGGATGGGGCCGGG - Intronic
904657982 1:32063466-32063488 CTCAATGGTAGGGTAGGGAATGG - Intergenic
906212961 1:44022323-44022345 CTCCATGGTAGGAAGGGGCAGGG + Intronic
908639783 1:66209690-66209712 ATCAATGGTAGCCTGGGGCAAGG - Intronic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915455029 1:156034731-156034753 CCCAATGGTCTGATGGGGAATGG + Intergenic
916632844 1:166635487-166635509 ATCAATTGTCTAATGGGGCAAGG - Intergenic
916851635 1:168710425-168710447 CTGGATGGTAGGATGGGGTAAGG + Intronic
920166236 1:204038050-204038072 CTCAATGCTAGGGTGGGGGATGG + Intergenic
922816281 1:228452138-228452160 CTCAGTGTTCGGTTGGGGCTGGG + Intergenic
1063410429 10:5832955-5832977 GACACTGGTGGGATGGGGCAGGG - Intronic
1063856939 10:10265439-10265461 CTCATGTGTTGGATGGGGCAGGG - Intergenic
1078448887 11:11425646-11425668 CTGAATTGTGGGATGGGGCGAGG + Intronic
1085878613 11:80438950-80438972 CTAAATGGAAGGCTGGGGCAGGG + Intergenic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1089360827 11:117885390-117885412 CACAAGGGATGGATGGGGCAAGG - Intergenic
1090550435 11:127813780-127813802 CTCACTGCTCCCATGGGGCAGGG - Intergenic
1092243850 12:6852102-6852124 CTCATTGGACGGGAGGGGCAGGG + Intergenic
1104979840 12:132568925-132568947 CCCCATGGTCACATGGGGCAGGG + Intronic
1105355732 13:19657816-19657838 CTCAGTGGTGGGATGGGTCATGG + Intronic
1106419844 13:29577151-29577173 CTCAATGGTCGGATGGGGCAGGG + Intronic
1113873468 13:113579364-113579386 TTCAACGGTGGGAGGGGGCAGGG - Intergenic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1123030321 14:105448434-105448456 GTCAGTGCTCGGATGGGGCCTGG + Intronic
1123813424 15:23952709-23952731 CTTAATGGTAGGGTTGGGCAGGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124813877 15:32968880-32968902 CTCCAGGGTTGGGTGGGGCAGGG + Exonic
1129694843 15:77734746-77734768 CTCCCTGGTCTGATGGGTCAGGG - Intronic
1137951322 16:52786310-52786332 CCTAATGGTTGGATGGGGCCAGG - Intergenic
1140342854 16:74182608-74182630 TTCATTGGTGGGATGGGGGAGGG - Intergenic
1142263820 16:89054526-89054548 CTCGAGGGCGGGATGGGGCAGGG - Intergenic
1145067805 17:19773928-19773950 CTCAATGGAAGGAGGGGACAGGG + Exonic
1150455689 17:65304941-65304963 CTCAAGTGTGGGATGGGGGAAGG + Intergenic
1153280473 18:3409976-3409998 ACAAATGGTCGGATGGGACAGGG + Intergenic
1155960958 18:31994336-31994358 CTCAATGGTCTGGAGGGGAAAGG - Intergenic
1162062796 19:8107078-8107100 ATGAATGGGTGGATGGGGCATGG + Intronic
1162829968 19:13278269-13278291 CTGAATGGTCAGATCGTGCAGGG - Intronic
1165941348 19:39416249-39416271 CCCAATGGTCTGCTGGGGCTGGG - Intronic
927067706 2:19490389-19490411 CTCAATGGAGGGAGGGGGCAAGG - Intergenic
929870980 2:45759130-45759152 CTCAATGGAGGGCAGGGGCAGGG - Intronic
935039841 2:99415580-99415602 CTCAGTGGTCACATGGAGCAAGG - Intronic
936011934 2:108930481-108930503 CTTGATGGTGGGATGGGGCTTGG - Intronic
938550855 2:132381123-132381145 CAGGATGGTGGGATGGGGCATGG - Intergenic
938682761 2:133708924-133708946 CTCAAAGGTCAGTTGGGACAAGG + Intergenic
940484984 2:154287115-154287137 CTCAAAGGTCAGATGTGTCAAGG - Intronic
942498997 2:176568558-176568580 CTCATTGGGCCGATGGTGCATGG + Intergenic
1170608269 20:17890251-17890273 CCCCCTGGTGGGATGGGGCAAGG - Intergenic
1173752047 20:45484856-45484878 CTCAGTGGTGGGGTGGGGGATGG + Intergenic
1175167235 20:57053574-57053596 CTCAATGGTGGTAAAGGGCAGGG + Intergenic
1179051445 21:37891899-37891921 CTCAAGTGTGGGATGGGGAAGGG + Intronic
1181983561 22:26783341-26783363 CACATTGGTGGGAGGGGGCATGG + Intergenic
1183565460 22:38611185-38611207 CTCTATGCTGGGATGGGACAGGG - Intronic
1183716267 22:39535283-39535305 CTCATTGGTTGGATGGGGCTTGG + Intergenic
950043859 3:9937543-9937565 CTCACTGATCGGACAGGGCAGGG - Exonic
951464173 3:22984233-22984255 ATCAGTGGTTGGCTGGGGCATGG + Intergenic
953679033 3:45025938-45025960 CTCAATGGTAAAATGGGGAAAGG + Intronic
954711262 3:52506159-52506181 CTCAACGGTCAGCTGGGGCAAGG - Exonic
955347181 3:58169811-58169833 TTCAAGGGTGGGGTGGGGCAGGG + Intronic
961657307 3:128450267-128450289 TTCAATGGTCGGTTGGAGCATGG - Intergenic
962570712 3:136710619-136710641 CTCGATGGTTGGAGGGGGGAGGG - Intronic
962928054 3:140013063-140013085 CTCAATGGATGGATGAGCCAAGG + Intronic
963524954 3:146405716-146405738 CTTAATGGTAGGATGGGGAGGGG + Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
970570413 4:17375917-17375939 CTCAATGGTCACATGTGGCTAGG - Intergenic
997475875 5:134142238-134142260 CACAATGGCCGGGTGGGGGATGG - Exonic
998524160 5:142827228-142827250 CTCCATGGTTGGTTGTGGCATGG + Intronic
999920197 5:156309774-156309796 CTCAAAGATCGGGTGGGGCGTGG - Intronic
1000652491 5:163833986-163834008 CACAATTGTCGTATGGGGAAAGG + Intergenic
1004410898 6:15380575-15380597 CTCACTGGACGGATGGTGCATGG + Intronic
1007631519 6:43275727-43275749 CTCAGTGGTGGGGTGGGGCAGGG - Intronic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1009957867 6:70477703-70477725 CTCAATGTTGGAATGGGGCCTGG - Intronic
1010717496 6:79246326-79246348 CTCAAGGGTGGGATGGGAGATGG - Intergenic
1012412005 6:98969357-98969379 CTCAATGGCAGAAAGGGGCAAGG + Intergenic
1013381194 6:109572904-109572926 CTCATTTGGTGGATGGGGCAAGG - Intronic
1018719066 6:166558561-166558583 CTCAAGGCTGGGCTGGGGCAGGG + Intronic
1019994056 7:4711907-4711929 CTCAAGGTTGAGATGGGGCAGGG + Intronic
1026255648 7:68708970-68708992 CTCAGGAATCGGATGGGGCAGGG + Intergenic
1027559885 7:79716448-79716470 ATCAACAGTGGGATGGGGCAGGG - Intergenic
1029666146 7:101996477-101996499 CTCCATGGTCACATGGGGCTTGG - Intronic
1032222968 7:130008175-130008197 CTCAAGGGCCAGAAGGGGCAGGG + Intergenic
1032447986 7:132001102-132001124 CAGAATGGCTGGATGGGGCAAGG + Intergenic
1033665127 7:143433539-143433561 CTAAATGCTCGAATGGAGCAAGG + Intergenic
1034827824 7:154282547-154282569 CTCAATGGTGGGAAGGGGATGGG + Intronic
1037284503 8:17284108-17284130 CTCAATGGTGGGATTATGCAAGG + Intronic
1038370267 8:26981929-26981951 CGCACTGGGAGGATGGGGCAGGG + Intergenic
1041395239 8:57383566-57383588 CTTAATGGGCGGCTGGGGAAGGG + Intergenic
1045149467 8:99387636-99387658 TTCCATGGTGGGGTGGGGCAGGG - Intronic
1048210545 8:132450830-132450852 TTCAATGGACGACTGGGGCAAGG + Intronic
1051351909 9:16205155-16205177 CTCAAAGGCCAGATGGGGCCTGG + Intronic
1055431988 9:76253198-76253220 CTCCATGGGCAGATGGGGAAGGG + Intronic
1186022405 X:5271065-5271087 GTCAATGGAAGGATGGAGCATGG + Intergenic
1195501808 X:105610479-105610501 CTCAGTGGTTGCCTGGGGCAAGG - Intronic