ID: 1106431876

View in Genome Browser
Species Human (GRCh38)
Location 13:29688340-29688362
Sequence GAGATCTAGCTCCACTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106431865_1106431876 30 Left 1106431865 13:29688287-29688309 CCATGATGGTCAGGTGCCGGAGG No data
Right 1106431876 13:29688340-29688362 GAGATCTAGCTCCACTATGGAGG No data
1106431869_1106431876 14 Left 1106431869 13:29688303-29688325 CCGGAGGGGAGTGAACAGTGCAT No data
Right 1106431876 13:29688340-29688362 GAGATCTAGCTCCACTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106431876 Original CRISPR GAGATCTAGCTCCACTATGG AGG Intergenic
No off target data available for this crispr