ID: 1106428591

View in Genome Browser
Species Human (GRCh38)
Location 13:29657874-29657896
Sequence GTCTCTGGCCAGCACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106428591_1106428595 13 Left 1106428591 13:29657874-29657896 CCAGGCTGGTGCTGGCCAGAGAC No data
Right 1106428595 13:29657910-29657932 GCTTCTCCACTCCTGCAGCCTGG No data
1106428591_1106428597 19 Left 1106428591 13:29657874-29657896 CCAGGCTGGTGCTGGCCAGAGAC No data
Right 1106428597 13:29657916-29657938 CCACTCCTGCAGCCTGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106428591 Original CRISPR GTCTCTGGCCAGCACCAGCC TGG (reversed) Intergenic
No off target data available for this crispr