ID: 1106421488

View in Genome Browser
Species Human (GRCh38)
Location 13:29589545-29589567
Sequence CAGGTGCCTGGACTTGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 451}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106421475_1106421488 5 Left 1106421475 13:29589517-29589539 CCCAAGGACCCCAGGGCTCCAGC 0: 1
1: 0
2: 5
3: 49
4: 323
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421480_1106421488 -5 Left 1106421480 13:29589527-29589549 CCAGGGCTCCAGCTGTGCCAGGT 0: 1
1: 0
2: 3
3: 41
4: 334
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421471_1106421488 18 Left 1106421471 13:29589504-29589526 CCAGCGCAGCTGCCCCAAGGACC 0: 1
1: 0
2: 0
3: 17
4: 199
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421474_1106421488 6 Left 1106421474 13:29589516-29589538 CCCCAAGGACCCCAGGGCTCCAG 0: 1
1: 0
2: 5
3: 56
4: 403
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421468_1106421488 25 Left 1106421468 13:29589497-29589519 CCACGTCCCAGCGCAGCTGCCCC 0: 1
1: 0
2: 2
3: 35
4: 405
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421478_1106421488 -4 Left 1106421478 13:29589526-29589548 CCCAGGGCTCCAGCTGTGCCAGG 0: 1
1: 0
2: 7
3: 53
4: 513
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421477_1106421488 -3 Left 1106421477 13:29589525-29589547 CCCCAGGGCTCCAGCTGTGCCAG 0: 1
1: 0
2: 9
3: 48
4: 394
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421470_1106421488 19 Left 1106421470 13:29589503-29589525 CCCAGCGCAGCTGCCCCAAGGAC 0: 1
1: 0
2: 0
3: 14
4: 194
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451
1106421476_1106421488 4 Left 1106421476 13:29589518-29589540 CCAAGGACCCCAGGGCTCCAGCT 0: 1
1: 0
2: 10
3: 66
4: 590
Right 1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG 0: 1
1: 0
2: 4
3: 55
4: 451

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106421488 Original CRISPR CAGGTGCCTGGACTTGGGAG GGG Intronic
900366108 1:2312607-2312629 CAGGTGCTGGGACGTGGGGGTGG - Intergenic
900536374 1:3179682-3179704 CAGGTGCCCGGCCTTGAGAGCGG - Intronic
900957101 1:5892788-5892810 CAGCTTCCTGGACTTCTGAGTGG - Intronic
901322554 1:8348607-8348629 CAGGTGTCTGGAACTGGGGGTGG + Intergenic
901662054 1:10804651-10804673 CAGGTCCCTGGATGTGGGTGGGG + Intergenic
901883709 1:12208530-12208552 CAGGGCCCTGGCCCTGGGAGGGG - Exonic
902082234 1:13829039-13829061 CTGGAGCCTGGACTTGAGGGAGG - Intergenic
902218120 1:14947392-14947414 CAGGAGCCTGGCCTTGGGGAGGG + Intronic
902624346 1:17667888-17667910 CAGCTGCCCGGAGTTGGAAGTGG - Intronic
902829690 1:19004044-19004066 AAGGGGCTTGGACTTGGCAGTGG - Intergenic
902930951 1:19731131-19731153 CAAGGGCAAGGACTTGGGAGGGG + Intronic
903277034 1:22228910-22228932 CAGGTGACAGGACTTGGGTGCGG - Intergenic
903805408 1:26001939-26001961 AAGCAGCTTGGACTTGGGAGGGG + Intergenic
904576152 1:31506343-31506365 GAGCTGCCTGGACATTGGAGGGG + Intergenic
904947477 1:34210180-34210202 GAAGTGCCTGGACCTGGGAGGGG - Intronic
905187008 1:36203965-36203987 CAGCTGCCTCGGCCTGGGAGCGG - Intergenic
906023816 1:42655992-42656014 CACATGCCTGTACTTGGGAGAGG - Intergenic
906102910 1:43274427-43274449 TAGGTTCCTGGGCATGGGAGAGG + Intergenic
906250315 1:44306157-44306179 CAGGTGGCAGGGCTTGGGGGAGG - Intronic
906642795 1:47451398-47451420 CAGGTCCTTGGATTTGGAAGAGG + Intergenic
906685213 1:47758778-47758800 CAGGCTCCTGGACATGGAAGAGG + Intergenic
907261708 1:53223024-53223046 GAGCTGCCTGGAGTTGGGAGAGG - Intergenic
907806122 1:57822045-57822067 CAGGTGGCTGAACTGGGAAGTGG + Intronic
910643642 1:89490327-89490349 TAGCTGCCTGGAACTGGGAGAGG - Intergenic
911293751 1:96088302-96088324 CAGGTGATTGCACGTGGGAGGGG - Intergenic
912141747 1:106738328-106738350 TGGTTGCCTGGAATTGGGAGAGG + Intergenic
912385380 1:109268771-109268793 CTGGTGCCTGGGTTGGGGAGGGG + Intronic
912787525 1:112619127-112619149 CAGGCGCCAGGAGCTGGGAGGGG + Exonic
912913685 1:113789577-113789599 CAGAGGCCTGGACTTGTGACTGG + Intronic
913450066 1:118987270-118987292 CCGGTCCCTGGGATTGGGAGGGG - Intronic
914443399 1:147726823-147726845 GAGGTGGCTGGACTTGAGTGGGG + Intergenic
915002893 1:152609683-152609705 CAGGAGACTGGAGTTGGAAGGGG + Intergenic
915020585 1:152775302-152775324 CAGGGGCCTGGAATTGTGATTGG + Intronic
915264598 1:154707761-154707783 TAGGTGCCTCTACTTGGGAGCGG - Exonic
915299297 1:154942812-154942834 CAGGTGGCTGGGCCTGGGAAAGG - Intergenic
915327561 1:155088508-155088530 CAAGTGCCTGGCCCAGGGAGGGG + Intergenic
915896174 1:159812962-159812984 GAGGTGACTGGAGCTGGGAGAGG - Intronic
915939999 1:160113104-160113126 AAGATGCCTGGGCTGGGGAGTGG - Intergenic
916554610 1:165883465-165883487 CAGGCACCTGGACTGGGGGGTGG - Intronic
916728910 1:167549202-167549224 GAGGAGCCTGGGGTTGGGAGTGG + Intronic
916913822 1:169384316-169384338 CAGGTGTTTGAACTTGGGAGGGG - Intronic
917479229 1:175396648-175396670 CGGGTGCCTGGAGATTGGAGTGG - Exonic
917804415 1:178600334-178600356 CAGGAGACTGGACGTGGGTGAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
918245734 1:182657512-182657534 CAGTTGCCTGGGCTTGGGGAGGG - Intronic
918747803 1:188228406-188228428 GAGCTGCCTGGAGTTGCGAGTGG + Intergenic
920269494 1:204752376-204752398 CAGGTGCCGGGAGTGGAGAGGGG - Intergenic
920311826 1:205053035-205053057 GATGTGCCTGGAGCTGGGAGGGG + Intronic
920567700 1:206988529-206988551 CAGGTTCCAGGAATTGGGATGGG - Intergenic
921149129 1:212385876-212385898 GAGGTGCCTGGGCTGGGAAGAGG - Intronic
922041768 1:221904154-221904176 CAGGTGCTGGGAGCTGGGAGAGG + Intergenic
922917692 1:229271500-229271522 GAGGTGTCTGGGCTTGGGACCGG + Intronic
923055586 1:230424516-230424538 CTGGTGCCTGGACTTGGATCTGG - Intronic
923153064 1:231252188-231252210 TAGTTGCCTAGACTAGGGAGTGG + Intronic
1062959536 10:1562169-1562191 AAGCTGACTGGGCTTGGGAGGGG - Intronic
1063200594 10:3782860-3782882 CAAGGGCCTGCACTTGGGAACGG - Intronic
1064291771 10:14040971-14040993 CAAGTGCCAGGATTTTGGAGTGG + Intronic
1065289534 10:24215815-24215837 CAGGTGCCTCGAGGTAGGAGGGG + Intronic
1066428381 10:35330154-35330176 AAGGTGACTGGCATTGGGAGGGG - Intronic
1069831822 10:71286496-71286518 CAGCTGGGTGGTCTTGGGAGGGG - Intronic
1070653238 10:78253092-78253114 CAGCTGCAGGGACCTGGGAGCGG + Intergenic
1071567792 10:86680634-86680656 CAGGGGAATGCACTTGGGAGGGG - Intronic
1073769479 10:106719854-106719876 CAGGTGGCTGGAATAGAGAGAGG - Intronic
1074087031 10:110215925-110215947 CAGGTGTCTGTCCTTGGGACAGG - Intronic
1075694238 10:124421593-124421615 CAGGTGCCTGACCTTGCGAGGGG + Intergenic
1075930257 10:126289264-126289286 GAGATGCCTGGAAGTGGGAGAGG - Intronic
1076812232 10:132893216-132893238 TGGCTGCCTGCACTTGGGAGGGG - Intronic
1077138397 11:1012870-1012892 CAGCAGCCTGTCCTTGGGAGAGG - Exonic
1077352062 11:2097619-2097641 CAGGCGCCCGGACCTGGGTGGGG - Intergenic
1077416733 11:2427444-2427466 CAGGTGCCAGGAGTTGTGGGCGG - Intergenic
1077436425 11:2541523-2541545 CAGGTCCCTGGACCTGGCGGTGG + Intronic
1077522288 11:3043477-3043499 CTGGTGCCTGGCCCTGGGAAGGG + Intronic
1077543195 11:3157324-3157346 AAGGAGCCTGGACTTACGAGAGG + Intronic
1077601470 11:3577794-3577816 GAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1077677349 11:4206865-4206887 CAGGTGCCTGTGCTTTGGTGAGG - Intergenic
1078604935 11:12766926-12766948 CAGCTGCCTGGAGGTGGGGGTGG - Intronic
1080356061 11:31447267-31447289 CAGACCACTGGACTTGGGAGGGG - Intronic
1080886062 11:36369410-36369432 CAGGTGACTGGTCCTGGGACTGG - Intronic
1081044189 11:38251016-38251038 CAGGTGCCTGGAGCAGGGAGAGG + Intergenic
1081173265 11:39893935-39893957 GAGATGCCTAGACTTGGGAGGGG - Intergenic
1082780752 11:57285812-57285834 GAAGTGGCTGGACTTGGGAAGGG - Intergenic
1083614901 11:64021491-64021513 CAGGTTCCTGGGCCAGGGAGAGG + Intronic
1083802533 11:65054625-65054647 CAGGTACCAGGAGTTGGGAAAGG + Exonic
1083915988 11:65744143-65744165 CGGGTGCCAGGAGTGGGGAGAGG - Intergenic
1083924516 11:65797896-65797918 CAGGTGCCTGGACAGAGGTGCGG - Intergenic
1084272818 11:68038285-68038307 CAGCTGCCTGCACTTTGGACAGG - Intergenic
1087048575 11:93864880-93864902 CAGGTACCTGGCCTTGGGCTTGG + Intergenic
1087134816 11:94706002-94706024 CAGGTGACTGGACTTTGCAAAGG - Intergenic
1087407945 11:97752769-97752791 CAGGTGCCAGGAGCAGGGAGAGG + Intergenic
1087433229 11:98080104-98080126 CATGTGCTTGGCTTTGGGAGAGG - Intergenic
1088651041 11:111958390-111958412 CAGGTGCAGGGAGTCGGGAGAGG - Intronic
1088821089 11:113457961-113457983 CAGCAGCCTGGGCTGGGGAGGGG + Intronic
1089622872 11:119731824-119731846 GAGGTGCGTGGAGGTGGGAGAGG + Intergenic
1089965900 11:122655136-122655158 GAGGTGGCAGGACCTGGGAGGGG - Intergenic
1090086601 11:123655284-123655306 CAGCTGCTAGGACTAGGGAGTGG - Intergenic
1090784475 11:130037180-130037202 CAGTTGCCTGGACTTGTTAGCGG + Intergenic
1091116283 11:133016631-133016653 CAGGTACCTGGAGTTAGGACGGG + Intronic
1091433401 12:454901-454923 CATGTGCCATGACTTGGGAGTGG + Intergenic
1092242489 12:6843715-6843737 CTGGTGCTGGGGCTTGGGAGTGG + Intronic
1092450795 12:8600281-8600303 CAGAGGCCTGGACTTGTGACTGG - Intergenic
1092458793 12:8668726-8668748 CACGTGCATGAACTTGGAAGTGG + Intergenic
1095939279 12:47715650-47715672 CAGCTGCCTGGAGTTGGGAAAGG + Intronic
1096106093 12:48997775-48997797 GTGGTGCCTGGATCTGGGAGCGG + Exonic
1096843567 12:54393060-54393082 CAGGGGATTGGCCTTGGGAGAGG + Intergenic
1096875872 12:54630045-54630067 CCTGTGCCTGGCCTGGGGAGGGG + Intergenic
1097076318 12:56397350-56397372 CAGGTGCCTGGACTGGAGGTAGG + Intergenic
1098290928 12:68956230-68956252 CAGGTGCCAGGAGCAGGGAGAGG + Intronic
1098539713 12:71640572-71640594 CAGTTGCATGGCCTTGGGGGTGG - Intronic
1098550265 12:71754779-71754801 AACGTGCCTGGACGTGGGCGGGG - Intergenic
1098975376 12:76896521-76896543 GAGCTGCCTGGAGTTGGGAGAGG - Intergenic
1100062676 12:90600570-90600592 CAGTTGCCTGGCCCTGGGAAAGG + Intergenic
1100730911 12:97467795-97467817 CATTTGCCTGAATTTGGGAGAGG + Intergenic
1101779773 12:107824797-107824819 AGAGTGCCTGGACTTGAGAGTGG - Intergenic
1101999752 12:109549973-109549995 AAGGTGCTTTGACTGGGGAGTGG - Intergenic
1102222045 12:111201302-111201324 CAGCTGCCTGGAGGTGGGGGTGG + Intronic
1103912353 12:124359539-124359561 CAGGTGCCTCCACTGGGGACTGG - Intronic
1104091192 12:125519123-125519145 CCCGTGCCTGGGCTGGGGAGGGG + Intronic
1104232748 12:126900893-126900915 CAGGTGCCTGGAACTGGGGAGGG + Intergenic
1104475518 12:129067615-129067637 CAGGTGCCAGGGCTGGGGCGAGG + Intergenic
1104880980 12:132069903-132069925 GAGGAGCCTGGAACTGGGAGAGG - Intronic
1105006176 12:132722040-132722062 CAGGTGACTGGATGGGGGAGGGG + Exonic
1106155546 13:27152120-27152142 CATGTGTCTGTACTTTGGAGTGG - Intronic
1106421488 13:29589545-29589567 CAGGTGCCTGGACTTGGGAGGGG + Intronic
1106660195 13:31791424-31791446 CAGGGGCTTGGGCTTGGGATGGG - Intronic
1107582250 13:41802934-41802956 CAGCTGTCTGGAGTTGGGAGAGG - Intronic
1107814564 13:44232756-44232778 CAGAAGCCAGGAGTTGGGAGTGG - Intergenic
1108595303 13:51944089-51944111 GAGGTACGTGGACTTGGGCGTGG - Exonic
1109345803 13:61113509-61113531 CGGGTGCCAGGAGCTGGGAGAGG - Intergenic
1109622278 13:64925688-64925710 CAGGTGCCGGGAATGGGTAGAGG + Intergenic
1109982223 13:69923958-69923980 CAGGTGCCGGGAGTAGGAAGAGG - Intronic
1113244127 13:108376334-108376356 GAGCTGCCTGGAGCTGGGAGAGG + Intergenic
1113486083 13:110653167-110653189 CAGGGGCCTGGGGTGGGGAGGGG + Intronic
1113704167 13:112415194-112415216 GAGCTGCCTGGAGTTGGAAGAGG + Intronic
1113901176 13:113799035-113799057 CAGGTGCTTGGCCTTTTGAGGGG - Intronic
1114614803 14:24062698-24062720 CAGGTGCCGGGCCTGGGGAAGGG - Exonic
1114624977 14:24123113-24123135 CTGGGGCTTGGACTTGGGTGGGG + Intronic
1115374644 14:32660931-32660953 CAAATGGCTGGAATTGGGAGGGG - Intronic
1115398955 14:32938029-32938051 CGGGTCCCGGGACTTGGGACCGG - Intronic
1116515231 14:45796517-45796539 GGGGTGCCTGGCCTTGTGAGAGG - Intergenic
1116661638 14:47717460-47717482 CAGGTGCCGGGAGCAGGGAGAGG + Intergenic
1117842906 14:59880067-59880089 GAGATGCCTGGAGCTGGGAGAGG + Intergenic
1119296309 14:73536262-73536284 CAGGTACAAGGGCTTGGGAGGGG + Intronic
1120426355 14:84352574-84352596 GAGCTGCCTGGAGTTGTGAGTGG + Intergenic
1121053255 14:90833079-90833101 CAGAGGCCTGGACTTGTGACTGG + Intergenic
1121722305 14:96118062-96118084 CATGCGCCAGCACTTGGGAGGGG + Intergenic
1122023827 14:98860055-98860077 CAGGTGCCTGGGCTAGGGAGTGG + Intergenic
1122716456 14:103699433-103699455 CAGATGCCTGGCCCTGGGGGCGG + Exonic
1122931795 14:104936509-104936531 CAGGAGCCTGGGCAGGGGAGAGG - Exonic
1123000753 14:105292886-105292908 AAGGGGCCTGGGCTTGGGAAGGG - Intronic
1124632920 15:31347471-31347493 CAGGGGGCTGGGCTGGGGAGGGG + Intronic
1125222063 15:37349857-37349879 AAGGTGCCTGGGGTTGGGAGTGG - Intergenic
1125746050 15:41997923-41997945 CAGGAGCCTGGACTTGTTTGGGG - Intronic
1126110984 15:45174600-45174622 CAAGAGCCTGGAGTAGGGAGAGG - Intronic
1126174703 15:45724712-45724734 CATGTGACTGAACTTGGAAGTGG + Intergenic
1126895756 15:53255646-53255668 GAGATGCCTGGTGTTGGGAGAGG + Intergenic
1127371071 15:58342168-58342190 GAGGTTCCGGGAGTTGGGAGGGG + Intronic
1128148215 15:65344509-65344531 CAGGGGCCTGGATGGGGGAGAGG + Intronic
1128309482 15:66621580-66621602 GAGATGCCTGGTCTTGGCAGTGG + Intronic
1128936764 15:71753217-71753239 CAGCTGCTTGTACTTGAGAGTGG + Intronic
1129019629 15:72504550-72504572 GAGGTCCCTGGACTTCAGAGGGG - Intronic
1129105874 15:73306916-73306938 AAGGTGGCTGCAATTGGGAGAGG - Intergenic
1129262714 15:74377609-74377631 CAGGTCTCTGGACTGGGGTGAGG + Intergenic
1130196781 15:81786954-81786976 CAGCTGTCTGGAATGGGGAGAGG - Intergenic
1131270774 15:90946525-90946547 CAGGTGCCTGGCCAGTGGAGGGG + Intronic
1131336386 15:91553353-91553375 CAGGTGCCTAGACTTCAAAGTGG + Intergenic
1131629063 15:94156951-94156973 CAGGTGTCTGGAGTTAGGGGAGG - Intergenic
1132956424 16:2596743-2596765 CAGGAGCCTGCGCTTGGAAGTGG - Intronic
1133370629 16:5243226-5243248 GAGGTGCCTGGTCTTGGGGAAGG - Intergenic
1134909619 16:18012916-18012938 CAGGTGAATGGGCTTGGAAGTGG + Intergenic
1135435044 16:22420985-22421007 CTGGTGGCTGGGCTTGGGAGGGG + Intronic
1135653250 16:24225536-24225558 CAGGGGCCTGGATTTGTGACTGG + Intergenic
1136229119 16:28876716-28876738 CTTCTGCCTGGACTTGGGTGAGG - Intergenic
1137760463 16:50936084-50936106 CATGAGAGTGGACTTGGGAGTGG - Intergenic
1138278793 16:55756856-55756878 CAGGGGGTAGGACTTGGGAGAGG - Intergenic
1138350886 16:56345659-56345681 CAGGTGCTGGGACGTGGCAGAGG + Exonic
1138519188 16:57561195-57561217 CAAGTGCCTGCAGTGGGGAGAGG - Intronic
1138530599 16:57632248-57632270 CAGGTGCGTGGATTTGGCAGTGG - Intronic
1139420588 16:66847236-66847258 CAGGTGCCAGGCTTTGGCAGGGG - Intronic
1139463699 16:67142605-67142627 CCGGTGCCTGCTCTGGGGAGGGG - Intronic
1139503487 16:67387301-67387323 CAGGTGCCTGGCCTGGGGCAGGG - Intergenic
1140103413 16:71938190-71938212 CAGGTGCTGGGAGTGGGGAGAGG - Intronic
1141161282 16:81630684-81630706 CAGGTGGCTGGGCCTGGAAGGGG - Intronic
1142044229 16:87914760-87914782 CTGGCGGCTGGGCTTGGGAGGGG + Intronic
1142150796 16:88511806-88511828 CAGGTGCCTGGATTGGTAAGGGG - Intronic
1142175020 16:88641083-88641105 CAGGTGCCTGGAGATGGGGGTGG + Intergenic
1142234840 16:88917206-88917228 CACATGCCTGGACTTAGGTGTGG + Intronic
1142500499 17:330216-330238 CAGGTGCCTGGACATGTGCATGG - Intronic
1142510096 17:387464-387486 CCGGTGCCTGGTCTAGGGTGGGG - Intergenic
1142510110 17:387518-387540 CCGGTGCCTGGTCTAGGGTGGGG - Intergenic
1142940760 17:3378401-3378423 CAGGTGCCAGGAGTAGGGAGAGG + Intergenic
1143159344 17:4858977-4858999 CGGGTGCCTGGTGTTGGGAGGGG - Intronic
1143409821 17:6702158-6702180 CAGGAGCCTGGACAGGGGTGGGG - Intronic
1143518138 17:7430155-7430177 TAGGAGCCTGGGCTGGGGAGTGG - Intergenic
1143622082 17:8086482-8086504 CAGGTGCCTGGAGAGGGGAGTGG - Intronic
1144829239 17:18122315-18122337 CAGGTGGCAGGACTGGGGATGGG - Exonic
1145200899 17:20943997-20944019 GAGCTGCCTGGAGTTGGGGGAGG + Intergenic
1146122686 17:30209288-30209310 CAGGTCTCTGTAGTTGGGAGGGG - Intronic
1146242624 17:31244269-31244291 GAGCTGCCTGGGTTTGGGAGAGG + Intronic
1146606011 17:34258294-34258316 CAGGTGCCTGAGATTGGGATGGG - Intergenic
1146642196 17:34549952-34549974 CAGGAGCCTAGACCTGGGTGTGG + Intergenic
1148107775 17:45128438-45128460 CAGGTGCCTGGCCTGGGTGGTGG - Intronic
1148384101 17:47222044-47222066 CAGGTACCAGGGTTTGGGAGAGG + Intronic
1148495104 17:48048692-48048714 GTGAGGCCTGGACTTGGGAGTGG + Intronic
1148629062 17:49092600-49092622 GAGGTGCCTGGGCTGGGGCGGGG + Intergenic
1148752803 17:49955295-49955317 CAAGTGCCTGGGGCTGGGAGGGG - Intergenic
1148836977 17:50470499-50470521 CAAGTGCCTGGCCTTGGGGCAGG - Intronic
1150030720 17:61732067-61732089 GAGTTGCTTGAACTTGGGAGGGG - Intronic
1150138928 17:62712460-62712482 CAGCTGCTTGGTCCTGGGAGAGG - Intronic
1151666150 17:75546179-75546201 GTGGTGCCAGGCCTTGGGAGGGG + Intronic
1151678110 17:75610257-75610279 CAGGTGCAGGGGCTTGGGTGGGG + Intergenic
1152643700 17:81459411-81459433 CTGGTCCCTGGGCCTGGGAGTGG - Intronic
1152790056 17:82273850-82273872 CAGGAGCCTGCACGTGGAAGGGG - Intergenic
1153276685 18:3374414-3374436 GAGGAGCCCTGACTTGGGAGTGG - Intergenic
1153456026 18:5282807-5282829 CAGAGGCCTGGACTTGTAAGTGG + Intergenic
1153765098 18:8367319-8367341 CAGGTGCCTGTGCTCGGGAGGGG + Intronic
1153880554 18:9418386-9418408 CGGTGGCCTGGACATGGGAGTGG - Intergenic
1155215679 18:23641376-23641398 CAGGTGCCGGGAGTGGGGAGAGG - Intronic
1155537661 18:26833560-26833582 CAGAGGCCTGCACTTGGGCGCGG + Intergenic
1156160270 18:34350832-34350854 CAGGTTCCAGGAGCTGGGAGAGG - Intergenic
1157052993 18:44191247-44191269 CTGGTGCCTGAAATTGGGAAGGG - Intergenic
1157247102 18:46064376-46064398 GAATCGCCTGGACTTGGGAGGGG - Intronic
1157606190 18:48927351-48927373 GAGATGGCTGGACTTGGGGGTGG + Intronic
1157745738 18:50133757-50133779 CAGGCTCCTGGAGGTGGGAGGGG - Intronic
1158296974 18:56008943-56008965 TAGGTGTCCGTACTTGGGAGGGG + Intergenic
1158756541 18:60332189-60332211 CCAGTGCCTGGACGTGGCAGGGG - Intergenic
1159446429 18:68545998-68546020 GAGTTGCCTGGAGCTGGGAGAGG - Intergenic
1160083652 18:75754131-75754153 CAGGTGCCAGGAGTGGGAAGAGG + Intergenic
1160190512 18:76710926-76710948 CAGATGCCTGCTCTTGGCAGGGG + Intergenic
1161028594 19:2047851-2047873 CAGGTGTCTGGGCTTGGGTAGGG - Intronic
1161253959 19:3295891-3295913 TGGCTGCCTGGCCTTGGGAGGGG - Intronic
1161300120 19:3538449-3538471 TGGGTGCCGGGACTGGGGAGGGG - Intronic
1161400177 19:4063834-4063856 CAGGTGCCGGTACTAGGCAGGGG - Intronic
1161610857 19:5241773-5241795 CAGGTGGCAGGACTTGGAAGAGG - Intronic
1162397112 19:10423700-10423722 CAGGGACCTGGACTAAGGAGGGG + Intronic
1162771816 19:12953728-12953750 CGGGTGCCTGGAAGGGGGAGAGG + Exonic
1163186097 19:15640782-15640804 CAGCTGCCCAGACATGGGAGCGG + Intronic
1163489563 19:17609342-17609364 GAGGTTCTTGGAGTTGGGAGTGG - Intronic
1163503171 19:17688051-17688073 CAGGTGGCTGGACTTTTGAGAGG - Intronic
1163513322 19:17748493-17748515 CTGGAGCCTGGACTTGGGGGGGG + Intronic
1163710749 19:18845291-18845313 GAGGTGCTGGTACTTGGGAGTGG + Intronic
1165423526 19:35733483-35733505 CAGGTTCCAGGGCTTGGCAGTGG + Exonic
1165428143 19:35756791-35756813 CAGGTGCCAGGCCTGGGGAGGGG - Exonic
1165788691 19:38477868-38477890 CAGGTGCCGGGGCTGGGGGGAGG + Exonic
1165941907 19:39418798-39418820 CAGGTGTCTGTGCTTGGGAATGG - Exonic
1166233295 19:41438403-41438425 CAGGCGCAGGGACTGGGGAGGGG + Exonic
1166528354 19:43527071-43527093 CGGGTGGCTGGACCTAGGAGGGG - Intronic
1166705533 19:44905989-44906011 CAGGGGACTGGACCTGGGAAGGG + Intronic
1167083259 19:47291538-47291560 GAGATGCCTGGAGTTGGGGGAGG - Intronic
1167328308 19:48838047-48838069 CAGTAGCCAGGGCTTGGGAGAGG + Exonic
1167604620 19:50475271-50475293 CAGGTGCCTGGAGCTGAGGGAGG + Intronic
925141199 2:1550836-1550858 CAGGTGCCCGCGCTTGGGAGCGG - Intergenic
925614818 2:5735120-5735142 CAGGTGCCTCGAGCTGGGAGTGG - Intergenic
926232441 2:11014613-11014635 CAGGTTCCTGGGGTTTGGAGTGG - Intergenic
926246019 2:11122914-11122936 CAGGTGGCTGGATTGGGGTGGGG - Intergenic
928182777 2:29081082-29081104 CGGGTGCCAGGAGTTGGGAGAGG + Intergenic
928470349 2:31568945-31568967 CAGGTGCCTAGAGTGGGAAGAGG + Intronic
930153449 2:48081009-48081031 CAGCTGACTGGACTAGAGAGAGG + Intergenic
930230575 2:48840433-48840455 ATGCTGCCTGGAGTTGGGAGAGG + Intergenic
930616656 2:53601044-53601066 CAGGTGGCTGGGCTGGGGAATGG - Intronic
930698969 2:54440137-54440159 CAGGTGCTTGCAATTTGGAGAGG + Intergenic
930957184 2:57217154-57217176 CAGGTGCCAGGAGGAGGGAGAGG - Intergenic
931005892 2:57849942-57849964 CAGGTGCCAGGAATGGGGAGAGG + Intergenic
932187505 2:69711513-69711535 TAGTTTCCTGGGCTTGGGAGTGG + Intronic
932398348 2:71463307-71463329 TGGGTGACTGGAGTTGGGAGAGG + Intronic
932667318 2:73708145-73708167 CAAGAGCCTGCACGTGGGAGGGG - Intergenic
934473999 2:94580660-94580682 CAGTTGCCAGGAGTTGGGGGAGG - Intergenic
935752188 2:106245413-106245435 CAGAGGCCTGGACTTGGGACCGG + Intergenic
935912600 2:107912959-107912981 CAGAGGCCTGGACTTGGGACCGG + Intergenic
936722692 2:115272743-115272765 CAGGTGCGTGGGCAGGGGAGGGG - Intronic
936885151 2:117300798-117300820 GAGCTGCCTGGAGCTGGGAGTGG - Intergenic
938248444 2:129796411-129796433 CTGGTGCCAGGACAGGGGAGAGG + Intergenic
938382217 2:130843142-130843164 CAGCTGCTGGGACTGGGGAGAGG - Intronic
939986299 2:148832713-148832735 AAGGAGCCTGGACTAGGGATGGG + Intergenic
941350902 2:164433963-164433985 AAGGTGCCTGGATTTGGGCTAGG - Intergenic
942444905 2:176071422-176071444 CAGATGCGTGGGCTTAGGAGTGG - Intergenic
943255027 2:185583732-185583754 GTGCTGCCTGGAGTTGGGAGAGG - Intergenic
945312627 2:208332858-208332880 AAGGTGGGTGGACTTGGGGGTGG - Intronic
946182296 2:217955974-217955996 CAGCTGCCTTGAAGTGGGAGGGG + Intronic
946184423 2:217971241-217971263 TAGTTACCTGGAGTTGGGAGTGG - Intronic
946352591 2:219165149-219165171 CAGGTACGTGGACCTGGGATGGG - Exonic
947812464 2:233013124-233013146 CAGGTGCCTGGACAGGACAGGGG - Exonic
947971145 2:234326530-234326552 CAGGTGCCATGGCTTGGGTGGGG + Intergenic
947988594 2:234469051-234469073 CAGGTGCCTGGACACCTGAGGGG + Intergenic
948214076 2:236215789-236215811 CAGGTGGCTGAAGTTGGGGGTGG - Intronic
948335003 2:237200805-237200827 CAGGTGCCGGGAGTGGTGAGAGG + Intergenic
948695966 2:239733155-239733177 CAGGGCCCTGGAATAGGGAGTGG + Intergenic
948695977 2:239733185-239733207 CAGGGCCCTGGAATAGGGAGTGG + Intergenic
948696016 2:239733335-239733357 CAGGGCCCTGGAATAGGGAGTGG + Intergenic
948696033 2:239733395-239733417 CAGGGCCCTGGAATAGGGAGTGG + Intergenic
948696098 2:239733635-239733657 CAGGGCCCTGGAATAGGGAGTGG + Intergenic
948946865 2:241224862-241224884 CAGGGGCCAGGAGCTGGGAGAGG - Exonic
1169309273 20:4521456-4521478 TGGGTGCCTGGAGTAGGGAGAGG - Intergenic
1170224216 20:13973955-13973977 CTGATCCCTGGACTTGGGAAGGG + Intronic
1170737146 20:19022110-19022132 CAGGTGCTGGGGCTTGAGAGAGG - Intergenic
1171236992 20:23535201-23535223 CAGGTGCCAGGAGCGGGGAGAGG + Intergenic
1171366723 20:24629976-24629998 CAAGTGCCTGGAGTCAGGAGCGG + Intronic
1171429147 20:25069580-25069602 TAGGTGCCTTGACTTGGGAGAGG + Intergenic
1172487401 20:35306625-35306647 CTGTTGCCAGGACTTGGGAGGGG + Intronic
1173643374 20:44618630-44618652 CTGGCGCCGGGACTTGGGCGGGG + Exonic
1173870887 20:46341490-46341512 CAAGTGCCTGAACTTGGGAGTGG - Intergenic
1174361519 20:50031805-50031827 CAGGTGCCTGGACGTGTGTGTGG + Intergenic
1174390331 20:50214890-50214912 CAGGAGCCTGGACCAGGGTGGGG + Intergenic
1174563180 20:51445721-51445743 GAGGTCCCTGCCCTTGGGAGTGG - Intronic
1174705712 20:52653871-52653893 CCAGTGCCTGGACTAGGGTGAGG - Intergenic
1174982034 20:55407589-55407611 AAGCTGCCTGGAGCTGGGAGAGG + Intergenic
1175895447 20:62333818-62333840 AAGGTGGCGGGGCTTGGGAGTGG + Intronic
1176042106 20:63071349-63071371 CAGGTGCCCGGGCTGGTGAGAGG + Intergenic
1177009735 21:15717338-15717360 AAGGTGCCTGCACTTTGTAGAGG - Intergenic
1177624943 21:23646902-23646924 CAGGTGCTGGGAGTGGGGAGAGG + Intergenic
1178244304 21:30936364-30936386 CAGGTGCTGGGAGTGGGGAGAGG - Intergenic
1178467166 21:32859063-32859085 CAGGTGCTGGGAGCTGGGAGAGG + Intergenic
1179717559 21:43297698-43297720 CAGGTGCCAGGCGTGGGGAGGGG - Intergenic
1179882993 21:44301109-44301131 CAGGTGCCTGAAGCTGGGTGGGG - Intronic
1179955292 21:44735017-44735039 CCGGGGCCTGGGGTTGGGAGAGG - Intergenic
1180059163 21:45375744-45375766 CAGAGCCCTGGACTTGGGAATGG - Intergenic
1181012897 22:20052718-20052740 AAGGTGCTTGTGCTTGGGAGTGG + Intronic
1181077492 22:20391311-20391333 CAGGAACCTGTACATGGGAGTGG - Intergenic
1182907493 22:33950578-33950600 GAGGTGACTGGACATGGGGGTGG + Intergenic
1183265103 22:36819984-36820006 CACGGGCCTGGGGTTGGGAGCGG + Intergenic
1183669702 22:39265165-39265187 CAGGACCCTGGACTTGGGAATGG - Intergenic
1184068013 22:42131090-42131112 CAGGAGCTTGGAGTGGGGAGAGG - Intergenic
1184411905 22:44330897-44330919 CAGGGGCACGCACTTGGGAGGGG + Intergenic
1184482508 22:44756117-44756139 CAGTGGCCTGGACTTTGCAGGGG + Intronic
1184661259 22:45966600-45966622 CAGGTGCCTGGAGCTGGGCCTGG - Intronic
1184884244 22:47332470-47332492 CATGTGGATGGGCTTGGGAGTGG + Intergenic
1185397831 22:50601493-50601515 CAGGGGCCTGGAGCTGCGAGTGG + Intronic
949543873 3:5055438-5055460 CTGGGGCCTTGTCTTGGGAGTGG + Intergenic
952956213 3:38559193-38559215 CAGGTGTCTGGGCTTGAGATTGG + Intronic
953670545 3:44958679-44958701 CAGGTTCCTGGAATTGGATGTGG + Intronic
953919610 3:46942948-46942970 CAGGTGACTGGGGTTGGGGGAGG + Intronic
954070011 3:48136090-48136112 AAACTGCCTGGACATGGGAGAGG - Intergenic
954419835 3:50412952-50412974 CAGGGCCCAGGACTTGGGACAGG + Intronic
954475479 3:50740996-50741018 AAGGTACCTAGACTTGGGGGAGG - Intronic
957613973 3:82505428-82505450 CAGGTGCTGGGAGTGGGGAGAGG - Intergenic
959714215 3:109414949-109414971 TAGTTGCCTGGAGATGGGAGTGG + Intergenic
962345765 3:134618158-134618180 TAGGTGCCTGTGCTTGGCAGTGG + Intronic
962503906 3:136026865-136026887 GAGGTGGCTGGAGGTGGGAGTGG - Exonic
962767675 3:138580292-138580314 GAGCTGCCTGGAATTGGGGGAGG - Intronic
962898945 3:139740344-139740366 CAGGAGCCTGGACTTTTGTGTGG - Intergenic
963246098 3:143064688-143064710 CAGCTGCCTGGTCTTGGGTAAGG + Intergenic
963250107 3:143095423-143095445 CAGGTGCCAGGAGCGGGGAGAGG - Intergenic
963802339 3:149688404-149688426 GAGCTGCCTGGAGTTGGGGGAGG - Intronic
964140720 3:153396361-153396383 GAGGTGCCTGGAGTTGGGGGAGG + Intergenic
964590804 3:158360724-158360746 CAGGTGCCAGGAGTGGAGAGAGG + Intronic
965181150 3:165404994-165405016 GAGCTGACTGGAATTGGGAGAGG - Intergenic
965975239 3:174613162-174613184 GAGCTGCCTGGAGCTGGGAGTGG + Intronic
965980415 3:174682526-174682548 GAGATGCCTGGAGTTGGGGGAGG - Intronic
966516069 3:180821965-180821987 CACCTCCCTGGACTTGGGAGAGG - Intronic
966659845 3:182402135-182402157 TGGTTGCCTGGAGTTGGGAGAGG + Intergenic
966856428 3:184196943-184196965 CAGGAGCATGGCCTTGGGAGAGG + Intronic
967133981 3:186497612-186497634 CTGCTGCCTGGACTGGGGGGAGG - Intergenic
967684344 3:192402068-192402090 TAAGTACCTGGACTTCGGAGTGG - Intronic
968035446 3:195544068-195544090 CTGCGGACTGGACTTGGGAGAGG - Intergenic
968233477 3:197017435-197017457 TAGGTACCTGGAGTTGGGTGCGG - Intronic
968526214 4:1058890-1058912 CAGGAGCCAAGGCTTGGGAGAGG - Intronic
969535654 4:7754940-7754962 CAGGAGCCTGAACCTGGGAATGG + Intergenic
970009826 4:11446888-11446910 CAGGAGGCTGGACCTGGGAGGGG + Intergenic
970915430 4:21328442-21328464 GAGGTGCCTGGAGCTGGGGGTGG + Intronic
971363334 4:25956344-25956366 CAGAGGCCTGGACTTGTGACTGG + Intergenic
973238018 4:47926978-47927000 CAGGTGCTGGGACTTGCGGGAGG - Intronic
973724224 4:53756857-53756879 TAGGAGCCTTGACTTTGGAGTGG + Intronic
978385647 4:108173151-108173173 CAGGCGCCTGAACTTGGCATGGG + Intergenic
978520338 4:109609088-109609110 GAGCTGCCTGGAGCTGGGAGTGG + Intronic
979395152 4:120178545-120178567 GAGCTGCCTGGAGCTGGGAGAGG - Intergenic
980480846 4:133385358-133385380 CAGGTGCCTGGAGCAGGGAAAGG - Intergenic
982574779 4:157096026-157096048 CTGATGGCTGGAATTGGGAGTGG + Intronic
982673459 4:158349032-158349054 CGGGGGCCTGGACTTGTGACTGG + Intronic
982802684 4:159723401-159723423 CAGGTGCTGGGAGTGGGGAGAGG + Intergenic
982856298 4:160386045-160386067 CAGGTGCCTGGAGTGGGGAGAGG + Intergenic
982918951 4:161250071-161250093 CAGGTGCTAGGAGTGGGGAGAGG + Intergenic
984526825 4:180867243-180867265 CAGGTGCCCAGAGTGGGGAGAGG + Intergenic
985006241 4:185537551-185537573 CAAGTGGCTGGAGTTGGGAGGGG + Intergenic
985916072 5:2919996-2920018 CAGGTGCTAGGAGTGGGGAGAGG - Intergenic
986478299 5:8158503-8158525 CAGGAACCTGCACTTGGGAGGGG - Intergenic
987139370 5:14929703-14929725 CAGAGGCCTGGACTTTGGATTGG + Intergenic
988931741 5:36041507-36041529 AAGCTGCCTGGAGTTGGGGGAGG - Intronic
990211106 5:53482013-53482035 CTGGTGCCCGGACGTGGGCGCGG + Intronic
991005814 5:61827089-61827111 GAGCTGCCTGGACTTGAGTGAGG - Intergenic
991979932 5:72220192-72220214 CATGTACCTGGGCTGGGGAGAGG + Intronic
992180594 5:74193852-74193874 AAGGTGCCTAGACTTGAGAAGGG - Intergenic
994781214 5:104093252-104093274 CAGGTGCCTGGAAAGGGGAGAGG + Intergenic
995065056 5:107852108-107852130 AAGATGCCTGGGTTTGGGAGGGG + Intergenic
995873082 5:116762786-116762808 CAGGTGCCTGGATTGGGAAGAGG + Intergenic
995946116 5:117648365-117648387 CTGGTGCCTGGAGGTGGGTGGGG - Intergenic
996817324 5:127588587-127588609 CAGAGGCCTGGACTTGTGATTGG - Intergenic
997194945 5:131973150-131973172 CAAGTTCCAGGACTTGGCAGTGG + Intronic
997468195 5:134102145-134102167 CTGGTGGCTGGATTTGGAAGGGG - Intergenic
997779412 5:136641674-136641696 CAGATGGCTGGACTGGGGTGTGG - Intergenic
999315224 5:150579254-150579276 CAGGTGCCAGGAGCAGGGAGAGG - Intergenic
999651592 5:153773364-153773386 CAGGGGACTGGACTTGGGCCAGG + Intronic
999667363 5:153927110-153927132 GTGCTGCCTGGGCTTGGGAGAGG - Intergenic
1000250690 5:159491917-159491939 CAGGTTCCTGCACTTTAGAGAGG - Intergenic
1000266204 5:159640754-159640776 CAGTTGCCAGGAGCTGGGAGAGG - Intergenic
1001844536 5:174910303-174910325 CAGAAGCCTGGGCTGGGGAGTGG - Intergenic
1002559959 5:180074256-180074278 CACCAGCCTGTACTTGGGAGTGG + Intergenic
1002986130 6:2191573-2191595 CAGGTGCCTGGAGCGGGGAGAGG - Intronic
1003493203 6:6641793-6641815 CAGGTTCAAGGACTTGGGGGTGG + Intronic
1003515625 6:6816107-6816129 CAGGTGCTTGGACATGGGGCAGG + Intergenic
1004004777 6:11628595-11628617 CAGGTGGCTGGTCATGTGAGTGG + Intergenic
1004542894 6:16568786-16568808 CAGATAACTGGACTTGGGAAGGG - Intronic
1005715423 6:28542864-28542886 CAGGTGCCTGGAGTCCGGGGTGG - Intergenic
1005970006 6:30753323-30753345 AAGGTGCCTGGATTTGGGTTGGG - Intergenic
1006182714 6:32163755-32163777 CAGATGCCTGGTCTAGGGTGGGG + Intronic
1007285906 6:40747150-40747172 AAGGGGCGTGGACTTGGGGGTGG - Intergenic
1007351047 6:41273741-41273763 CAGGTGGCTGGACTTGGAGATGG + Intronic
1007967225 6:46014545-46014567 CAGTCGCCAGGACTTGGGGGAGG - Intronic
1012551372 6:100467219-100467241 CAGGTCCCTGGGCCCGGGAGGGG - Intergenic
1013510499 6:110840363-110840385 CAAAGGCCTGGACTTGGGACTGG - Intronic
1014761190 6:125358561-125358583 CAGTTGCCTGGAGTTGGGAATGG - Intergenic
1015274958 6:131374492-131374514 CAGGTACAGGGCCTTGGGAGAGG + Intergenic
1016567352 6:145471561-145471583 CAGCTGCCTGGAGTGGGGAGTGG - Intergenic
1016663128 6:146604311-146604333 CCCCTGCGTGGACTTGGGAGAGG - Intronic
1016669536 6:146687242-146687264 CAAGAGGCTTGACTTGGGAGAGG - Intronic
1018729418 6:166637468-166637490 CAGGTGCCAGGTCGGGGGAGAGG + Intronic
1019176908 6:170164651-170164673 TGGGTCCCTGGACGTGGGAGAGG + Intergenic
1019708552 7:2507920-2507942 CAAGTGCCCTGACCTGGGAGGGG + Intergenic
1020226148 7:6281835-6281857 CAGGTGGCTGTACTTGTGTGAGG - Intergenic
1020586686 7:10078694-10078716 CAGGTGCCAAGAGTGGGGAGAGG - Intergenic
1021158938 7:17247492-17247514 CAGAGGCCTGGACTTGCGACTGG + Intergenic
1021912818 7:25403277-25403299 CAGGAGCCTGAACTAGAGAGGGG - Intergenic
1022171318 7:27834691-27834713 CATGTGCCTGGGCCTCGGAGGGG - Intronic
1022171966 7:27839500-27839522 CAGAGGCGTGGAGTTGGGAGAGG - Intronic
1022483683 7:30761025-30761047 CAGGGGCCATGACTTAGGAGTGG - Intronic
1023660090 7:42462188-42462210 GAGCAGCCTGGACTTGGGAAAGG - Intergenic
1023837037 7:44074336-44074358 CAGGTCCCTTCACTGGGGAGGGG + Intronic
1024136161 7:46411517-46411539 CAGAAGCCTGGACTTGAGACTGG - Intergenic
1024331779 7:48162212-48162234 CAGATGCCTGGACTTGCAACTGG - Intergenic
1024580691 7:50798081-50798103 CAGTTGCCTGGAGTAGGAAGGGG - Intergenic
1026030612 7:66789914-66789936 CAGTTGCCAGCACTTGGAAGAGG + Intronic
1026370259 7:69691581-69691603 CAGGTGCCGGGAGTGGGGAGAGG + Intronic
1026877609 7:73888376-73888398 GAGGTGGCTGGACTGGGCAGGGG + Intergenic
1027207511 7:76113314-76113336 CAGTTGCCAGCACTTGGAAGAGG - Intergenic
1027244518 7:76358447-76358469 CGCGGGGCTGGACTTGGGAGCGG - Intronic
1027575106 7:79921983-79922005 CGGGCGCCTGGAGCTGGGAGAGG - Intergenic
1027911735 7:84260553-84260575 TAGGTGCCGGGAGTGGGGAGAGG - Intronic
1027921397 7:84399899-84399921 AAGATGCCTGGAGTTGGGGGAGG - Intronic
1028148588 7:87345847-87345869 AAGGTGCCTGGATTTGGTGGGGG + Intronic
1029074583 7:97925806-97925828 GAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1029425917 7:100493922-100493944 GGGGCGCCTGGACTGGGGAGGGG + Exonic
1030243725 7:107359218-107359240 TAGGTGCTGGGAGTTGGGAGAGG - Intronic
1031169927 7:118280322-118280344 CAGGTGCCTGGACTAGGCTTGGG - Intergenic
1031565988 7:123297225-123297247 GAGCTGCCTGGAGTTGGAAGAGG - Intergenic
1031786485 7:126040552-126040574 CAGGCGCCAGGACTGGAGAGAGG - Intergenic
1032468950 7:132164377-132164399 CAGGTGCAGGGACTTGGCAGGGG - Intronic
1033213214 7:139475799-139475821 CAGAGGCCTGGACTTGCGACGGG + Intronic
1033757222 7:144404910-144404932 CAGGTGCTTGGAGCTGGGTGGGG + Intronic
1033813960 7:145050562-145050584 GAGCTACCTGGACTTGGGGGAGG + Intergenic
1034829154 7:154294285-154294307 CAGGTGGAAGGAGTTGGGAGTGG + Intronic
1035596749 8:864224-864246 CAGGTGCAGGGACTTGGGTAGGG + Intergenic
1036133126 8:6134757-6134779 CAGGTGGCTGGGTTTGGCAGGGG + Intergenic
1036257672 8:7218579-7218601 AAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1036258923 8:7225578-7225600 AAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1036309724 8:7677175-7677197 AAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1036359812 8:8068944-8068966 AAGGTGCCTGGTCTTGGGGAAGG - Intergenic
1036829607 8:12011706-12011728 AAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1036891146 8:12598026-12598048 AAGGTGCCTGGTCTTGGGGAAGG + Intergenic
1037776045 8:21836289-21836311 CAGCTGCCAGGAGCTGGGAGAGG - Intergenic
1037903715 8:22703307-22703329 CAGGGGCCTGGATTTTGAAGGGG - Intergenic
1038315621 8:26482245-26482267 AAAGTGCCTGGACTTGGCAGTGG + Intronic
1038426421 8:27467153-27467175 CGGGTCCATGGCCTTGGGAGGGG - Intronic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1042980362 8:74519443-74519465 GAGCTGCCTGGAGCTGGGAGAGG - Intergenic
1043929523 8:86075048-86075070 CACGTGCATGCACTTGGAAGGGG - Intronic
1044878073 8:96692457-96692479 GAGCTGCCTGGAGCTGGGAGAGG - Intronic
1045439221 8:102193240-102193262 CAGGTGGCTGGAGTGGGAAGAGG - Intergenic
1045492016 8:102677112-102677134 CAGGTGCCTGGAATTAGGTGAGG - Intergenic
1045674542 8:104592425-104592447 CAGGTACATGCAATTGGGAGTGG + Intronic
1047510741 8:125513448-125513470 CGGTCGCCTGGACCTGGGAGCGG + Intergenic
1049018669 8:139939346-139939368 CAGGTGCCAGCACCTGAGAGGGG + Intronic
1049645852 8:143735290-143735312 CAGCTGTGTGGACTAGGGAGAGG + Intergenic
1049813435 8:144586657-144586679 CCGGTGCCTGGAAGTGGGTGTGG - Intronic
1050426429 9:5516808-5516830 CAGGTGCCAGGAGTGGGAAGAGG + Intronic
1050485385 9:6129124-6129146 CAGGGGCCTGTATTTGGGAGGGG + Intergenic
1050808817 9:9718621-9718643 CAGGTGCTTGGAGCAGGGAGAGG - Intronic
1051029693 9:12658868-12658890 CAGGTGCTGGGAGTTGGGAGAGG + Intergenic
1051469611 9:17423092-17423114 GGGTTGCCTGGAGTTGGGAGAGG + Intronic
1052580691 9:30350173-30350195 CAGGTGCCAGGAGTGTGGAGAGG + Intergenic
1053288779 9:36866491-36866513 CAGGTCCCAGGGCCTGGGAGAGG + Intronic
1053934051 9:43133757-43133779 CAGTTGCCAGGAGTTGGGGGAGG + Intergenic
1054279644 9:63119481-63119503 CAGTTGCCAGGAGTTGGGGGAGG - Intergenic
1054500544 9:65870888-65870910 CAGTTGCCAGGAGTTGGGGGAGG - Intergenic
1057644553 9:96860394-96860416 AGGCTGCCTGGAGTTGGGAGAGG - Intronic
1058006689 9:99923702-99923724 CAAGGGCCTGGACTTGTGACTGG - Intronic
1058272646 9:102992520-102992542 GAGGTAACTGGACATGGGAGTGG + Intergenic
1058525143 9:105850066-105850088 CAGGAACCTGGACTCTGGAGGGG + Intergenic
1059041888 9:110823392-110823414 GAGCTGCCTGGAGCTGGGAGAGG - Intergenic
1060240180 9:121896647-121896669 CAGGTGCCTGAACTTCAGTGCGG + Intronic
1061035915 9:128114279-128114301 CAGGTGCCTGCCCTCGGGAAGGG + Intergenic
1061421976 9:130477595-130477617 TGGGTGCCTGAGCTTGGGAGAGG + Intronic
1062363474 9:136198260-136198282 CAGCTGCTTGGAGTTGGGGGAGG - Intronic
1062442829 9:136578792-136578814 CAGGGGCCTGGCCTGGGGCGGGG + Intergenic
1062654068 9:137593062-137593084 AAGGTGCCTGCCCCTGGGAGAGG - Intergenic
1186181620 X:6978851-6978873 CTGGTGAATGGACTTGGGAATGG - Intergenic
1186390259 X:9151617-9151639 CTGGGGTCTGGAATTGGGAGGGG - Intronic
1186595592 X:10978448-10978470 CTGATGACTGGACTTGGTAGAGG - Intergenic
1187104339 X:16224604-16224626 GAGGTGCTTGGTCATGGGAGTGG - Intergenic
1188597809 X:31922474-31922496 CAGAGGCCTGGACTTGAGACTGG + Intronic
1189411768 X:40779185-40779207 GAGCTGCCTGGAACTGGGAGAGG + Intergenic
1190142519 X:47860636-47860658 CAGAGGCCTGGACTTGTGATTGG + Intronic
1190305532 X:49079643-49079665 CATGCGGCTGGTCTTGGGAGAGG - Intronic
1190467896 X:50745461-50745483 CTGGGCCCTCGACTTGGGAGTGG + Intronic
1191953041 X:66615352-66615374 TAGGTCCCTGAACTTGGGGGTGG - Intronic
1191991127 X:67038349-67038371 GAGGTGCCTGGAGCTGGGAGGGG + Intergenic
1192436140 X:71145025-71145047 GAGGAGCCTGGGATTGGGAGGGG - Intronic
1194016354 X:88625759-88625781 TAGCTGCCTGGAGTTGGCAGTGG - Intergenic
1197400004 X:125978478-125978500 GAGCTGCCTGGAGTTGGGTGTGG - Intergenic
1198118926 X:133571697-133571719 CAGTGGCCTGAGCTTGGGAGGGG + Intronic
1199971896 X:152867489-152867511 CAAATGCCAAGACTTGGGAGTGG + Intronic
1200097041 X:153669333-153669355 CAGGTGCCTGGGACTGGGAAGGG - Intergenic
1200749220 Y:6929462-6929484 CAGGTGCTGGGATTGGGGAGAGG + Intronic
1200984517 Y:9291383-9291405 CAGGTGCTTCAAGTTGGGAGGGG - Intergenic