ID: 1106432042

View in Genome Browser
Species Human (GRCh38)
Location 13:29690137-29690159
Sequence TTTATAGAGGCCACACTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106432039_1106432042 1 Left 1106432039 13:29690113-29690135 CCTTTACCTGGAAAATTATAAAA No data
Right 1106432042 13:29690137-29690159 TTTATAGAGGCCACACTCAATGG No data
1106432040_1106432042 -5 Left 1106432040 13:29690119-29690141 CCTGGAAAATTATAAAACTTTAT No data
Right 1106432042 13:29690137-29690159 TTTATAGAGGCCACACTCAATGG No data
1106432038_1106432042 7 Left 1106432038 13:29690107-29690129 CCAAGACCTTTACCTGGAAAATT No data
Right 1106432042 13:29690137-29690159 TTTATAGAGGCCACACTCAATGG No data
1106432036_1106432042 17 Left 1106432036 13:29690097-29690119 CCAAAGATGTCCAAGACCTTTAC No data
Right 1106432042 13:29690137-29690159 TTTATAGAGGCCACACTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106432042 Original CRISPR TTTATAGAGGCCACACTCAA TGG Intergenic
No off target data available for this crispr